Family Search for PF06500 (DUF1100)

PF06500.11 hits 38 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

FRSA_VIBVU / Q8DF91 Esterase FrsA; EC 3.1.1.1 from Vibrio vulnificus (strain CMCP6) (see 3 papers)
WP_011078432 esterase FrsA from Vibrio vulnificus
Aligns to 4:414 / 415 (99.0%), covers 99.8% of PF06500, 781.3 bits

• function: Catalyzes the hydrolysis of esters (PubMed:30951551). In vitro, prefers short chain alkanoate ester as substrate. Displays highest activity towards p-nitrophenyl acetate (pNPA). Has weaker activity towards p-nitrophenyl butyrate (pNPB) (PubMed:30951551).
  catalytic activity: a carboxylic ester + H2O = a carboxylate + an alcohol + H(+) (RHEA:21164)
  subunit: Monomer in solution (PubMed:21623357). Homodimer (PubMed:30951551). Forms a 1:1 complex with the unphosphorylated form of the EIIA component of the glucose-specific PTS system (IIAGlc) (PubMed:21623357).
• Purification and biochemical characterization of FrsA protein from Vibrio vulnificus as an esterase
  Wang, PloS one 2019
  • “...VvFrsA gene was exactly same as the amino acid sequence of VvFrsA protein (protein ID: WP_011078432). Therefore recombinant plasmid of pET28a-VvFrsA was successfully constructed. 10.1371/journal.pone.0215084.g001 Fig 1 Construction of expression plasmid and purification of VvFrsA. A . Agarose gel of pET28a-VvFrsA plasmid. M: DNA marker; 1:...”
• FrsA functions as a cofactor-independent decarboxylase to control metabolic flux.
  Lee, Nature chemical biology 2011 (PubMed)
  • GeneRIF: FrsA converts pyruvate to acetaldehyde and carbon dioxide in a cofactor-independent manner and that its pyruvate decarboxylation activity is enhanced by the dephosphorylated form of IIAGlc (d-IIAGlc)

VC_2276 esterase FrsA from Vibrio cholerae O1 biovar El Tor str. N16961
VC2276 conserved hypothetical protein (NCBI ptt file) from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 4:414 / 415 (99.0%), covers 99.8% of PF06500, 778.8 bits

• Genomic analysis of pathogenic isolates of Vibrio cholerae from eastern Democratic Republic of the Congo (2014-2017)
  Irenge, PLoS neglected tropical diseases 2020
  • “...c.457T>C 69 missense_variant p.Ser153Pro I:2249832_C/T VC_2088 (Succinate dehydrogenase, iron-sulfur protein) c.428G>A 69 missense_variant p.Gly143Asp I:2431057_A/G VC_2276 (Conserved hypothetical protein) c.229T>C 515 missense_variant p.Ser77Pro I:2433926_A/G VC_2279 (Aminoacyl-histidine Dipeptidase) c.4A>G 69 missense_variant p.Thr2Ala II:189289_C/A VC_A0172 (Conserved hypothetical protein) c.894G>T 69 missense_variant p.Trp298Cys II:193789_T/G VC_A0176 (Methyl accepting chemotaxis protein)...”
• Characterization of ferric and ferrous iron transport systems in Vibrio cholerae
  Wyckoff, Journal of bacteriology 2006
  • “...of the G protein signature motifs (24, 30). A small ORF (VC2276), initiating with a GTG that overlaps the feoB stop codon, is also present. We refer to this ORF...”

YPO3224 conserved hypothetical protein (NCBI ptt file) from Yersinia pestis CO92
y0964 fermentation/respiration switch protein (RefSeq) from Yersinia pestis KIM
Aligns to 1:415 / 415 (100.0%), covers 99.8% of PF06500, 746.4 bits

• Comparative genomics of 2009 seasonal plague (Yersinia pestis) in New Mexico
  Gibbons, PloS one 2012
  • “...YPO3112 dnaX - DNA pol III subunits gamma & tau D589N Chrom 38 3588660 G/A YPO3224 frsA - fermentation/respiration switch protein Synonymous Chrom 39 4081854 G/T YPO3661 Putative sulfite oxidase subunit YedZ H164N Phylogenetic analyses of the MLVA and SNP/Indel data showed that unique genotypes were...”
• Proteomic analysis of iron acquisition, metabolic and regulatory responses of Yersinia pestis to iron starvation
  Pieper, BMC microbiology 2010
  • “...y0869 cybC cytochrome b(562) PP Fur 626 5035 5.64 0.13 0.03 4.746 N.D. 3.160 59 y0964 frsA fermentation/respiration switch protein U 586 51326 5.98 0.15 0.07 2.208 0.000 1.875 60 y1128 bglX putative beta-glucosidase PP 2324 81506 5.43 3.01 0.52 5.822 0.000 1.740 61 y1189 gltI...”
• The role of relA and spoT in Yersinia pestis KIM5 pathogenicity
  Sun, PloS one 2009
  • “...LcrH (SycD) secretion chaperone YPCD1.30c chaperone for YopBD MALDI 2.3 2 FrsA (fermentation/respiration switch protein) y0964 FrsA may promote fermentation MALDI 2.8 3 MetK (S-adenosylmethionine synthetase) y3314 catalyzes the formation of S-adenosylmethionine from methionine and ATP; methionine adenosyltransferase MALDI 4.2 4 CodA (cytosine deaminase) y3946 salvage...”

YafA / b0239 fermentation-respiration switch protein from Escherichia coli K-12 substr. MG1655 (see 4 papers)
FRSA_ECOLI / P04335 Esterase FrsA; Fermentation/respiration switch protein; EC 3.1.1.1 from Escherichia coli (strain K12) (see 2 papers)
P04335 carboxylesterase (EC 3.1.1.1) from Escherichia coli (see paper)
Aligns to 1:414 / 414 (100.0%), covers 100.0% of PF06500, 738.8 bits

• function: Catalyzes the hydrolysis of esters (PubMed:15808744). Displays esterase activity toward pNP-butyrate (PubMed:15808744). May stimulate mixed-acid fermentation by acting as a fermentation/respiration switch that down-regulates respiration and up- regulates fermentation rates (PubMed:15169777).
  catalytic activity: a carboxylic ester + H2O = a carboxylate + an alcohol + H(+) (RHEA:21164)
  subunit: Forms a 1:1 complex specifically with the unphosphorylated form of the EIIA component of the glucose-specific PTS system (IIAGlc).
  disruption phenotype: Deletion of the gene increases cell respiration rate on several sugars including glucose.

ECs0266 hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
Aligns to 1:414 / 414 (100.0%), covers 100.0% of PF06500, 734.8 bits

• Gene expression induced in Escherichia coli O157:H7 upon exposure to model apple juice
  Bergholz, Applied and environmental microbiology 2009
  • “...ECs0203 ECs0214 ECs0233 ECs0239 ECs0247 ECs0252 ECs0253 ECs0266 ECs0272 ECs0429 ECs0445 ECs0478 ECs0514 ECs0552 ECs0561 ECs0629 ECs0646 ECs0661 ECs0728 ECs0781...”

Sesv_0065 esterase FrsA from Salmonella enterica subsp. enterica serovar Virchow str. SVQ1
Aligns to 1:414 / 414 (100.0%), covers 100.0% of PF06500, 709.3 bits

• Genome analysis and CRISPR typing of Salmonella enterica serovar Virchow
  Bachmann, BMC genomics 2014
  • “...20 Forward 1337 GI-pheV (3 boundary) pheV-C/R GAGAGAACTGGAGCCACAGG 20 Reverse SV-0065-F GCAGAAAGCCTGTCAGGAAC 20 Forward 856 Sesv_0065 SV-0065-R CACCGGGTTAAAAGGGATCT 20 Reverse SV-1374-F TTTTACGGTCTGGGAAGCGAC 21 Forward 623 Sesv_1374 SV-1374-R TATGCGGATTAACCGCCTGC 20 Reverse SV-0106-F GGGCCTGCATTTCTTGTCTA 20 Forward 935 Sesv_0106 SV-0106-R GCCCTTTCTGGATAAGACGA 20 Reverse SV-0279-F CGCAGGTACGCGTGTTATTA 20 Forward 814 Sesv_0279...”

MAP3757c hypothetical protein (NCBI) from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 19:357 / 368 (92.1%), covers 69.6% of PF06500, 67.6 bits

• Disruption of Mycobacterium avium subsp. paratuberculosis-specific genes impairs in vivo fitness
  Wang, BMC genomics 2014
  • “...0.0111 0.0057 MmpS1 family protein 14 MAP3751 (MAPK_0017) 0.0746 0.0970 transmembrane transport protein, MmpL4_5 14 MAP3757c (MAPK_0011) 0.0923 0.0679 H.P. 14 MAP3759c (MAPK_3761) 0.0836 0.0106 Tranposase 14 MAP3760c (n. a.) 0.0400 0.0065 H.P. 14 MAP3763c (MAPK_3765) 0.0372 0.0267 PapA2_3 14 MAP3764c (MAPK_3766) 0.1181 0.1928 Pks2 15...”
  • “...of MAP3750 and MAP3751 , encoding membrane protein MmpS1 and MmpL4. Other depleted genes include MAP3757c , a probable leucyl-tRNA synthetase, MAP3759 a transposase, MAP3760c a predicted methylase and two adjacent genes, MAP3763c , and MAP3764c, predicted to code for proteins involved in polyketide synthesis (PapA3...”

HMPREF1120_02312 hypothetical protein from Exophiala dermatitidis NIH/UT8656
Aligns to 65:396 / 415 (80.0%), covers 72.0% of PF06500, 54.7 bits

• Comparative genomic and transcriptomic analysis of wangiella dermatitidis, a major cause of phaeohyphomycosis and a model black yeast human pathogen
  Chen, G3 (Bethesda, Md.) 2014
  • “...W. dermatitidis , including the known polyketide synthase (HMPREF1120_03173, WdPks1p) and the alpha/beta hydrolase AYG1 (HMPREF1120_02312, WdYG1), both of which are required for melanin production in W. dermatitidis ( Feng et al. 2001 ; Wheeler et al. 2008 ). A second candidate alpha-beta hydrolase similar to...”
  • “...Afu4g14560 An09g05730 (FwnA) Afu7g00160 An11g07310 Ayg1 Afu2g17550(Ayg1) An14g05350 (Ayg1) HMPREF1120_00377 0.39 8.55e02 0.12 5.26e01 Abhydrolase HMPREF1120_02312 0.32 5.16e02 0.67 7.33e07 Arp2 Afu2g17560 (Arp2) An02g00220 HMPREF1120_05939 1.25 9.27e16 0.18 1.97e01 1,3,6,8-Tetrahydroxynaphthalene reductase Arp1 Afu2g17580 (Arp1) An08g09920 HMPREF1120_07724 0.74 3.10e06 1.27 8.13e23 Scytalone dehydratase Abr2 Afu2g17530 (Abr2) An01g13660...”

DHPON_PAENI / Q93NG6 2,6-dihydropseudooxynicotine hydrolase; EC 3.7.1.19 from Paenarthrobacter nicotinovorans (Arthrobacter nicotinovorans) (see 3 papers)
Q93NG6 2,6-dihydroxypseudooxynicotine hydrolase (EC 3.7.1.19) from Paenarthrobacter nicotinovorans (see paper)
Q93NG6 2,6-dihydroxypseudooxynicotine hydrolase (EC 3.7.1.19) from Paenarthrobacter nicotinovorans (see 3 papers)
Aligns to 29:245 / 367 (59.1%), covers 48.4% of PF06500, 47.6 bits

• function: L-nicotine is used as a growth substrate. Plays a role in nicotine catabolism by cleaving a C-C bond in 2,6- dihydroxypseudooxynicotine.
  catalytic activity: 2,6-dihydroxypseudooxynicotine + H2O = 2,6-dihydroxypyridine + 4-(methylamino)butanoate + H(+) (RHEA:34167)
  subunit: Homodimer.

Noca_0613 protein of unknown function DUF1100, hydrolase family protein (NCBI) from Nocardioides sp. JS614
Aligns to 70:283 / 383 (55.9%), covers 36.3% of PF06500, 45.6 bits

• KEGG: new perspectives on genomes, pathways, diseases and drugs
  Kanehisa, Nucleic acids research 2017
  • “...KEGG pathway map of nicotinate and nicotinamide metabolism (map00760) for Nocardioides sp. JS614 (nca), where Noca_0613 for EC:3.7.1.19 is marked red. ( B ) Ortholog table for the KEGG module of nicotine degradation pyridine pathway (M00810), where coloring of positional correlation indicates that Noca_0613 for EC:3.7.1.19...”
  • “...the nicotine degradation pyridine pathway module (M00810) for Nocardioides sp. JS614 (nca), where the gene Noca_0613 (Figure 1A ) for K19188 with EC:3.7.1.19 is marked red. Figure 3B is the ortholog table for M00810, which indicates by coloring that this gene is adjacent on the chromosome...”

An14g05350 pigment biosynthesis protein Ayg1 from Aspergillus niger CBS 513.88
Aligns to 70:398 / 406 (81.0%), covers 72.7% of PF06500, 44.0 bits

• Molecular Mechanisms of Conidial Germination in Aspergillus spp
  Baltussen, Microbiology and molecular biology reviews : MMBR 2020 (secret)
• Efficient marker free CRISPR/Cas9 genome editing for functional analysis of gene families in filamentous fungi
  van, Fungal biology and biotechnology 2019
  • “...shown the occurrence of differently sized indels in either fwnA (NRRL3_00462, An09g05730) or olvA (NRRL3_01039, An14g05350) in A. niger NRRL3, ranging from 88bp insertions up to 1096bp deletions across 30 individual mutants. In this study, while targeting the brnA gene, we observed even larger deletions that...”
• The role of melanin pathways in extremotolerance and virulence of Fonsecaea revealed by de novo assembly transcriptomics using illumina paired-end sequencing
  Li, Studies in mycology 2016
  • “...0.032* G647-03914 Afu4g14560 An09g05730 (FwnA) Afu7g00160 An11g07310 Abhydrolase (Ayg1) unigene1384 0.250 0.309 HMPREF1120-00377 G647-01705 Afu2g17550(Ayg1) An14g05350 (Ayg1) unigene1176 0.301 0.244 HMPREF1120-02312 G647-03620 1,3,6,8-Tetrahydroxynaphthalene reductase (Arp2) unigene2337 0.126 0.142 HMPREF1120-05939 G647-10180 Afu2g17560 (Arp2) An02g00220 unigene3830 0.426 0.037* Scytalone dehydratase (Arp1) unigene3787 0.793 0.04* HMPREF1120-07724 G647-03339 Afu2g17580 (Arp1)...”
• Comparative genomic and transcriptomic analysis of wangiella dermatitidis, a major cause of phaeohyphomycosis and a model black yeast human pathogen
  Chen, G3 (Bethesda, Md.) 2014
  • “...7.13e55 0.53 4.12e05 Polyketide synthase Afu4g00210 (EncA) An04g09530 Afu4g14560 An09g05730 (FwnA) Afu7g00160 An11g07310 Ayg1 Afu2g17550(Ayg1) An14g05350 (Ayg1) HMPREF1120_00377 0.39 8.55e02 0.12 5.26e01 Abhydrolase HMPREF1120_02312 0.32 5.16e02 0.67 7.33e07 Arp2 Afu2g17560 (Arp2) An02g00220 HMPREF1120_05939 1.25 9.27e16 0.18 1.97e01 1,3,6,8-Tetrahydroxynaphthalene reductase Arp1 Afu2g17580 (Arp1) An08g09920 HMPREF1120_07724 0.74 3.10e06...”
• Cytosolic streaming in vegetative mycelium and aerial structures of Aspergillus niger
  Bleichrodt, Studies in mycology 2013
  • “...RB3 and RB4 for mpdA (An02g05830), RB5 and RB6 for ayg1 (also known as olvA; An14g05350), RB7 and RB8 for flavohemoprotein ( flaA ; An14g02460), RB9 and RB10 for adhA (An17g01530), RB11 and RB12 for FAD binding oxidoreductase ( oxiA ; An18g00510), RB13 and RB14 for...”
  • “...H4.1 - Aspergillus nidulans An04g00710 2597 Weak similarity to hypothetical protein CAC28773.2 - Neurospora crassa An14g05350 a 2578 Strong similarity to hypothetical yellowish-green 1 ayg1 - Aspergillus fumigatus An11g02720 2568 Similarity to hypothetical protein C50F7.2 - Caenorhabditis elegans An02g14040 2469 Hypothetical protein An18g04220 2456 Strong similarity...”
• The transcriptional repressor TupA in Aspergillus niger is involved in controlling gene expression related to cell wall biosynthesis, development, and nitrogen source availability
  Schachtschabel, PloS one 2013
  • “...biosynthesis An09g05730 fwnA polyketide synthase required for melanin synthesis A. niger 54 128 0.4 3.94E-04 An14g05350 olvA strong similarity to hypothetical yellowish-green 1 ayg1 - Aspergillus fumigatus 363 85 4.3 3.42E-05 An14g05370 brnA strong similarity to cell surface ferroxidase precursor Fet3 - Saccharomyces cerevisiae 52 34...”
• Germination of conidia of Aspergillus niger is accompanied by major changes in RNA profiles
  van, Studies in mycology 2013
  • “...complex melanin pigments (see Krijgsheld et al. 2012). Transcripts of three genes (An 03g03750, An09g05730, An14g05350) of the melanin synthesis pathway (Jorgenson et al. 2010) were present in dormant conidia but disappeared during germination. Transcripts of five out of seven genes that code for proteins with...”
• The carbon starvation response of Aspergillus niger during submerged cultivation: insights from the transcriptome and secretome
  Nitsche, BMC genomics 2012
  • “...5.0E-10 3.0E-10 An03g02360 hypB Hydrophobin 0.5 0.4 162.4 214.5 0.9 345.1 455.8 7.3E-01 5.8E-10 3.2E-10 An14g05350 olvA Hydrolase involved in pigmentation 1.6 11.1 153.3 205.4 6.8 94.2 126.2 8.2E-07 3.7E-11 1.8E-11 An01g13660 yA Laccase invovled in pigmenation 0.8 1.0 46.1 20.6 1.2 56.5 25.3 3.6E-01 2.3E-11...”
• More

Q54287 OrfZ protein from Streptomyces hygroscopicus
Aligns to 41:274 / 389 (60.2%), covers 48.4% of PF06500, 43.9 bits

• Gene cluster on pAO1 of Arthrobacter nicotinovorans involved in degradation of the plant alkaloid nicotine: cloning, purification, and characterization of 2,6-dihydroxypyridine 3-hydroxylase
  Baitsch, Journal of bacteriology 2001
  • “...in 100 aa (Q9XAJ6) 124 aa (Q9XAJ6) 99 aa (Q9KZG3) 207 aa (Q54287) 19 aa (Q9RK75) 85 aa (Q9RN54) 70/43 in 221 aa (Q9XA70) 63/37 in 99 aa (Q06829) 60/28 in 261 aa...”

AYG1_ASPFU / Q4WZB3 Heptaketide hydrolyase ayg1; Conidial pigment biosynthesis protein ayg1; EC 3.7.1.- from Neosartorya fumigata (strain ATCC MYA-4609 / Af293 / CBS 101355 / FGSC A1100) (Aspergillus fumigatus) (see 12 papers)
AFUA_2G17550, Afu2g17550 conidial pigment biosynthesis protein Ayg1 from Aspergillus fumigatus Af293
Aligns to 72:399 / 406 (80.8%), covers 72.7% of PF06500, 40.9 bits

• function: Heptaketide hydrolyase; part of the gene cluster that mediates the biosynthesis of dihydroxynaphthalene (DHN)-melanin, a bluish-green pigment and a structural component of the conidial wall (PubMed:10515939, PubMed:11350964, PubMed:15310761, PubMed:19156203). The first step of the pathway is the production of the heptaketide naphtopyrone YWA1 by the polyketide synthase alb1 though condensation of acetyl-CoA with malonyl-CoA (PubMed:10515939). The naphtopyrone YWA1 is then converted to the pentaketide 1,3,6,8-tetrahydroxynaphthalene (1,3,6,8-THN) by the heptaketide hydrolyase ayp1 though chain-length shortening (PubMed:10515939, PubMed:11350964). 1,3,6,8-THN is substrate of the hydroxynaphthalene reductase arp2 to yield scytalone (PubMed:10515939, PubMed:11350964, PubMed:15310761). The scytalone dehydratase arp1 then reduces scytalone to 1,3,8-THN (PubMed:10515939). 1,3,8-THN is also substrate of the hydroxynaphthalene reductase arp2 to yield vermelone (PubMed:10515939). Vermelone is further converted by the multicopper oxidase abr1 to 1,8-DHN (PubMed:10515939). Finally the laccase abr2 transforms 1,8-DHN to DHN-melanin (PubMed:10515939). DHN- melanin biosynthesis appears to be initiated in endosomes where early enzymes (abl1, ayg1, arp1 and arp2) localize, with exocytosis leading to melanin deposition on the cell surface where late enzymes (abr1 and abr2) localize (PubMed:26972005). DHN-melanin is an important structural component of the outer cell wall and is required for the presence of conidial surface hydrophobins (PubMed:19703288). DHN- melanin plays also a crucial role in fungal virulence, including a protective role against the host's immune defenses (PubMed:19156203, PubMed:20145078, PubMed:21501368, PubMed:21747802, PubMed:21573171, PubMed:24818666). DHN-melanin protects also conidia against amoeba predation (PubMed:25684622).
  subunit: Homodimer.
  disruption phenotype: Leads to a yellow-green color of conidia (PubMed:11350964, PubMed:26972005). Impairs the accumulation of 1,3,6,8-tetrahydroxynaphthalene (1,3,6,8-THN) (PubMed:11350964). Results in an altered conidial surface with masked surface rodlet layer, leaky cell wall allowing the deposition of proteins on the cell surface and exposing the otherwise-masked cell wall polysaccharides at the surface (PubMed:24818666). Decreases the protection against the host's immune defenses (PubMed:21501368). Causes enhanced insect mortality compared to the parent strain in a wax moth Galleria mellonella infection model, probably through exacerbated immune response of the wax moth (PubMed:19156203).
• The fungal gene cluster for biosynthesis of the antibacterial agent viriditoxin.
  Urquhart, Fungal biology and biotechnology 2019
  • “...molecule YWA1. BLAST with DHN melanin pathway components in A. fumigatus (i.e. GenBank accessions E9QUT3, Q4WZB3 and Q4WZB4) [ 33 , 34 ] required to convert YWA1 into other pigments revealed their absence from the P. variotii genome. Thus, PvpP of P. variotii is required for...”
• Molecular Mechanisms of Conidial Germination in Aspergillus spp
  Baltussen, Microbiology and molecular biology reviews : MMBR 2020 (secret)
• Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction
  Fraczek, Current protocols in microbiology 2019
  • “...622 to 5259 bp (7 amplicons in total) and amplified the A. fumigatus AYG1 gene (Afu2g17550) and its flanking regions using the supernatant from four different spore concentrations (8 10 8 /ml, 1 10 8 /ml, 5 10 7 /ml, and 1 10 7 /ml). Using...”
• The Transcription Factor ZafA Regulates the Homeostatic and Adaptive Response to Zinc Starvation in Aspergillus fumigatus
  Vicentefranqueira, Genes 2018
  • “...AFUA_2G15010 NZR - 1.5 0.2 1.2 0.1 AFUA_2G15290 DZR - 26.0 3.6 3.2 0.3 Repression AFUA_2G17550 IZR ayg1 2.7 0.4 103.5 10.8 AFUA_3G02270 DZR cat1 18.9 1.8 2.0 0.2 Induction AFUA_3G03640 IZR mirB 3225.8 304.5 10.0 1.2 AFUA_3G14440 NZR - 3.5 0.5 1.3 0.1 AFUA_4G03410 NZR...”
• The Effect of Aspergillus Thermomutatus Chrysovirus 1 on the Biology of Three Aspergillus Species
  Ejmal, Viruses 2018
  • “...protein 16 Afu2g17600 Conidial pigment polyketide synthase PksP/Alb1; conidial pigment biosynthesis; conidia wall assembly 13 Afu2g17550 Heptaketide hydrolase ayg1; conidial pigment; polyketide shortening; conidia-enriched protein 13 Afu2g17580 Scytalone dehydratase arp1; conidial pigment biosynthesis; conidia formation and sporulation 9 Afu1g09750 Aldehyde reductase (AKR1), putative; conidia-enriched protein 38...”
• Temperature during conidiation affects stress tolerance, pigmentation, and trypacidin accumulation in the conidia of the airborne pathogen Aspergillus fumigatus
  Hagiwara, PloS one 2017
  • “...2.55 heat shock transcription factor, putative AFUA_7G01720 647.0 56.9 95.9 11.36 1.68 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase AFUA_2G17550 208.0 18.5 6.2 11.24 0.34 ayg1 conidial pigment biosynthesis protein Ayg1 AFUA_1G16960 2413.7 215.9 310.3 11.18 1.44 conserved hypothetical protein AFUA_4G08170 979.3 92.1 68.5 10.64 0.74 uga2 succinate-semialdehyde dehydrogenase Uga2,...”
• Regulation of Secondary Metabolism by the Velvet Complex Is Temperature-Responsive in Aspergillus
  Lind, G3 (Bethesda, Md.) 2016
  • “..., Afu2g05830 Inglis et al. (2013) Cluster 7 1,8-Dihydroxynaphthalene (DHN) melanin Afu2g17530 , Afu2g17540 , Afu2g17550 , Afu2g17560 , Afu2g17580 , Afu2g17600 Tsai et al. (1999) Cluster 8 Fumigaclavine Afu2g17960 , Afu2g17970 , Afu2g17980 , Afu2g17990 , Afu2g18000 , Afu2g18010 , Afu2g18020 , Afu2g18030 , Afu2g18040...”
• Surface structure characterization of Aspergillus fumigatus conidia mutated in the melanin synthesis pathway and their human cellular immune response
  Bayry, Infection and immunity 2014
  • “...reduction and dehydration by Ayg1p (AFUA_2G17550), Arp2p (AFUA_2G17560), and Arp1p (AFUA_2G17580), respectively. The generated product...”
• Multiplexed activity-based protein profiling of the human pathogen Aspergillus fumigatus reveals large functional changes upon exposure to human serum
  Wiedner, The Journal of biological chemistry 2012
  • “...pigment biosynthetic proteins Arp2 (AFUA_2G17560) and Ayg1 (AFUA_2G17550) (41), hybrid PKS-NRPS enzyme nrps14 (AFUA_8G00540) of the pseurotin A biosynthesis...”
  • “...AFUA_1G15960 AFUA_2G10170 AFUA_8G00430 AFUA_4G09220 AFUA_3G12910 AFUA_2G17550 AFUA_3G00800 AFUA_2G17560 Histone H3 Acetyl-CoA carboxylase Sulfur metabolism...”
• More

Pc21g16440 hypothetical protein from Penicillium rubens Wisconsin 54-1255
Aligns to 75:401 / 409 (80.0%), covers 71.8% of PF06500, 39.8 bits

• Among developmental regulators, StuA but not BrlA is essential for penicillin V production in Penicillium chrysogenum
  Sigl, Applied and environmental microbiology 2011
  • “...Pc22g08420 Pc21g16000 Pc21g16420 Pc21g16430 Pc16g11310 Pc21g16440 Pc06g00470 Pc20g06360 Pc16g06690 Pc13g12240 Pc15g00600 Pc12g01640 Pc12g12190 Pc13g03170...”

SS1G_01382 hypothetical protein from Sclerotinia sclerotiorum 1980 UF-70
Aligns to 81:410 / 412 (80.1%), covers 72.7% of PF06500, 38.7 bits

• ORF Ι of Mycovirus SsNSRV-1 is Associated with Debilitating Symptoms of Sclerotinia sclerotiorum
  Gao, Viruses 2020
  • “...process, of which gene sscle_03g022890 (SS1G_00993) was related to steroid hormone metabolic process, gene sscle_01g009260 (SS1G_01382) was supposed to encode a pigment biosynthesis protein controlling hydrolase activity, and gene sscle_08g063720 (SS1G_05048) had N-acetyltransferase activity that might control acyl-carrier-protein biosynthetic process. In addition, gene sscle_08g067700 (SS1G_05567) was...”

VDAG_04954 pigment biosynthesis protein Ayg1 from Verticillium dahliae VdLs.17
Aligns to 134:463 / 466 (70.8%), covers 73.2% of PF06500, 38.5 bits

• Two Verticillium dahliae MAPKKKs, VdSsk2 and VdSte11, Have Distinct Roles in Pathogenicity, Microsclerotial Formation, and Stress Adaptation
  Yu, mSphere 2019
  • “...), VdBrn2 ( VDAG_00183 ), VdLac1 ( VDAG_00189 ), VdCmr1 ( VDAG_00195 ), Vayg1 ( VDAG_04954 ), and VdMsn2 ( VDAG_04227 ). Consistent with a deficiency in melanization during culturing, gene expression data showed that seven genes, including VdPKS1 , VdLac1 , and VdCmr1 , were...”
• Transcription factor VdCmr1 is required for pigment production, protection from UV irradiation, and regulates expression of melanin biosynthetic genes in Verticillium dahliae
  Wang, Microbiology (Reading, England) 2018
  • “...and tetra-hydroxynaphthalene reductase functions [ 41, 42 ] VDAG_03393 . Scytalone dehydratase [ 43 ] VDAG_04954 /pigmentbiosynthesis protein Ayg1 Vayg1/ [ 11 ] Polyketide chain shortening [ 44 ] VDAG_00190 /conidialyellow pigment biosynthesis PKS VdPKS1; this study/ [ 12 ] Polyketide synthase [ 45 ] VDAG_00194/VDAG_00195...”
  • “...levels of additional homologues of melanin biosynthetic-related genes VDAG_00034 (laccase) , VDAG_03665 (scytalone dehydratase) , VDAG_04954 (PKS Vayg1) , VDAG_05181 (THN reductase), were analysed in two VDAG_00195 deletion mutants ( Fig. 3a ). Among these genes, VDAG_00034 (laccase) and VDAG_05181 (THN reductase) were not differentially expressed...”
• VdCYC8, Encoding CYC8 Glucose Repression Mediator Protein, Is Required for Microsclerotia Formation and Full Virulence in Verticillium dahliae
  Li, PloS one 2015
  • “...strains, the gene loci of VDAG_00189 , VDAG_00190 , VDAG_00184 , VDAG_03665 , VDAG_03393 , VDAG_04954 were selected for quantitative real-time PCR (RT-qPCR) analysis ( Table 2 ) [ 40 ]. The expression patterns of VdCYC8 at different stages of development were also assessed by RT-qPCR...”
  • “...59C 144 bp R: CACCCTCTTCGAGGTGCTTGTA VDAG_03393 scytalone dehydratase F: ATCACCTTCGACGACTACCTCG 63C 153 bp R: CATGGCCTCCCAGATCTTGTCT VDAG_04954 pigment biosynthesis protein Ayg1 F: GATGGGCACGAGTATCCGTTTC 60C 80 bp R: GTCTTGTACTCCGCCACAGTCT RNA isolation and cDNA synthesis were performed as mentioned above. RT-qPCR was performed in a LightCycler 480 (Roche, Germany)...”
• RNA-seq analyses of gene expression in the microsclerotia of Verticillium dahliae
  Duressa, BMC genomics 2013
  • “...Protein name/functional annotation Pigment synthesis VDAG_03665 344.05 Tetrahydroxynaphthalene reductase/melanin biosynthesis VDAG_03393 231.29 Scytalone dehydratase/melanin biosynthesis VDAG_04954 165.00 Pigment biosynthesis protein Ayg1 VDAG_00190 136.66 Conidial yellow pigment biosynthesis polyketide synthase/melanin synthesis VDAG_00189 110.81 Laccase/melanin biosynthesis VDAG_05181 86.98 Tetrahydroxynaphthalene reductase/melanin biosynthesis VDAG_00183 40.79 Versicolorin reductase/Polyketide/melanin or aflatoxin biosynthesis...”
  • “..., 344-fold; VDAG_05181 87-fold), scytalone dehydratase ( VDAG_03393 , 231-fold), pigment biosynthesis protein Ayg1 ( VDAG_04954 , 165-fold), conidial yellow pigment biosynthesis PKS ( VDAG_00190 , 137-fold), two laccases ( VDAG_00189 , 111-fold, and VDAG_00034 , 7-fold), versicolorin reductase ( VDAG_00183 , 41-fold), polyketide synthase (...”

FUS2_GIBM7 / W7N6P0 20-hydroxy-prefusarin hydrolase FUS2; Fusarin biosynthesis protein 2; EC 3.7.1.- from Gibberella moniliformis (strain M3125 / FGSC 7600) (Maize ear and stalk rot fungus) (Fusarium verticillioides) (see 2 papers)
Aligns to 38:278 / 419 (57.5%), covers 48.9% of PF06500, 36.6 bits

• function: 20-hydroxy-prefusarin hydrolase; part of the gene cluster that mediates the biosynthesis of the mycotoxin fusarin C (PubMed:17121404, PubMed:22652150). Within the cluster, FUS1, FUS2, FUS8 and FUS9 are sufficient for fusarin production (By similarity). The roles of the other FUS members are yet undetermined (By similarity). The fusarin C synthetase FUS1 is responsible for the condensation of one acetyl-coenzyme A (CoA) unit with six malonyl-CoA units and the amide linkage of the arising heptaketide and homoserine, subsequently releasing the first intermediate, prefusarin, as an alcohol with an open ring structure (PubMed:17121404). The cytochrome P450 monooxygenase FUS8 participates in multiple oxidation processes at carbon C-20 and is able to use the FUS1 product as substrate, resulting in formation of 20-hydroxy-prefusarin (By similarity). This reaction seems to be essential before the 2-pyrrolidone ring closure can be catalyzed by FUS2, generating 20-hydroxy-fusarin (By similarity). FUS8 is able to further oxidizes carbon C-20 after ring closure, resulting in the formation of carboxy-fusarin C (By similarity). As the last step, FUS9 methylates the hydroxyl group at C-21 to generate fusarin C (By similarity). Fusarin C can then rearrange to epi-fusarin C, the (z)-isomers, and fusarin A and fusarin D (By similarity).

FUS2_GIBF5 / S0EE80 20-hydroxy-prefusarin hydrolase FUS2; Fusarin biosynthesis protein 2; EC 3.7.1.- from Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831) (Bakanae and foot rot disease fungus) (Fusarium fujikuroi) (see 2 papers)
Aligns to 38:275 / 419 (56.8%), covers 48.9% of PF06500, 36.4 bits

• function: 20-hydroxy-prefusarin hydrolase; part of the gene cluster that mediates the biosynthesis of the mycotoxin fusarin C (PubMed:23932525). Within the cluster, FUS1, FUS2, FUS8 and FUS9 are sufficient for fusarin production (PubMed:23932525). The roles of the other FUS members are yet undetermined (PubMed:23932525). The fusarin C synthetase FUS1 is responsible for the condensation of one acetyl- coenzyme A (CoA) unit with six malonyl-CoA units and the amide linkage of the arising heptaketide and homoserine, subsequently releasing the first intermediate, prefusarin, as an alcohol with an open ring structure (PubMed:23932525). The cytochrome P450 monooxygenase FUS8 participates in multiple oxidation processes at carbon C-20 and is able to use the FUS1 product as substrate, resulting in formation of 20- hydroxy-prefusarin (PubMed:23932525). This reaction seems to be essential before the 2-pyrrolidone ring closure can be catalyzed by FUS2, generating 20-hydroxy-fusarin (PubMed:23932525). FUS8 is able to further oxidizes carbon C-20 after ring closure, resulting in the formation of carboxy-fusarin C (PubMed:23932525). As the last step, FUS9 methylates the hydroxyl group at C-21 to generate fusarin C (PubMed:23932525). Fusarin C can then rearrange to epi-fusarin C, the (z)-isomers, and fusarin A and fusarin D (PubMed:23932525).
  disruption phenotype: Accumulates 20-hydroxy-prefusarin (PubMed:23932525).

Q7MZT8 Uncharacterized protein from Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
plu4186 No description from Photorhabdus luminescens subsp. laumondii TTO1
Aligns to 60:283 / 384 (58.3%), covers 48.4% of PF06500, 35.1 bits

• Molecular mechanism of polyketide shortening in anthraquinone biosynthesis of Photorhabdus luminescens
  Zhou, Chemical science 2019
  • “...is exceptional. Moreover, the local alignment search in the NCBI databank revealed that AntI (Uniprot: Q7MZT8) is predominantly found in Photorhabdus species. Thus, AntI is a promising candidate for polyketide shortening, followed by a unique cyclisation of the third aromatic ring in AQ biosynthesis ( Fig....”
• Secondary Metabolites Produced by Heterorhabditis Symbionts and Their Application in Agriculture: What We Know and What to Do Next
  Stock, Journal of nematology 2017 (secret)
• Genome mining unearths a hybrid nonribosomal peptide synthetase-like-pteridine synthase biosynthetic gene cluster
  Park, eLife 2017 (no snippet)

GLRG_09712 alpha/beta hydrolase from Colletotrichum graminicola M1.001
Aligns to 42:267 / 425 (53.2%), covers 44.5% of PF06500, 32.5 bits

• A Colletotrichum graminicola mutant deficient in the establishment of biotrophy reveals early transcriptional events in the maize anthracnose disease interaction
  Torres, BMC genomics 2016
  • “...10 Endo-1,4-beta-xylanase M. oryzae PHI_2208 Cazyme (GH10-CBM1) GLRG_08975 3.55 PF01738 Dienelactone hydrolase family Conserved SSP GLRG_09712 5.18 PF12695 Alpha/beta hydrolase family Cazyme, (CE1). SM Cluster 22 GLRG_09714 7.40 PF00107 Zinc binding dehydrogenase SM Cluster 22 GLRG_09807 7.70 PF00734 Fungal Cellulose Binding Domain FAED1 Gibberella zeae Cazyme,...”

MSMEG_5341 dipeptidyl aminopeptidase/acylaminoacyl peptidase (NCBI) from Mycobacterium smegmatis str. MC2 155
Aligns to 39:266 / 398 (57.3%), covers 47.9% of PF06500, 31.6 bits

• Characterization of Mycobacterium smegmatis sigF mutant and its regulon: overexpression of SigF antagonist (MSMEG_1803) in M. smegmatis mimics sigF mutant phenotype, loss of pigmentation, and sensitivity to oxidative stress
  Singh, MicrobiologyOpen 2015
  • “...oxidoreductase 3.82/0.72 GGTGN 15 GGGGA 361 MSMEG_5180 Conserved hypothetical protein 2.41/0.84 GTTGN 14 GGGTG 233 MSMEG_5341 Dipeptidyl aminopeptidase 2.22/0.91 MSMEG_5343 a Conserved hypothetical protein 3.09/1.07 GTTTN 16 GGCTA 35 MSMEG_5374 Glutamateammonia ligase 2.22/0.03 MSMEG_5559 Metabolite/sugar transport protein 2.83/0.35 GTTTN 16 GGGTA 39 MSMEG_5623 Lcarnitine dehydratase 3.24/1.20...”

WP_012548346 alpha/beta fold hydrolase from Dictyoglomus thermophilum H-6-12
Aligns to 5:206 / 256 (78.9%), covers 32.1% of PF06500, 30.9 bits

• EstDZ3: A New Esterolytic Enzyme Exhibiting Remarkable Thermostability
  Zarafeta, Frontiers in microbiology 2016
  • “...analysis revealed that EstDZ3 is identical to a putative Dictyoglomus thermophilum / hydrolase (Accession no. WP_012548346). Analysis against Uniprot/SwissProt indicated that the closest sequence homolog of EstDZ3, which has been characterized functionally, is an arylesterase from Pseudomonas fluorescens (sequence identity 23%, coverage 78%, Accession no. P22862.4)...”

CP_0620 alpha/beta hydrolase from Chlamydia pneumoniae AR39
Aligns to 40:199 / 316 (50.6%), covers 29.0% of PF06500, 29.2 bits

• The Chlamydia trachomatis CT149 protein exhibits esterase activity in vitro and catalyzes cholesteryl ester hydrolysis when expressed in HeLa cells
  Peters, Microbes and infection 2012
  • “...L2 strain 434/Bu (CTL0404), C. trachomatis A/HAR-13 (CTA_158), C. muridarum Nigg (TC_426), C. pneumoniae AR39 (CP_0620), and C. caviae GPIC (CCA_00614). The identical motifs are not only conserved in chlamydiae, but also the localization of the genes coding for CT149 homologs is syntenic with respect to...”
  • “...A/HAR-13 (CTA_158, acc. no. YP_327950.1), C. muridarum Nigg (TC_0426, acc no. AAF39282.1), C. pneumonia AR39 (CP_0620, acc. no. AAF38435.1), and C. caviae GPIC (CCA_00614, acc no. AAP05356.1) in ClustalX2 with default settings. The black arrow marks the predicted cleavage site in all sequences. The GXSXG lipase/esterase...”

ACRC_ASPA1 / P9WEZ7 Hydrolase acrC; Acurin A biosynthesis cluster protein C; EC 3.7.1.- from Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094) (see paper)
Aligns to 40:315 / 428 (64.5%), covers 47.0% of PF06500, 28.4 bits

• function: Hydrolase; part of the cluster that mediates the biosynthesis of acurin A, a highly reduced polyketide coupled to a serine via a peptide bond (PubMed:32234543). The activities of the highly reducing polyketide synthase acrA and the nonribosomal peptide synthetase acrB are collectively responsible for the synthesis of the acurin A core structure with a heptaketide backbone produced by acrA covalently fused to a L-serine by acrB (PubMed:32234543). After the formation of the PK- NRP hybrid product, it is detached from acrB by reductive release to set up the formation of the lactam ring by aldol condensation (Probable). The hydrolyase acrC then catalyzes water loss to generate a double bond in the ring (Probable). This double bond is probably reduced, which is followed by three oxidations at C-22 to generate the carboxylic acid moiety, involving probably the FAD-binding monooxygenase acrE and the cytochrome P450 monooxygenases acrD and acrF (Probable). Finally, a last methylation step performed by the O- methyltransferase acrG leads to the production of acurin A (Probable).
  disruption phenotype: Abolishes the production of acurin A.

CT206 (predicted acyltransferase family) (NCBI ptt file) from Chlamydia trachomatis D/UW-3/CX
Aligns to 14:180 / 282 (59.2%), covers 28.2% of PF06500, 28.2 bits

• Chlamydia trachomatis infection induces replication of latent HHV-6
  Prusty, PloS one 2013
  • “...22412.0638 <32+/ 20 ND NEG 22 CT175 10.633452 25.0302 3125.70194 <32+/ ND ND POS 23 CT206 ND 203.0779 6519.2924 POS Samples with detectable HHV-6 DNA as well as chlamydial (Ctr) DNA in cervical smears were grouped in this table. HHV-6 DNA load in cervical smears and...”
• The Chlamydia trachomatis CT149 protein exhibits esterase activity in vitro and catalyzes cholesteryl ester hydrolysis when expressed in HeLa cells
  Peters, Microbes and infection 2012
  • “...of the esterase/lipase family (predicted outer membrane protein CT073, Lysophospholipase esterase CT136, and predicted acyltransferase CT206) had either zero or only one GXSXG motif in their protein sequence. In addition we did not find other annotated hydrolases in other bacterial species, including Mycobacterium and E. coli...”
  • “...esterases and lipases. From four annotated esterase/lipase proteins in C. trachomatis (CT073, CT136, CT149, and CT206) only the gene product from ct149 contains two GXSXG motifs found in lipases/esterases [ 23 , 24 ]. Also, compared to other bacterial species, we did not find another esterase/lipase...”

TTE1809 Hydrolases of the alpha/beta superfamily (NCBI ptt file) from Thermoanaerobacter tengcongensis MB4
Aligns to 1:149 / 258 (57.8%), covers 31.1% of PF06500, 26.7 bits

• Thermostable feruloyl esterase for the bioproduction of ferulic acid from triticale bran
  Abokitse, Applied microbiology and biotechnology 2010 (PubMed)
  • “...A putative / hydrolase fold-encoding gene (locus tag TTE1809) from the genome of Thermoanaerobacter tengcongensis was cloned and expressed in Escherichia coli...”
  • “...in the thermophilic T. tengcongensis strain MB4T (locus tag TTE1809; NP_623397; Bao et al. 2002) showing 26% sequence identity was chosen for this study. The T....”
• Carboxylic ester hydrolases from hyperthermophiles
  Levisson, Extremophiles : life under extreme conditions 2009
  • “...Lysophospholipase 314 GHSFG TTE0552 AAM23828 Predicted hydrolase 279 GVSMG TTE0556 AAM23832 Predicted hydrolase 298 GWSMG TTE1809 AAM25001 Alpha/beta hydrolase 258 GLSMG TTE2321 AAM25462 Alpha/beta hydrolase 414 CHSMG TTE2547 AAM25672 Alpha/beta hydrolase 285 AHSFG Thermococcus kodakaraensis TK0522 BAD84711 Carbohydrate esterase 449 GSSLG Thermotoga maritima TM1022 AAD36099 Esterase...”

HSM_1908 alpha/beta hydrolase from Histophilus somni 2336
HSM_1908 hypothetical protein (RefSeq) from Haemophilus somnus 2336
Aligns to 32:174 / 599 (23.9%), covers 25.5% of PF06500, 26.5 bits

• Horizontal gene transfer in Histophilus somni and its role in the evolution of pathogenic strain 2336, as determined by comparative genomic analyses
  Siddaramappa, BMC genomics 2011
  • “...ORFs encoding a cyclase family protein and a membrane-spanning protein ([GenBank: HSM_1907 ] and [GenBank: HSM_1908 ]). These ORFs appeared to form an operon with ORFs encoding proteins putatively involved in butyrate/pyruvate metabolism ([GenBank: HSM_1903 ] to [GenBank: HSM_1906 ]). Furthermore, strain 2336 contained an ORF...”

CCA_00614 alpha/beta hydrolase from Chlamydia caviae GPIC
Aligns to 39:231 / 315 (61.3%), covers 32.1% of PF06500, 26.4 bits

• The Chlamydia trachomatis CT149 protein exhibits esterase activity in vitro and catalyzes cholesteryl ester hydrolysis when expressed in HeLa cells
  Peters, Microbes and infection 2012
  • “...trachomatis A/HAR-13 (CTA_158), C. muridarum Nigg (TC_426), C. pneumoniae AR39 (CP_0620), and C. caviae GPIC (CCA_00614). The identical motifs are not only conserved in chlamydiae, but also the localization of the genes coding for CT149 homologs is syntenic with respect to the monooxygenase CT148 and the...”
  • “...(TC_0426, acc no. AAF39282.1), C. pneumonia AR39 (CP_0620, acc. no. AAF38435.1), and C. caviae GPIC (CCA_00614, acc no. AAP05356.1) in ClustalX2 with default settings. The black arrow marks the predicted cleavage site in all sequences. The GXSXG lipase/esterase and the CRAC sequence are marked with solid...”

XF1745 conserved hypothetical protein (NCBI ptt file) from Xylella fastidiosa 9a5c
Aligns to 19:189 / 338 (50.6%), covers 32.6% of PF06500, 26.2 bits

• Xylella fastidiosa subsp. pauca Strains Fb7 and 9a5c from Citrus Display Differential Behavior, Secretome, and Plant Virulence
  de, International journal of molecular sciences 2020
  • “...6 9 9 XF1159 III.B.2 50S ribosomal protein L16 1.41 1.17 10 2 3 12 XF1745 VIII.A Alpha/beta-Hydrolases 1.4 1.74 10 4 8 14 XF1741 VII.C Daunorubicin C-13 ketoreductase 1.37 1.33 10 4 3 9 XF1165 III.B.2 30S ribosomal protein S14 1.33 4.85 10 3 2...”

TC0478 conserved hypothetical protein (NCBI ptt file) from Chlamydia muridarum Nigg
Aligns to 4:171 / 272 (61.8%), covers 26.5% of PF06500, 24.9 bits

• Identification of immunodominant antigens by probing a whole Chlamydia trachomatis open reading frame proteome microarray using sera from immunized mice
  Cruz-Fisher, Infection and immunity 2011
  • “...TC0437 TC0438 TC0439 TC0446 TC0448 TC0449 TC0458 TC0473 TC0478 TC0479 TC0491 TC0500 TC0503 TC0504 TC0512 TC0519 TC0521 TC0522 TC0527 TC0536 TC0539 TC0551 TC0557...”

UCSC_ACRSP / A0A411KUP9 Alpha/beta hydrolase ucsC; UCS1025A pyrrolizidinone biosynthesis cluster protein C; EC 3.7.1.- from Acremonium sp. (see paper)
Aligns to 38:298 / 492 (53.0%), covers 49.1% of PF06500, 24.7 bits

• function: Alpha/beta hydrolase; part of the gene cluster that mediates the biosynthesis of UCS1025A, a member of the pyrrolizidinone family that acts as a strong telomerase inhibitor and displays potent antibacterial and antitumor properties (PubMed:29373009). These compounds share a hemiaminal-containing pyrrolizidinone core fused with a gamma-lactone, giving a furopyrrolizidine that is connected to a decalin fragment (PubMed:29373009). The polyketide synthase module (PKS) of the PKS-NRPS ucsA is responsible for the synthesis of the polyketide backbone via the condensation of an acetyl-CoA starter unit with 6 malonyl-CoA units (PubMed:29373009). The downstream nonribosomal peptide synthetase (NRPS) module then amidates the carboxyl end of the polyketide with a 2S,3S-methylproline derived from L-isoleucine by the 2-oxoglutarate-dependent dioxygenase ucsF which converts L-isoleucine to (4S,5S)-4-methylpyrroline-5-carboxylate that is further converted to 2S,3S-methylproline by the pyrroline-5-carboxylate reductase ucsG (PubMed:29373009). Reductive release of the completed aminoacyl polyketide from the assembly line can form the 3-pyrrolin-2-one structure via an intramolecular Knoevenagel reaction (PubMed:29373009). Because ucsA lacks a designated enoylreductase (ER) domain, the required activity is provided the enoyl reductase ucsL (PubMed:29373009). This keto acyclic precursor is the substrate of the Diels-Alderase ucsH, that catalyzes the Diels-Alder cycloaddition (PubMed:29373009). Oxidation of the 3S-methyl group to a carboxylate by the cytochrome P450 monooxygenase ucsK allows an oxa-Michael cyclization that might involve the reductase/dehydrogenase ucsI and which furnishes the furopyrrolizidine (PubMed:29373009). The oxidase ucsJ likely plays a critical role in stereoselective reduction of the C5-C6 double bond to afford the required R-configured carboxylate group (Probable). Further enolization and oxidation at C5 by an unidentified enzyme affords the last intermediate that can undergo oxa-Michael cyclization to yield UCS1025A (Probable).
  subunit: Homodimer.

FGSG_13222 hypothetical protein from Fusarium graminearum PH-1
Aligns to 30:278 / 419 (59.4%), covers 35.0% of PF06500, 24.6 bits

• The Fusarium graminearum histone H3 K27 methyltransferase KMT6 regulates development and expression of secondary metabolite gene clusters
  Connolly, PLoS genetics 2013
  • “...genes in the fusarin C cluster are upregulated (A, FGSG_07797; B, FGSG_07798, fus1/pks10 ; C, FGSG_13222, fus2 ; D, FGSG_13223, fus3 ; E, FGSG_07800, fus4 ; F, FGSG_07801, fus5 ; G, FGSG_07802, fus6 ; H, FGSG_07803, fus7 ; I, FGSG_07804, fus8 cytochrome P450; J, FGSG_07805). B....”
• Genome-wide expression profiling shows transcriptional reprogramming in Fusarium graminearum by Fusarium graminearum virus 1-DK21 infection
  Cho, BMC genomics 2012
  • “...FGSG_07798 Polyketide synthase 6.350204512 0.001744378 36 h FGSG_07800 Eukaryotic aspartyl protease 6.046050259 0.004179133 36 h FGSG_13222 Dipeptidyl aminopeptidases 5.960147173 0.003763144 36 h FGSG_07804 Cytochrome P450 5.427966104 0.011883416 36 h FGSG_04468 Amino acid transporter permease 4.672200299 0.012719315 120 h FGSG_08055 Amino acid transporter permease 4.288189196 0.013683756 120...”
  • “...highly reduced at both 36 h and 120 h, whereas FGSG_03788, FGSG_00023, FGSG_07804, FGSG_07801, and FGSG_13222 were strongly induced regardless of the time point (Figure 3 AC). When the mRNA level of a gene is too low to quantify, or the P-values from the microarray data...”

An07g00020 alpha/beta hydrolase from Aspergillus niger CBS 513.88
Aligns to 44:305 / 448 (58.5%), covers 48.9% of PF06500, 23.9 bits

• Cytosolic streaming in vegetative mycelium and aerial structures of Aspergillus niger
  Bleichrodt, Studies in mycology 2013
  • “...S30 - Saccharomyces cerevisiae An02g13750 1062 Strong similarity to glutaminase A gtaA - Aspergillus oryzae An07g00020 1054 Strong similarity to hypothetical protein Z - Streptomyces hygroscopicus An12g02740 1051 Weak similarity to ATP-dependent proteinase Clp from patent WO9743303-A1 - Streptococcus pneumoniae An01g02880 1048 Strong similarity to cytoplasmic...”

CHGG_01246 hypothetical protein from Chaetomium globosum CBS 148.51
Aligns to 32:278 / 431 (57.3%), covers 34.3% of PF06500, 23.8 bits

• Identification of the Antifungal Metabolite Chaetoglobosin P From Discosia rubi Using a Cryptococcus neoformans Inhibition Assay: Insights Into Mode of Action and Biosynthesis
  Perlatti, Frontiers in microbiology 2020
  • “...59.5 g73 Hypothetical protein CHGG_01244 44.7 g74 Short chain dehydrogenase CHGG_01245 59.7 g75 Alpha/beta hydrolase CHGG_01246 68.3 g76 C-methyltransferase Absent g77 Branched chain amino-acid aminotransferase Absent FIGURE 4 Graphic representation of the putative and proven chaetoglobosin-type gene clusters and their microsynteny. Chaetoglobosin P gene cluster from...”
• The brlA Gene Deletion Reveals That Patulin Biosynthesis Is Not Related to Conidiation in Penicillium expansum
  Zetina-Serrano, International journal of molecular sciences 2020
  • “...] delineated the cluster at nine genes, the two genes located directly downstream (CHGG_01245 and CHGG_01246) have a corresponding homolog in P. expansum ( Figure 6 ). The difference between the clusters in the two species is the absence in P. expansum of a gene homologous...”
  • “...confirm this hypothesis and to determine the exact role of homologous proteins to CHGG_01245 and CHGG_01246, the generation of monogenic null mutants is currently underway. 4. Materials and Methods 4.1. Fungal Strains and PebrlA Mutant Strain Construction Penicillium expansum NRRL 35695, originally isolated from grape berries...”

FGSG_04503 hypothetical protein from Fusarium graminearum PH-1
Aligns to 91:355 / 445 (59.6%), covers 43.6% of PF06500, 21.1 bits

• The adaptation of Fusarium culmorum to DMI Fungicides Is Mediated by Major Transcriptome Modifications in Response to Azole Fungicide, Including the Overexpression of a PDR Transporter (FcABC1)
  Hellin, Frontiers in microbiology 2018
  • “...FGSG_15560 Hypothetical protein 4.92 <0.001 FCUL_02780 FgramPH1_01t06451 FGSG_02694 Spherulin 1b partial 4.74 <0.001 FCUL_06652 FgramPH1_01t15459 FGSG_04503 / hydrolase 4.62 <0.001 FCUL_11523 FgramPH1_01t27023 FGSG_09463 Related to Rtm1p 4.4 <0.001 FCUL_10992 FgramPH1_01t25819 FGSG_07852 Short-chain dehydrogenase reductase 4.4 <0.001 FCUL_07989 FgramPH1_01t18803 FGSG_05807 Platelet-activating factor acetylhydrolase 4.39 0.007 FCUL_05569 FgramPH1_01t12957...”

ORFZB_MAGO7 / G4MVZ4 Hydrolase ORFZ; ACE1 cytochalasan biosynthesis cluster protein ORFZ; EC 3.7.1.- from Magnaporthe oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958) (Rice blast fungus) (Pyricularia oryzae) (see 3 papers)
Aligns to 29:335 / 424 (72.4%), covers 47.2% of PF06500, 21.0 bits

• function: Hydrolyase; part of the gene cluster that mediates the biosynthesis of a tyrosine-derived cytochalasan acting as a fungal signal recognized by resistant rice plants and leads to avirulence in Pi33 resistant rice cultivars (PubMed:18433432). The first step in the pathway is catalyzed by the hybrid PKS-NRPS ACE1, assisted by the enoyl reductase RAP1, that are responsible for fusion of the tyrosine precursor and the polyketide backbone (PubMed:29142718). The polyketide synthase module (PKS) of ACE1 is responsible for the synthesis of the polyketide backbone and the downstream nonribosomal peptide synthetase (NRPS) amidates the carboxyl end of the polyketide with the tyrosine precursor (PubMed:29142718). Because ACE1 lacks a designated enoylreductase (ER) domain, the required activity is provided the enoyl reductase RAP1 (PubMed:29142718). Reduction by the hydrolyase ORFZ, followed by dehydration and intra-molecular Diels-Alder cyclization by the Diels-Alderase ORF3 then yield the required isoindolone-fused macrocycle (Probable). A number of oxidative steps catalyzed by the tailoring enymes identified within the cluster, including cytochrome P450 monooxygenases CYP1 to CYP4, the FAD-linked oxidoreductase OXR2 and the short-chain dehydrogenase/reductase OXR1, are further required to afford the final cytochalasans that confer avirulence and which have still to be identified (Probable). The monooxygenase CYP1 has been shown to be a site-selective C-18 hydroxylase whereas the function of CYP3 is the site-selective epoxidation of the C-6/C-7 olefin that is present in some intermediate compounds (PubMed:31644300). Finally, SYN2 and RAP2 are not required for avirulence in Pi33 resistant rice cultivars (PubMed:18433432).
  subunit: Homodimer.

TP0952 lipase, putative (NCBI ptt file) from Treponema pallidum subsp. pallidum str. Nichols
Aligns to 15:199 / 345 (53.6%), covers 28.2% of PF06500, 20.6 bits

• Whole genome sequence of the Treponema pallidum subsp. endemicum strain Iraq B: A subpopulation of bejel treponemes contains full-length tprF and tprG genes similar to those present in T. p. subsp. pertenue strains
  Mikalová, PloS one 2020
  • “...1030 hypothetical protein F/V 994934 T C TP0917 1320 MgtE F/F 1032779 C T **** TP0952 620 putative lipase/esterase G/E 1085945 T C TP0999 261 FtsK A/A 1089703 C T TP1001 552 hypothetical protein A/A 1130225 A G TP1035 731 ValS L/P Listed are 37 single...”
• Global proteome analysis of Leptospira interrogans
  Eshghi, Journal of proteome research 2009
  • “...normal human serum, while no significant reactivity was observed against an irrelevant spirochete recombinant protein (Tp0952). The presence of antibodies against these leptospiral proteins in serum samples collected from natural leptospirosis infections is indicative of expression of the proteins during the course of infection. No reactivity...”
  • “...indicated recombinant L. interrogans proteins as well as a negative control recombinant Treponema pallidum protein (Tp0952) in triplicate. Reactivity was measured via absorbance at 600 nm and background subtracted values (no recombinant protein) were used in two-tailed t test calculations to determine statistical significance. The second...”
• Complete genome sequence of Treponema pallidum ssp. pallidum strain SS14 determined with oligonucleotide arrays
  Matejková, BMC microbiology 2008
  • “...TP0877 998 953710 954707 - 2 SNPs 24 TP0933 2023 1013098 1015120 - - 25 TP0952 1438 1032341 1033778 - 1 SNP 26 TP0961 1216 1041973 1043188 - - 27 TP0980 975 1063047 1064021 - - ORF open reading frame; nt nucleotide; SNP single nucleotide polymorphism;...”
• Treponema pallidum fibronectin-binding proteins
  Cameron, Journal of bacteriology 2004
  • “...and Tp0483, or the negative control recombinant proteins Tp0751 and Tp0952. After washing with PBS, slides were incubated for 2 h at 34C with 3 107 Syphilis is...”
  • “...or two negative control recombinant proteins (Tp0751 and Tp0952). Bars represent the average number of treponemes bound standard error for six fields, and the...”
• Identification of a Treponema pallidum laminin-binding protein
  Cameron, Infection and immunity 2003
  • “...(Tp92) Tp0453 Tp0483 Tp0557 Tp0620 (TprI) Tp0751 Tp0856 Tp0952 Sense primer(s)a VOL. 71, 2003 2527 FIG. 1. T. pallidum attachment to various ECM components....”

PSOB_ASPFU / Q4WAZ8 Alpha/beta hydrolase psoB; Pseurotin biosynthesis protein B; EC 3.7.1.- from Neosartorya fumigata (strain ATCC MYA-4609 / Af293 / CBS 101355 / FGSC A1100) (Aspergillus fumigatus) (see 3 papers)
AFUA_8G00530, Afu8g00530 alpha/beta hydrolase, putative from Aspergillus fumigatus Af293
Aligns to 55:272 / 445 (49.0%), covers 33.8% of PF06500, 20.1 bits

• function: Alpha/beta hydrolase; part of the gene cluster that mediates the biosynthesis of pseurotin A, a competitive inhibitor of chitin synthase and an inducer of nerve-cell proliferation (PubMed:24082142, PubMed:24939566). The PKS-NRPS hybrid synthetase psoA is responsible for the biosynthesis of azaspirene, one of the first intermediates having the 1-oxa-7-azaspiro[4,4]-non-2-ene-4,6-dione core of pseurotin, via condensation of one acetyl-CoA, 4 malonyl-CoA, and a L- phenylalanine molecule (PubMed:24082142, PubMed:24939566). The dual- functional monooxygenase/methyltransferase psoF seems to be involved in the addition of the C3 methyl group onto the pseurotin scaffold (PubMed:24939566). Azaspirene is then converted to synerazol through 4 steps including oxidation of C17 by the cytochrome P450 monooxygenase psoD, O-methylation of the hydroxy group of C8 by the methyltransferase psoC, and the trans-to-cis isomerization of the C13 olefin by the glutathione S-transferase psoE (PubMed:24939566). The fourth step of synerazol production is performed by the dual-functional monooxygenase/methyltransferase psoF which seems to catalyze the epoxidation of the intermediate deepoxy-synerazol (PubMed:24939566). Synerazol can be attacked by a water molecule nonenzymatically at two different positions to yield two diol products, pseurotin A and pseurotin D (PubMed:24939566).
  subunit: Homodimer.
  disruption phenotype: Results in significant reduction of pseurotin production (PubMed:24082142).
• A possible role for fumagillin in cellular damage during host infection by Aspergillus fumigatus
  Guruceaga, Virulence 2018
  • “...9.95 4.68 10.36 Cytochrome P450 oxidoreductase OrdA-like Afu8g00510 fmaG 5.87 11.07 5.02 10.92 / hydrolase Afu8g00530 psoB 5.41 8.30 5.29 8.47 Methyltransferase Afu8g00550 psoC 7.09 10.12 6.90 10.70 Cytochrome P450 oxidoreductase Afu8g00560 4.61 ND 4.46 ND Glutathione S-transferase like Afu8g00580 elfB / psoE 5.06 9.48 4.96...”
• Regulation of Secondary Metabolism by the Velvet Complex Is Temperature-Responsive in Aspergillus
  Lind, G3 (Bethesda, Md.) 2016
  • “..., Afu8g00490 , Afu8g00500 , Afu8g00510 , Afu8g00520 Lin et al. (2013) Cluster 34 Pseurotin Afu8g00530 , Afu8g00540 , Afu8g00550 , Afu8g00560 , Afu8g00570 , Afu8g00580 Wiemann et al. (2013) Cluster 35 Not known Afu8g00590 , Afu8g00595 , Afu8g00600 , Afu8g00610 , Afu8g00620 , Afu8g00630 ,...”
• A modified recombineering protocol for the genetic manipulation of gene clusters in Aspergillus fumigatus
  Alcazar-Fuoli, PloS one 2014
  • “...the left subtelomeric arm of chromosome 8. Genes in the cluster encode two putative hydrolases (AFUA_8G00530, AFUA_8G00570) a putative methyltransferase (AFUA_8G00550), a putative P450 monooxygenase (AFUA_8G00560) and the hybrid PKS/NRPS psoA (AFUA_8G00540) [47] . It has been demonstrated, via gene replacement analyses that integrity of the...”
  • “...of pseurotin A production we constructed A. fumigatus mutants lacking the entire pseurotin gene cluster (AFUA_8G00530 AFUA_8G00580) or other genes within or surrounding the cluster limits. We focused upon AFUA_8G00520, which encodes an integral membrane protein which lies beyond the cluster boundaries but is co-regulated, during...”
• RNA-seq reveals the pan-transcriptomic impact of attenuating the gliotoxin self-protection mechanism in Aspergillus fumigatus
  O'Keeffe, BMC genomics 2014
  • “...0.002 AFUA_8G00510 fmaG 0.793 0.820 8.101 0.0005 AFUA_8G00520 fma-TC/fmaA 0.528 0.904 8.369 0.022 Pseurotin A AFUA_8G00530 psoB 0.415 0.946 7.450 0.0005 AFUA_8G00540 psoA/NRPS14 0.768 0.776 5.792 0.0005 AFUA_8G00550 psoC 0.292 0.964 7.413 0.0005 AFUA_8G00560 psoD 0.808 0.735 6.778 0.0005 AFUA_8G00570 - 0.271 0.965 8.059 0.064 AFUA_8G00580...”
  • “...all of the pseurotin A biosynthetic genes was significantly down-regulated (Table 2 ). Expression of AFUA_8G00530 and A. fumigatus psoA/nrps14 , the PKS-NRPS hybrid [ 28 ], were down-regulated log 2 7.45- and log 2 5.79-fold respectively, while A. fumigatus psoC, psoD and elfB [ 31...”
• A proteomic approach to investigating gene cluster expression and secondary metabolite functionality in Aspergillus fumigatus
  Owens, PloS one 2014
  • “...enzymes, that form part of the pseurotin biosynthetic cluster, were detected here; an alpha/beta hydrolase (AFUA_8G00530), a hybrid PKS-NRPS enzyme PesO (AFUA_8G00540), a methyltransferase SirN-like (AFUA_8G00550) and a putative glutathione S-transferase (AFUA_8G00580) [4] . This cluster has demonstrated increased expression at both the transcript and protein...”
• The fumagillin gene cluster, an example of hundreds of genes under veA control in Aspergillus fumigatus
  Dhingra, PloS one 2013
  • “...fumagillin gene cluster from Afu8g00370 Afu8g00520 [ 53 ]; and the pseurotin A cluster from Afu8g00530 Afu8g00570 [ 88 ]. 10.1371/journal.pone.0077147.g003 Figure 3 Expression patterns of the fumagillin (A), fumitremorgin G (B), and fumigaclavine C (C) gene clusters in the veA vs WT and OE veA...”
• Transcriptional and proteomic analysis of the Aspergillus fumigatus ΔprtT protease-deficient mutant
  Hagag, PloS one 2012
  • “...unknown, cluster 24 contains genes for the biosynthesis of fumitremorgin (AFUA_8G00170- AFUA_8G00250) and pseurotin A (AFUA_8G00530- AFUA_8G00720) [13] , [15] , [34] . Only the genes involved in pseurotin A biosynthesis were upregulated in cluster 24 in the prtT mutant. Pseurotin A is a competitive inhibitor...”
• Analysis of the Aspergillus fumigatus proteome reveals metabolic changes and the activation of the pseurotin A biosynthesis gene cluster in response to hypoxia
  Vödisch, Journal of proteome research 2011
  • “...metabolism in A. fumigatus . Two proteins, namely a SirN-like methyltransferase (AFUA_8G00550) and an /-hydrolase (AFUA_8G00530) of the pseurotin A biosynthesis gene cluster were found to be up regulated due to hypoxic condition.( 39 ) The hypoxic induction of the entire pseurotin A biosynthesis gene cluster...”
• More

Or search for genetic data about PF06500 in the Fitness Browser