Family Search for PF06840 (PDC10_C)

PF06840 hits 19 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

Q8AVR4 Programmed cell death protein 10 from Xenopus laevis
Aligns to 74:161 / 212 (41.5%), covers 100.0% of PF06840, 136.9 bits

• Influence of Schistosoma japonicum programmed cell death protein 10 on the growth and development of schistosomula
  Gao, Parasites & vectors 2018
  • “...Nasonia vitripennis (K7IPU5), Arion vulgaris (A0A0B6Y0C7), Lottia gigantea (V4B5U4), Zootermopsis nevadensis (A0A067R7A2), and Xenopus laevis (Q8AVR4). Abbreviations : S, stable; US, unstable Sjpcdp 10 mRNA expression at different developmental stages The transcript levels of Sjpcdp 10 mRNA at different schistosomula stages were determined by real-time qPCR....”

PDC10_RAT / Q6NX65 Programmed cell death protein 10 from Rattus norvegicus (Rat) (see paper)
XP_006232563 programmed cell death protein 10 isoform X1 from Rattus norvegicus
Aligns to 72:159 / 210 (41.9%), covers 100.0% of PF06840, 136.0 bits

• function: Promotes cell proliferation. Modulates apoptotic pathways. Increases mitogen-activated protein kinase activity and STK26 activity. Important for cell migration, and for normal structure and assembly of the Golgi complex. Part of the striatin-interacting phosphatase and kinase (STRIPAK) complexes. STRIPAK complexes have critical roles in protein (de)phosphorylation and are regulators of multiple signaling pathways including Hippo, MAPK, nuclear receptor and cytoskeleton remodeling. Different types of STRIPAK complexes are involved in a variety of biological processes such as cell growth, differentiation, apoptosis, metabolism and immune regulation (By similarity). Important for KDR/VEGFR2 signaling. Increases the stability of KDR/VEGFR2 and prevents its breakdown. Required for normal cardiovascular development. Required for normal angiogenesis, vasculogenesis and hematopoiesis during embryonic development (By similarity).
  subunit: Homodimer. Interacts (via C-terminus) with CCM2. Interacts (via C-terminus) with PXN. Interacts (via N-terminus) with STK25. Interacts (via N-terminus) with STK26. Interacts (via N-terminus) with STK24. Interacts with GOLGA2. Identified in a complex with KRIT1 and CCM2. Interacts with KDR/VEGFR2. Interaction with KDR/VEGFR2 is enhanced by stimulation with VEGFA. Interacts with RIPOR1 (via C- terminus); this interaction is required for the association of RIPOR1 with either STK24 and STK26 kinases and occurs in a Rho-independent manner. Part of the core of STRIPAK complexes composed of PP2A catalytic and scaffolding subunits, the striatins (PP2A regulatory subunits), the striatin-associated proteins MOB4, STRIP1 and STRIP2, PDCD10 and members of the STE20 kinases, such as STK24 and STK26.
• Concomitant activation of miR-107/PDCD10 and hypoxamir-210/Casp8ap2 and their role in cytoprotection during ischemic preconditioning of stem cells.
  Kim, Antioxidants & redox signaling 2012
  • GeneRIF: The ischemic preconditioning (IPC) enhances stem cell survival via the combined participation of hypoxia responsive miRs miR-107 and miR-210 via their respective putative target genes Pdcd10 and Casp8ap2.
• Influence of Schistosoma japonicum programmed cell death protein 10 on the growth and development of schistosomula
  Gao, Parasites & vectors 2018
  • “...(A0A183AMZ2), Capitella teleta (R7TWK6), Caenorhabditis elegans (Q17958), Homo sapiens (Q9BUL8), Mus musculus (Q8VE70), Rattus norvegicus (Q6NX65), Otolemur garnettii (H0XA12), Lithobates catesbeiana (C1C3N3), Crassostrea gigas (K1PTV5), Strigamia maritima (T1JN96), Nasonia vitripennis (K7IPU5), Arion vulgaris (A0A0B6Y0C7), Lottia gigantea (V4B5U4), Zootermopsis nevadensis (A0A067R7A2), and Xenopus laevis (Q8AVR4). Abbreviations :...”
• Quantitative proteomics reveals novel protein interaction partners of PP2A catalytic subunit in pancreatic β-cells.
  Zhang, Molecular and cellular endocrinology 2016
  • “...19 , 24 ] H Myh10 F1LQ02 Myosin-10 233.6 1000 [ 19 ] H Pdcd10 Q6NX65 Programmed cell death protein 10 24.4 1000 [ 24 ] H Pola1 F1LRJ6 DNA polymerase 166.9 1000 [ 57 ] H Ppfia1 D3ZXH0 Protein Ppfia1 142.7 1000 [ 19 ,...”
• A proteomics analysis to evaluate cytotoxicity in NRK-52E cells caused by unmodified Nano-Fe₃O₄
  Lin, TheScientificWorldJournal 2014
  • “...death and apoptosis related proteins APAF_RAT Q9EPV5 Apoptotic protease-activating factor 1 146.1 2 780.9 PDC10_RAT Q6NX65 Programmed cell death protein 10 25.0 2 233.2 LEG1_RAT P11762 Galectin-1 15.5 5 1.75 PDC6I_RAT Q9QZA2 Programmed cell death 6-interacting protein 99.2 n.d. n.d. Ras-related proteins RAB7L_RAT Q63481 Ras-related protein...”

PDC10_MOUSE / Q8VE70 Programmed cell death protein 10; TF-1 cell apoptosis-related protein 15 from Mus musculus (Mouse) (see paper)
NP_062719 programmed cell death protein 10 from Mus musculus
Q0VCQ6 Programmed cell death 10 from Bos taurus
XP_011984225 programmed cell death protein 10 isoform X2 from Ovis aries
Aligns to 74:161 / 212 (41.5%), covers 100.0% of PF06840, 136.0 bits

• function: Promotes cell proliferation. Modulates apoptotic pathways. Increases mitogen-activated protein kinase activity and STK26 activity. Important for cell migration, and for normal structure and assembly of the Golgi complex. Part of the striatin-interacting phosphatase and kinase (STRIPAK) complexes. STRIPAK complexes have critical roles in protein (de)phosphorylation and are regulators of multiple signaling pathways including Hippo, MAPK, nuclear receptor and cytoskeleton remodeling. Different types of STRIPAK complexes are involved in a variety of biological processes such as cell growth, differentiation, apoptosis, metabolism and immune regulation (By similarity). Important for KDR/VEGFR2 signaling. Increases the stability of KDR/VEGFR2 and prevents its breakdown (PubMed:20371769). Required for normal cardiovascular development. Required for normal angiogenesis, vasculogenesis and hematopoiesis during embryonic development (By similarity).
  subunit: Homodimer. Interacts (via C-terminus) with CCM2. Interacts (via C-terminus) with PXN. Interacts (via N-terminus) with STK25. Interacts (via N-terminus) with STK26. Interacts (via N-terminus) with STK24. Interacts with GOLGA2. Identified in a complex with KRIT1 and CCM2 (By similarity). Interacts with KDR/VEGFR2. Interaction with KDR/VEGFR2 is enhanced by stimulation with VEGFA (PubMed:20371769). Interacts with RIPOR1 (via C-terminus); this interaction is required for the association of RIPOR1 with either STK24 and STK26 kinases and occurs in a Rho-independent manner. Part of the core of STRIPAK complexes composed of PP2A catalytic and scaffolding subunits, the striatins (PP2A regulatory subunits), the striatin-associated proteins MOB4, STRIP1 and STRIP2, PDCD10 and members of the STE20 kinases, such as STK24 and STK26 (By similarity).
  disruption phenotype: Lethal at an early embryonic stage due to defects in angiogenesis, vasculogenesis and hematopoiesis. Mice exhibit low levels of KDR/VEGFR2.
• Cerebral cavernous malformation proteins, CCM1, CCM2 and CCM3, are decreased in metastatic lesions in a murine breast carcinoma model.
  Cici, Biotechnic & histochemistry : official publication of the Biological Stain Commission 2024 (PubMed)
  • GeneRIF: Cerebral cavernous malformation proteins, CCM1, CCM2 and CCM3, are decreased in metastatic lesions in a murine breast carcinoma model.
• Transcriptome Analysis Reveals Altered Expression of Genes Involved in Hypoxia, Inflammation and Immune Regulation in Pdcd10-Depleted Mouse Endothelial Cells.
  Fusco, Genes 2022
  • GeneRIF: Transcriptome Analysis Reveals Altered Expression of Genes Involved in Hypoxia, Inflammation and Immune Regulation in Pdcd10-Depleted Mouse Endothelial Cells.
• Caveolae-mediated Tie2 signaling contributes to CCM pathogenesis in a brain endothelial cell-specific Pdcd10-deficient mouse model.
  Zhou, Nature communications 2021
  • GeneRIF: Caveolae-mediated Tie2 signaling contributes to CCM pathogenesis in a brain endothelial cell-specific Pdcd10-deficient mouse model.
• Pdcd10-Stk24/25 complex controls kidney water reabsorption by regulating Aqp2 membrane targeting.
  Wang, JCI insight 2021
  • GeneRIF: Pdcd10-Stk24/25 complex controls kidney water reabsorption by regulating Aqp2 membrane targeting.
• CCM3 is a gatekeeper in focal adhesions regulating mechanotransduction and YAP/TAZ signalling.
  Wang, Nature cell biology 2021 (PubMed)
  • GeneRIF: CCM3 is a gatekeeper in focal adhesions regulating mechanotransduction and YAP/TAZ signalling.
• Mural Cell-Specific Deletion of Cerebral Cavernous Malformation 3 in the Brain Induces Cerebral Cavernous Malformations.
  Wang, Arteriosclerosis, thrombosis, and vascular biology 2020 (PubMed)
  • GeneRIF: Mural Cell-Specific Deletion of Cerebral Cavernous Malformation 3 in the Brain Induces Cerebral Cavernous Malformations.
• Distinct cellular roles for PDCD10 define a gut-brain axis in cerebral cavernous malformation.
  Tang, Science translational medicine 2019
  • GeneRIF: Distinct cellular roles for PDCD10 define a gut-brain axis in cerebral cavernous malformation.
• Endothelial exocytosis of angiopoietin-2 resulting from CCM3 deficiency contributes to cerebral cavernous malformation.
  Jenny, Nature medicine 2016
  • GeneRIF: CCM3 suppresses UNC13B- and vesicle-associated membrane protein 3 (VAMP3)-dependent exocytosis of angiopoietin 2 (ANGPT2) in brain endothelial cells. CCM3 deficiency in endothelial cells augments the exocytosis and secretion of ANGPT2, which is associated with destabilized endothelial cell junctions, enlarged lumen formation and endothelial cell-pericyte dissociation.
• More
• Comparative proteome analysis revealed the differences in response to both Mycobacterium tuberculosis and Mycobacterium bovis infection of bovine alveolar macrophages.
  Cai, Frontiers in cellular and infection microbiology 2023
  • “...encoding autophagy-related proteins The expression of important defence- and autophagy-related proteins induced by MB infection (Q0VCQ6, Q05204 and Q8HXK9) was investigated through real-time quantitative polymerase chain reactions (RTqPCR). The specific primers for RTqPCR were designed using Primer 6 (v6.24) Designer. Total RNA extraction and quantification were...”
  • “...shown in Table1 . Table1 Primer sequences for real-time PCR. Gene Primer (Forwards) Primer (Reverse) Q0VCQ6 CCGGTCAGTATATGTTTTGTGCT CATGACTGCATAGAGGGGCA Q05204 CAACCCCAACAAGACCACCT GGTCTCGAGAAGCCAAACCA Q8HXK9 TTTCCAAAGGGCAGACACCC CACCGTACGCCTCCAGATAG GAPDH AACGGATTTGGTCGTATTGG TTGATTTTGGAGGGATCTCG Results Quantitative proteomic analysis by label free To explore the proteomic profile alterations in BAMs following infection with MTB...”
• Influence of Schistosoma japonicum programmed cell death protein 10 on the growth and development of schistosomula
  Gao, Parasites & vectors 2018
  • “...(A0A183X0F3), Echinostoma caproni (A0A183AMZ2), Capitella teleta (R7TWK6), Caenorhabditis elegans (Q17958), Homo sapiens (Q9BUL8), Mus musculus (Q8VE70), Rattus norvegicus (Q6NX65), Otolemur garnettii (H0XA12), Lithobates catesbeiana (C1C3N3), Crassostrea gigas (K1PTV5), Strigamia maritima (T1JN96), Nasonia vitripennis (K7IPU5), Arion vulgaris (A0A0B6Y0C7), Lottia gigantea (V4B5U4), Zootermopsis nevadensis (A0A067R7A2), and Xenopus laevis...”
• Molecular cloning, expression and characterization of programmed cell death 10 from sheep (Ovis aries).
  Yang, Gene 2015 (PubMed)
  • GeneRIF: The full-length cDNA of OaPDCD10 was 1343bp with a 639bp open reading frame (ORF) encoding 212 amino acid residues. Tissue distribution of OaPDCD10 mRNA determined that it was ubiquitously expressed in all tested tissue samples, and the highest expression was observed in the heart.

PDC10_HUMAN / Q9BUL8 Programmed cell death protein 10; Cerebral cavernous malformations 3 protein; TF-1 cell apoptosis-related protein 15 from Homo sapiens (Human) (see 6 papers)
Aligns to 74:161 / 212 (41.5%), covers 100.0% of PF06840, 136.0 bits

• function: Promotes cell proliferation. Modulates apoptotic pathways. Increases mitogen-activated protein kinase activity and STK26 activity (PubMed:27807006). Important for cell migration, and for normal structure and assembly of the Golgi complex (PubMed:27807006). Part of the striatin-interacting phosphatase and kinase (STRIPAK) complexes. STRIPAK complexes have critical roles in protein (de)phosphorylation and are regulators of multiple signaling pathways including Hippo, MAPK, nuclear receptor and cytoskeleton remodeling. Different types of STRIPAK complexes are involved in a variety of biological processes such as cell growth, differentiation, apoptosis, metabolism and immune regulation (PubMed:18782753). Important for KDR/VEGFR2 signaling. Increases the stability of KDR/VEGFR2 and prevents its breakdown. Required for normal cardiovascular development. Required for normal angiogenesis, vasculogenesis and hematopoiesis during embryonic development (By similarity).
  subunit: Homodimer (PubMed:20489202). Interacts (via C-terminus) with CCM2 (PubMed:17360971, PubMed:20489202). Interacts (via C-terminus) with PXN (PubMed:20489202). Interacts (via N-terminus) with STK25 (PubMed:17360971, PubMed:20332113). Interacts (via N-terminus) with STK26 (PubMed:17360971, PubMed:20332113, PubMed:27807006). Interacts (via N-terminus) with STK24 (PubMed:20332113, PubMed:27807006). Interacts with GOLGA2 (PubMed:20332113). Identified in a complex with KRIT1 and CCM2. Interacts with KDR/VEGFR2. Interaction with KDR/VEGFR2 is enhanced by stimulation with VEGFA (Ref.5). Interacts with RIPOR1 (via C-terminus); this interaction is required for the association of RIPOR1 with either STK24 and STK26 kinases and occurs in a Rho- independent manner (PubMed:27807006). Part of the core of STRIPAK complexes composed of PP2A catalytic and scaffolding subunits, the striatins (PP2A regulatory subunits), the striatin-associated proteins MOB4, STRIP1 and STRIP2, PDCD10 and members of the STE20 kinases, such as STK24 and STK26 (PubMed:18782753).
• Convergence of coronary artery disease genes onto endothelial cell programs.
  Schnitzler, Nature 2024
• The mitotic surveillance pathway requires PLK1-dependent 53BP1 displacement from kinetochores
  Burigotto, 2023
• Metallothionein-3 promotes cisplatin chemoresistance remodelling in neuroblastoma.
  Rodrigo, Scientific reports 2021
  • “...(BID; P55957; pro-apoptotic member of the Bcl-2 protein family), and programmed cell death 10 (PDCD10; Q9BUL8; associated with cell apoptosis as target of C-MYC activation). Previous studies showed that BID expression was positively correlated with cell apoptosis in Nbl 51 . In contrast, over-expression of PDCD10...”
• Quantitative Analysis of Ubiquitinated Proteins in Human Pituitary and Pituitary Adenoma Tissues
  Qian, Frontiers in endocrinology 2019
  • “...10 496;501 1; 1 1.06E+07 Q9BT67 NDFIP1 NEDD4 family-interacting protein 1 TK*AEATIPLVPGR 13 83 1 Q9BUL8 PDCD10 Programmed cell death protein 10 QILSK*IPDEINDR 13 116 1 2.54E+07 Q9BWQ8 FAIM2 Protein lifeguard 2 APGTEGQQQVHGEK*K 15 25 0.822 2.50E+06 Q9H3Z4 DNAJC5 DnaJ homolog subfamily C member 5 FK*EINNAHAILTDATK...”
• Influence of Schistosoma japonicum programmed cell death protein 10 on the growth and development of schistosomula
  Gao, Parasites & vectors 2018
  • “...(A0A074ZX12), Trichobilharzia regent (A0A183X0F3), Echinostoma caproni (A0A183AMZ2), Capitella teleta (R7TWK6), Caenorhabditis elegans (Q17958), Homo sapiens (Q9BUL8), Mus musculus (Q8VE70), Rattus norvegicus (Q6NX65), Otolemur garnettii (H0XA12), Lithobates catesbeiana (C1C3N3), Crassostrea gigas (K1PTV5), Strigamia maritima (T1JN96), Nasonia vitripennis (K7IPU5), Arion vulgaris (A0A0B6Y0C7), Lottia gigantea (V4B5U4), Zootermopsis nevadensis (A0A067R7A2),...”
• Pharmacoproteomic analysis reveals that metapristone (RU486 metabolite) intervenes E-cadherin and vimentin to realize cancer metastasis chemoprevention
  Yu, Scientific reports 2016
  • “...bifunctional protein 9 5.248** 155 326 32.7 B2R7T6 cDNA, FLJ93596 12 7.217** 156 175 21.2 Q9BUL8 Programmed cell death protein 10 5 3.252* 157 264 19.6 B2R673 cDNA, FLJ92818 9 1.884* 158 341 34.1 G8JLB3 tRNA pseudouridine synthase (Fragment) 11 1.653* 159 1093 26 F8W930 Insulin-like...”
• Activation of the Endogenous Renin-Angiotensin-Aldosterone System or Aldosterone Administration Increases Urinary Exosomal Sodium Channel Excretion.
  Qi, Journal of the American Society of Nephrology : JASN 2016
• MiR-206 is expressed in pancreatic islets and regulates glucokinase activity.
  Vinod, American journal of physiology. Endocrinology and metabolism 2016
  • “...Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 2 P20936 RASA1 Ras GTPase-activating protein 1 Q9BUL8 PDCD10 Programmed cell death protein 10 P62158 CALM1 Calmodulin P40189 IL6ST Interleukin-6 receptor subunit- O14786 NRP1 Neuropilin-1 O14977 AZIN1 Antizyme inhibitor 1 Q15057 ACAP2 Arf-GAP with coiled-coil, ANK repeat and...”
• More

Q5ZIV5 Programmed cell death protein 10 from Gallus gallus
NP_001006554 programmed cell death protein 10 from Gallus gallus
Aligns to 74:161 / 212 (41.5%), covers 100.0% of PF06840, 136.0 bits

• A Proteomic View of the Cross-Talk Between Early Intestinal Microbiota and Poultry Immune System
  Rodrigues, Frontiers in physiology 2020
  • “...ACE Angiotensin I converting enzyme 1.000 0.003 P02612 MYL9 Myosin light chain 9 2.400 0.004 Q5ZIV5 PDCD10 Programmed cell death 10 6.800 0.005 P20678 Cyp2c23 Cytochrome P450, family 2, subfamily c, polypeptide 23 10.000 0.007 Q9PW72 PDLIM4 PDZ and LIM domain 4 2.000 0.013 P24797 ATP1A2...”
  • “...Q10751 ACE Angiotensin I converting enzyme 10.000 0.016 P55080 MFAP1 Microfibril-associated protein 1 7.500 0.018 Q5ZIV5 PDCD10 Programmed cell death protein 10 5.800 0.021 Q9PW72 PDLIM4 PDZ and LIM domain 4 5.000 0.021 Q5ZM35 TWF2 Twinfilin actin binding protein 2 7.100 0.022 Q90615 ITGA1 Integrin subunit...”
• PDCD10/CCM3 acts downstream of {gamma}-protocadherins to regulate neuronal survival.
  Lin, The Journal of biological chemistry 2010
  • GeneRIF: PDCD10/CCM3 acts as a critical regulator of neuronal survival during development

3rqgC / Q9BUL8 Cerebral cavernous malformation 3 (ccm3) in complex with paxillin ld4 (see paper)
Aligns to 76:163 / 212 (41.5%), covers 100.0% of PF06840, 135.8 bits

• Ligand: peptide (3rqgC)

PD10A_DANRE / Q6PHH3 Programmed cell death protein 10-A from Danio rerio (Zebrafish) (Brachydanio rerio) (see paper)
NP_956849 programmed cell death protein 10-A from Danio rerio
Aligns to 72:159 / 210 (41.9%), covers 100.0% of PF06840, 135.1 bits

• function: Promotes cell proliferation. Modulates apoptotic pathways. Increases mitogen-activated protein kinase activity. Important for cell migration, and for normal structure and assembly of the Golgi complex. Important for KDR/VEGFR2 signaling. Required for normal angiogenesis, vasculogenesis and hematopoiesis during embryonic development (By similarity). Required for normal cardiovascular development (PubMed:19370760). Promotes cell proliferation. Modulates apoptotic pathways. Increases mitogen-activated protein kinase activity and STK26 activity. Important for cell migration, and for normal structure and assembly of the Golgi complex. Part of the striatin-interacting phosphatase and kinase (STRIPAK) complexes. STRIPAK complexes have critical roles in protein (de)phosphorylation and are regulators of multiple signaling pathways including Hippo, MAPK, nuclear receptor and cytoskeleton remodeling. Different types of STRIPAK complexes are involved in a variety of biological processes such as cell growth, differentiation, apoptosis, metabolism and immune regulation (By similarity).
  subunit: Interacts (via C-terminus) with CCM2. Interacts (via N- terminus) with STK25 and STK26.
• Ccm3 functions in a manner distinct from Ccm1 and Ccm2 in a zebrafish model of CCM vascular disease.
  Yoruk, Developmental biology 2012 (PubMed)
  • GeneRIF: CCM3 plays a role distinct from CCM1/2 in Cerebral cavernous malformations pathogenesis, and acts via GCKIII activity to regulate cranial vasculature integrity and development.
• CCM3/PDCD10 heterodimerizes with germinal center kinase III (GCKIII) proteins using a mechanism analogous to CCM3 homodimerization.
  Ceccarelli, The Journal of biological chemistry 2011
  • GeneRIF: Sequence conservation and binding studies suggest that CCM3 may preferentially heterodimerize with GCKIII proteins through a manner structurally analogous to that employed for CCM3 homodimerization.
• Functional analyses of human and zebrafish 18-amino acid in-frame deletion pave the way for domain mapping of the cerebral cavernous malformation 3 protein.
  Voss, Human mutation 2009 (PubMed)
  • GeneRIF: The newly mapped STK25 and MST4 interaction domain within the CCM3 protein plays a crucial role for vascular development in zebrafish.

PD10B_DANRE / Q6NWL1 Programmed cell death protein 10-B from Danio rerio (Zebrafish) (Brachydanio rerio) (see paper)
NP_998098 programmed cell death protein 10-B from Danio rerio
Aligns to 72:159 / 210 (41.9%), covers 100.0% of PF06840, 134.8 bits

• function: Promotes cell proliferation. Modulates apoptotic pathways. Increases mitogen-activated protein kinase activity. Important for cell migration, and for normal structure and assembly of the Golgi complex. Important for KDR/VEGFR2 signaling. Required for normal angiogenesis, vasculogenesis and hematopoiesis during embryonic development (By similarity). Required for normal cardiovascular development (PubMed:19370760). Promotes cell proliferation. Modulates apoptotic pathways. Increases mitogen-activated protein kinase activity and STK26 activity. Important for cell migration, and for normal structure and assembly of the Golgi complex. Part of the striatin-interacting phosphatase and kinase (STRIPAK) complexes. STRIPAK complexes have critical roles in protein (de)phosphorylation and are regulators of multiple signaling pathways including Hippo, MAPK, nuclear receptor and cytoskeleton remodeling. Different types of STRIPAK complexes are involved in a variety of biological processes such as cell growth, differentiation, apoptosis, metabolism and immune regulation (By similarity).
  subunit: Interacts (via C-terminus) with CCM2. Interacts (via N- terminus) with STK25 and STK26.
• Functional analyses of human and zebrafish 18-amino acid in-frame deletion pave the way for domain mapping of the cerebral cavernous malformation 3 protein.
  Voss, Human mutation 2009 (PubMed)
  • GeneRIF: The newly mapped STK25 and MST4 interaction domain within the CCM3 protein plays a crucial role for vascular development in zebrafish.

H0XA12 Programmed cell death 10 from Otolemur garnettii
Aligns to 74:161 / 212 (41.5%), covers 100.0% of PF06840, 134.6 bits

• Influence of Schistosoma japonicum programmed cell death protein 10 on the growth and development of schistosomula
  Gao, Parasites & vectors 2018
  • “...(R7TWK6), Caenorhabditis elegans (Q17958), Homo sapiens (Q9BUL8), Mus musculus (Q8VE70), Rattus norvegicus (Q6NX65), Otolemur garnettii (H0XA12), Lithobates catesbeiana (C1C3N3), Crassostrea gigas (K1PTV5), Strigamia maritima (T1JN96), Nasonia vitripennis (K7IPU5), Arion vulgaris (A0A0B6Y0C7), Lottia gigantea (V4B5U4), Zootermopsis nevadensis (A0A067R7A2), and Xenopus laevis (Q8AVR4). Abbreviations : S, stable; US,...”

C1C3N3 Programmed cell death protein 10 from Aquarana catesbeiana
Aligns to 72:159 / 210 (41.9%), covers 100.0% of PF06840, 134.3 bits

• Influence of Schistosoma japonicum programmed cell death protein 10 on the growth and development of schistosomula.
  Gao, Parasites & vectors 2018
  • “...(Q17958), Homo sapiens (Q9BUL8), Mus musculus (Q8VE70), Rattus norvegicus (Q6NX65), Otolemur garnettii (H0XA12), Lithobates catesbeiana (C1C3N3), Crassostrea gigas (K1PTV5), Strigamia maritima (T1JN96), Nasonia vitripennis (K7IPU5), Arion vulgaris (A0A0B6Y0C7), Lottia gigantea (V4B5U4), Zootermopsis nevadensis (A0A067R7A2), and Xenopus laevis (Q8AVR4). Abbreviations : S, stable; US, unstable Sjpcdp 10...”

NP_650459 cerebral cavernous malformation 3 from Drosophila melanogaster
Aligns to 64:156 / 208 (44.7%), covers 100.0% of PF06840, 132.6 bits

• NDR kinase tricornered genetically interacts with Ccm3 and metabolic enzymes in Drosophila melanogaster tracheal development.
  Hudson, G3 (Bethesda, Md.) 2023
  • GeneRIF: NDR kinase tricornered genetically interacts with Ccm3 and metabolic enzymes in Drosophila melanogaster tracheal development.
• Focal defects in single-celled tubes mutant for Cerebral cavernous malformation 3, GCKIII, or NSF2.
  Song, Developmental cell 2013
  • GeneRIF: CCM3 and GCKIII prevent tube dilation in Drosophila trachea; tube dilation is suppressed by reduction of NSF2

T1JN96 Brix domain-containing protein from Strigamia maritima
Aligns to 959:1049 / 1101 (8.3%), covers 100.0% of PF06840, 129.3 bits

• Influence of Schistosoma japonicum programmed cell death protein 10 on the growth and development of schistosomula
  Gao, Parasites & vectors 2018
  • “...(Q8VE70), Rattus norvegicus (Q6NX65), Otolemur garnettii (H0XA12), Lithobates catesbeiana (C1C3N3), Crassostrea gigas (K1PTV5), Strigamia maritima (T1JN96), Nasonia vitripennis (K7IPU5), Arion vulgaris (A0A0B6Y0C7), Lottia gigantea (V4B5U4), Zootermopsis nevadensis (A0A067R7A2), and Xenopus laevis (Q8AVR4). Abbreviations : S, stable; US, unstable Sjpcdp 10 mRNA expression at different developmental stages...”

R7TWK6 Programmed cell death protein 10 dimerisation domain-containing protein from Capitella teleta
Aligns to 68:157 / 208 (43.3%), covers 100.0% of PF06840, 128.8 bits

• Influence of Schistosoma japonicum programmed cell death protein 10 on the growth and development of schistosomula
  Gao, Parasites & vectors 2018
  • “...(A0A095APY2), Clonorchis sinensis (H2KTN8), Opisthorchis viverrini (A0A074ZX12), Trichobilharzia regent (A0A183X0F3), Echinostoma caproni (A0A183AMZ2), Capitella teleta (R7TWK6), Caenorhabditis elegans (Q17958), Homo sapiens (Q9BUL8), Mus musculus (Q8VE70), Rattus norvegicus (Q6NX65), Otolemur garnettii (H0XA12), Lithobates catesbeiana (C1C3N3), Crassostrea gigas (K1PTV5), Strigamia maritima (T1JN96), Nasonia vitripennis (K7IPU5), Arion vulgaris (A0A0B6Y0C7),...”

K1PTV5 Programmed cell death protein 10 from Crassostrea gigas
Aligns to 57:148 / 201 (45.8%), covers 97.8% of PF06840, 118.9 bits

• Influence of Schistosoma japonicum programmed cell death protein 10 on the growth and development of schistosomula
  Gao, Parasites & vectors 2018
  • “...(Q9BUL8), Mus musculus (Q8VE70), Rattus norvegicus (Q6NX65), Otolemur garnettii (H0XA12), Lithobates catesbeiana (C1C3N3), Crassostrea gigas (K1PTV5), Strigamia maritima (T1JN96), Nasonia vitripennis (K7IPU5), Arion vulgaris (A0A0B6Y0C7), Lottia gigantea (V4B5U4), Zootermopsis nevadensis (A0A067R7A2), and Xenopus laevis (Q8AVR4). Abbreviations : S, stable; US, unstable Sjpcdp 10 mRNA expression at...”

V4B5U4 Programmed cell death protein 10 dimerisation domain-containing protein from Lottia gigantea
Aligns to 68:159 / 212 (43.4%), covers 98.9% of PF06840, 110.9 bits

• Influence of Schistosoma japonicum programmed cell death protein 10 on the growth and development of schistosomula
  Gao, Parasites & vectors 2018
  • “...(C1C3N3), Crassostrea gigas (K1PTV5), Strigamia maritima (T1JN96), Nasonia vitripennis (K7IPU5), Arion vulgaris (A0A0B6Y0C7), Lottia gigantea (V4B5U4), Zootermopsis nevadensis (A0A067R7A2), and Xenopus laevis (Q8AVR4). Abbreviations : S, stable; US, unstable Sjpcdp 10 mRNA expression at different developmental stages The transcript levels of Sjpcdp 10 mRNA at different...”

PDC10_CAEEL / Q17958 Programmed cell death protein 10 homolog; Cerebral cavernous malformation protein 3 from Caenorhabditis elegans (see paper)
NP_496290 Programmed cell death protein 10 homolog from Caenorhabditis elegans
Aligns to 71:179 / 215 (50.7%), covers 98.9% of PF06840, 106.6 bits

• function: Involved in excretory canal elongation during postembryonic development. Plays a role in promoting Golgi stability, ER integrity and vesicle transport probably by regulating the activation of Rho GTPase cdc-42. Involved in fertility.
  subunit: Interacts with gck-1.
  disruption phenotype: Animals are sterile and develop slowly. Excretory canals are approximately 45% shorter and are characterized by a discontinuous and wider lumen, the presence of cysts and an increased number of canalicular vesicles which are swollen. These defects start during the L3 larval stage and become more severe when reaching adulthood. In addition, cdc-42 expression levels and activity are reduced along the excretory canal length. Animals have also a reduced distribution of Golgi and ER components along the excretory canals.
• A Sterile 20 Family Kinase and Its Co-factor CCM-3 Regulate Contractile Ring Proteins on Germline Intercellular Bridges.
  Rehain-Bell, Current biology : CB 2017
  • GeneRIF: GCK-1 works together with CCM-3, a known binding partner, to promote intercellular bridge stability and limit localization of both canonical anillin and non-muscle myosin II (NMM-II) to intercellular bridges
• CCM-3 Promotes C. elegans Germline Development by Regulating Vesicle Trafficking Cytokinesis and Polarity.
  Pal, Current biology : CB 2017 (PubMed)
  • GeneRIF: This study establishes CCM-3 as a novel regulator of rachis lumenization and polarity establishment during embryogenesis.
• CCM-3/STRIPAK promotes seamless tube extension through endocytic recycling.
  Lant, Nature communications 2015 (PubMed)
  • GeneRIF: CCM-3/STRIPAK promotes seamless tube extension through endocytic recycling.
• Influence of Schistosoma japonicum programmed cell death protein 10 on the growth and development of schistosomula
  Gao, Parasites & vectors 2018
  • “...(H2KTN8), Opisthorchis viverrini (A0A074ZX12), Trichobilharzia regent (A0A183X0F3), Echinostoma caproni (A0A183AMZ2), Capitella teleta (R7TWK6), Caenorhabditis elegans (Q17958), Homo sapiens (Q9BUL8), Mus musculus (Q8VE70), Rattus norvegicus (Q6NX65), Otolemur garnettii (H0XA12), Lithobates catesbeiana (C1C3N3), Crassostrea gigas (K1PTV5), Strigamia maritima (T1JN96), Nasonia vitripennis (K7IPU5), Arion vulgaris (A0A0B6Y0C7), Lottia gigantea (V4B5U4),...”

H2KTN8 Programmed cell death protein 10 from Clonorchis sinensis
Aligns to 77:165 / 216 (41.2%), covers 100.0% of PF06840, 70.2 bits

• Influence of Schistosoma japonicum programmed cell death protein 10 on the growth and development of schistosomula
  Gao, Parasites & vectors 2018
  • “...numbers are as follows: S. japonicum (Q5D8L4), S. mansoni (C4Q5Z1), S. haematobium (A0A095APY2), Clonorchis sinensis (H2KTN8), Opisthorchis viverrini (A0A074ZX12), Trichobilharzia regent (A0A183X0F3), Echinostoma caproni (A0A183AMZ2), Capitella teleta (R7TWK6), Caenorhabditis elegans (Q17958), Homo sapiens (Q9BUL8), Mus musculus (Q8VE70), Rattus norvegicus (Q6NX65), Otolemur garnettii (H0XA12), Lithobates catesbeiana (C1C3N3),...”

Q5D8L4 Programmed cell death protein 10 from Schistosoma japonicum
Aligns to 77:165 / 216 (41.2%), covers 100.0% of PF06840, 67.1 bits

• Influence of Schistosoma japonicum programmed cell death protein 10 on the growth and development of schistosomula
  Gao, Parasites & vectors 2018
  • “...low homology with those from other species. UniProtKB accession numbers are as follows: S. japonicum (Q5D8L4), S. mansoni (C4Q5Z1), S. haematobium (A0A095APY2), Clonorchis sinensis (H2KTN8), Opisthorchis viverrini (A0A074ZX12), Trichobilharzia regent (A0A183X0F3), Echinostoma caproni (A0A183AMZ2), Capitella teleta (R7TWK6), Caenorhabditis elegans (Q17958), Homo sapiens (Q9BUL8), Mus musculus (Q8VE70),...”

C4Q5Z1 Programmed cell death protein 10 from Schistosoma mansoni
Aligns to 77:165 / 216 (41.2%), covers 100.0% of PF06840, 66.5 bits

• Influence of Schistosoma japonicum programmed cell death protein 10 on the growth and development of schistosomula
  Gao, Parasites & vectors 2018
  • “...those from other species. UniProtKB accession numbers are as follows: S. japonicum (Q5D8L4), S. mansoni (C4Q5Z1), S. haematobium (A0A095APY2), Clonorchis sinensis (H2KTN8), Opisthorchis viverrini (A0A074ZX12), Trichobilharzia regent (A0A183X0F3), Echinostoma caproni (A0A183AMZ2), Capitella teleta (R7TWK6), Caenorhabditis elegans (Q17958), Homo sapiens (Q9BUL8), Mus musculus (Q8VE70), Rattus norvegicus (Q6NX65),...”

Or search for genetic data about PF06840 in the Fitness Browser