Family Search for PF06842 (DUF1242)
PaperBLAST, GapMind, SitesBLAST, and Sites on a Tree will be down for server maintenance on Friday March 29.
Running HMMer for PF06842
PF06842 hits 8 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
KISH_DROME / Q9VWH8 Protein kish from Drosophila melanogaster (Fruit fly) (see paper)
Aligns to 10:44 / 72 (48.6%), covers 100.0% of PF06842, 74.9 bits
- function: Involved in the early part of the secretory pathway.
Tmem167 protein kish-A precursor from Mus musculus
Aligns to 10:44 / 72 (48.6%), covers 100.0% of PF06842, 74.1 bits
- Analyses of binding partners and functional domains for the developmentally essential protein Hmx3a/HMX3
Haws, Scientific reports 2023 - “...MGI:1,922,566 Tspan3 MGI:1,928,098 Commd4 MGI:1,913,449 Psmc3 MGI:1,098,754 Gfm2 MGI:2,444,783 Ahcyl MGI:3,643,647 Lat2 MGI:1,926,479 Uba3 MGI:1,341,217 Tmem167 MGI:1,913,324 Sdhb MGI:1,914,930 Ptpn2 MGI:97,806 We excluded from further analyses genes that either had no obvious ortholog in zebrafish or that were likely to be Y2H false positives because they,...”
- Structural and molecular characterization of paraventricular thalamic glucokinase-expressing neuronal circuits in the mouse
Gaspari, The Journal of comparative neurology 2022 - “...domain containing 7 (Spryd7) Frs2 0.39 .001650842 7.108316 Fibroblast growth factor receptor substrate 2 (Frs2) Tmem167 0.39 .005639071 6.600933 Transmembrane protein 167 (Tmem167) Pogz 0.39 .000558255 7.295534 Pogo transposable element with ZNF domain (Pogz) Rab3a 0.39 .000617378 8.68367 RAB3A, member RAS oncogene family (Rab3a) Tmem87b 0.39...”
- Long Term Response to Circulating Angiogenic Cells, Unstimulated or Atherosclerotic Pre-Conditioned, in Critical Limb Ischemic Mice
Beltrán-Camacho, Biomedicines 2021 - “...RPL37A, RPS17, S100A11, SCD1, SPARC, SEC16A, SPRR1A, SLMAP, SERPINF1, SERPINB6A, SERF2, SNRPD2, STMN1, TGTP1, TNC, TMEM167, TPP1, XIRP1 - ABCA1, APAF1, APBB1IP, APOBR, ARG2, ARL6IP1, ASS1, BC017643, CAPZA1, CAR13, CASP8, CD14, CYBB, DCAKD, DDX39, DHFR, DR1, DTYMK, ELANE, ELMO1, EMB, EMILIN1, EMILIN2, GCN1L1, GFPT1, GIT2, H2AFY,...”
- Promoter-proximal CTCF binding promotes distal enhancer-dependent gene activation
Kubo, Nature structural & molecular biology 2021 - “...artificially tethered CTCF was also dependent on the presence of the promoter of Xrcc4 / Tmem167 gene located at 350 kb downstream of Vcan gene ( Fig. 3a , b , the cell line depicted on second from the bottom). PLAC-seq experiments showed that the Vcan...”
- “...the long-range chromatin contacts between Vcan promoter and the 350 kb downstream distal Xrcc4 / Tmem167 promoter was also re-established ( Fig. 3e , f , Extended Data Fig. 8d ). Taken together, our results demonstrated that promoter-proximal CTCF binding can promote long-range promoter-anchored chromatin contacts...”
- Temporal Integrative Analysis of mRNA and microRNAs Expression Profiles and Epigenetic Alterations in Female SAMP8, a Model of Age-Related Cognitive Decline
Cosín-Tomás, Frontiers in genetics 2018 - “.../ NM_023403.1 /2.71 Vps50 / NM_024260.5 /3.17 Tgfbr1 / NM_009370.3 /2.31 Irf6 / NM_016851.2 /2.03 Tmem167 / NM_025335.2 /2.85 Arl4d / NM_025404.3 /2.01 Thrb / NM_009380.3 /2.96 Slc5a3 / NM_017391.1 /2.5 Serbp1 / NM_025814.2 /2.14 Cdip1 / NM_025670.2 /1.99 Unc5c / NM_009472.4 /2.50 Chst2 / NM_018763.2...”
- “...Man1a2, Ndst2, Serf2, Skil, Coro1c, Abca1, Atp6v0d1, Tcp1, Pdk4, Pbx3, Hp, Pdlim4, Ykt6, Kox17, Mesdc2, Tmem167, Serpb1, Lipt2, Atg12, Loh12cr1, Mrpl19, Manba, Trps1, Kremen1 Regulation of membrane lipid distribution (GO:0097035) 0.00260 2.53 4.08 Cellular response to extracellular stimulius (GO:0031668) 0.00299 2.26 3.66 Regulation of extrinsic apoptotic...”
KISHA_HUMAN / Q8TBQ9 Protein kish-A; Transmembrane protein 167; Transmembrane protein 167A from Homo sapiens (Human) (see paper)
NP_777569 protein kish-A precursor from Homo sapiens
Aligns to 10:44 / 72 (48.6%), covers 100.0% of PF06842, 73.7 bits
Q5ZII6 Protein kish-A from Gallus gallus
Aligns to 10:44 / 72 (48.6%), covers 100.0% of PF06842, 72.1 bits
C1LI02 Protein kish from Schistosoma japonicum
Aligns to 10:44 / 72 (48.6%), covers 100.0% of PF06842, 67.9 bits
- iTRAQ-Based Comparative Proteomic Analysis of Adult Schistosoma japonicum from Water Buffalo and Yellow Cattle
Zhai, Frontiers in microbiology 2018 - “...TCCTTATCCGTATCAACTT C1LHC4 FP: GTCCTTATTGTACTTGTTGTC 0.73 1.53 RP: AAATCCCACCATCTTCTAAA C1LAT6 FP: TTATGTCGCAAGCAGATG 1.94 0.33 RP: TTGTAGGTCTTAGCAAGTT C1LI02 FP: TGCTTACATTAGACACTTCTCT 0.50 0.48 RP: TTGCGTTCACCAATCCTT Gene relative expression in schistosomes from water buffalo compared with those from yellow cattle has opposite expression regulation between qRT-PCR analysis and iTRAQ analysis....”
- “...protein 34.59 0.6568 Q5DGG9 Troponin T 63.21 0.6499 Q5BS32 Dynein light chain roadblock 12.37 0.5555 C1LI02 Transmembrane protein 167 precursor 13.89 0.4772 C1LEX2 Inner nuclear membrane protein Man1 (LEM domain-containing protein 3) 7.13 0.6609 Protein proteolysis F6LHR8 Tetraspanin 2 27.44 1.742 C1LBS5 Cathepsin L, a 34.14...”
KISH_SCHPO / G2TRS3 Protein kish from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see paper)
Aligns to 10:44 / 73 (47.9%), covers 100.0% of PF06842, 61.9 bits
- function: Involved in the early part of the secretory pathway.
disruption phenotype: Inviable.
KISH_YEAST / Q8TGJ3 Protein Kish from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 2 papers)
YNL024C-A Putative protein of unknown function; YNL024C-A is an essential gene from Saccharomyces cerevisiae
Aligns to 10:45 / 72 (50.0%), covers 100.0% of PF06842, 61.2 bits
- function: Involved in the early part of the secretory pathway.
disruption phenotype: Inviable. - A semi-supervised Bayesian approach for simultaneous protein sub-cellular localisation assignment and novelty detection
Crook, PLoS computational biology 2020 - “...as core components of COPII vesicles and 6 associated with COPI vesicles. The protein Ksh1p (Q8TGJ3) is further suggested through homology with higher organisms to be part of the early secretory pathway [ 52 ]. The proteins Scw4p (P53334), Cts1p (P29029) and Scw10p (Q04951) [ 53...”
- A widespread inversion polymorphism conserved among Saccharomyces species is caused by recurrent homogenization of a sporulation gene family
Salzberg, PLoS genetics 2022 - “...protein, confers rapamycin resistance by binding Fpr1 YNL024C EFM6 Putative SAM-dependent lysine methyltransferase, methylates EF-1 YNL024C-A KSH1 Kish small membrane protein, role in secretory pathway YNCN0014W SNR66 snR66 small nucleolar RNA (snoRNA) YNCN0013W NME1 RNA component of RNAse MRP, cleaves pre-rRNA YNL025C SSN8 Cyclin-like component of...”
- Computational discovery and annotation of conserved small open reading frames in fungal genomes
Mat-Sharani, BMC bioinformatics 2019 - “...from this study Kastenmayer et al S.cerevisiae-gi14318502 YFL017W-A S.cerevisiae-gi6323292 #N/A S.cerevisiae-gi398364355 YFR032C-A S.cerevisiae-gi6323318 #N/A S.cerevisiae-gi398365385 YNL024C-A S.cerevisiae-gi6323506 #N/A S.cerevisiae-gi398365605 YLR287C-A S.cerevisiae-gi6323558 #N/A S.cerevisiae-gi398365775 YOR210W S.cerevisiae-gi6323634 #N/A S.cerevisiae-gi398365789 YDR139C S.cerevisiae-gi6323912 #N/A S.cerevisiae-gi398366075 YLR388W S.cerevisiae-gi6324184 #N/A S.cerevisiae-gi6321622 YGR183C S.cerevisiae-gi6324259 #N/A S.cerevisiae-gi6321937 YHR143W-A S.cerevisiae-gi6324313 #N/A S.cerevisiae-gi6323294 YLR264W S.cerevisiae-gi6324619 #N/A...”
- Augmented annotation of the Schizosaccharomyces pombe genome reveals additional genes required for growth and viability
Bitton, Genetics 2011 - “...2); it has human (TMEM167A) and S. cerevisiae (YNL024C-A) orthologs whose functions are suggested to lie within the secretory pathway (Wendler et al. 2009)....”
- A genome-wide RNA interference screen identifies two novel components of the metazoan secretory pathway
Wendler, The EMBO journal 2010 - “...by the previously uncharacterised open reading frame (ORF) YNL024c-a. This yeast protein has only 72 residues and is 56% identical to the Drosophila protein,...”
- “...At Dd Hs Xl Ce CG14199 Tmem167A Tmem167A YNL024c-a At5g20165 TM167 Tmem167B Tmem167B K07F5.15 1 1 1 1 1 1 1 1 1...”
- Functional genomics of genes with small open reading frames (sORFs) in S. cerevisiae
Kastenmayer, Genome research 2006 - “...YNR032C-A YOR167C YLR264W YKR057W YJL136C YDR139C YNL024C-A YLR038C YOR159C YGR037C YIL008W YER146W YOR298C-A YER048W-A YBL071W-A YFR032C-A YBR089C-A YPR052C...”
- “...YBR233W-A YDR320C-A YER074W-A YHR072W-A YKL138C-A YLR099W-A YNL024C-A YNL138W-A YBL071C-B YBL071W-A YGL007C-A YGL188C-A YPL096C-A YPL189C-A DAD3 DAD4 YOS1 NOP10...”
- Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii
Brachat, Genome biology 2003 - “...1 ). This suggests that they represent conserved fungal proteins. For two genes, YMR194C-B and YNL024C-A, we identified homologs in higher eukaryotes, including mouse and human. The conservation in other species, and particularly their syntenic positions in A. gossypii , strongly support the authenticity of these...”
- “...75 YLR307C-A 87 50.00 AFL165W 94 YMR194C-B 73 51.47 x x x x ADL210W 72 YNL024C-A 72 81.94 x x x x AFR059W 84 YNL138W-A 85 52.38 x AAR108W-A 70 YOR020W-A 90 35.71 x x ABR192C-A 71 YPL096C-A 68 45.59 x AFL069C 58 YPL189C-A 68 69.64...”
- Parallel identification of new genes in Saccharomyces cerevisiae
Oshiro, Genome research 2002 - “...YHR050W-A YHR132W-B YIL002W-A YIL046W-A YKR099C-A YLR154W-B YMR175W-A YNL024C-A YOR072W-A YOR192C-C YPR170W-A Chromosomal location Chr Chr Chr Chr Chr Chr Chr...”
KISHB_HUMAN / Q9NRX6 Protein kish-B; Transmembrane protein 167B from Homo sapiens (Human) (see paper)
Aligns to 10:46 / 74 (50.0%), covers 97.1% of PF06842, 43.3 bits
- function: Involved in the early part of the secretory pathway.
Or search for genetic data about PF06842 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory