Family Search for PF06980 (DUF1302)
PF06980.11 hits 16 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
PP0765 conserved hypothetical protein (NCBI ptt file) from Pseudomonas putida KT2440
PP_0765 DUF1302 domain-containing protein from Pseudomonas putida KT2440
Aligns to 31:628 / 628 (95.2%), covers 100.0% of PF06980, 773.9 bits
PA14_13130 hypothetical protein (NCBI) from Pseudomonas aeruginosa UCBPP-PA14
Aligns to 31:641 / 641 (95.3%), covers 100.0% of PF06980, 769.0 bits
PA3923 hypothetical protein (NCBI) from Pseudomonas aeruginosa PAO1
Aligns to 31:641 / 641 (95.3%), covers 100.0% of PF06980, 768.7 bits
- Pseudomonas aeruginosa uses multiple receptors for adherence to laminin during infection of the respiratory tract and skin wounds
Paulsson, Scientific reports 2019 - “...Four new high-affinity laminin receptors were identified in the outer membrane; EstA, OprD, OprG and PA3923. Mutated bacteria devoid of these receptors adhered poorly to immobilized laminin. All bacterial receptors bound to the heparin-binding domains on LG4 and LG5 of the laminin alpha chain as assessed...”
- “...laminin-receptor on P. aeruginosa 14 , four of those, i.e ., EstA, OprD, OprG and PA3923, were further characterized as laminin-receptors in downstream analysis. The remaining six putative laminin-binding proteins were discarded either since the amino acid sequence indicated other subcellular localization than the outer membrane,...”
- Inhibition of Pseudomonas aeruginosa swarming motility by 1-naphthol and other bicyclic compounds bearing hydroxyl groups
Oura, Applied and environmental microbiology 2015 - “...PA1914 PA3369 PA3370 PA3371 PA3488 PA3520 PA3601 PA3919 PA3923 PA3969 PA4063 PA4115 PA4155 PA4220 PA4648 PA4773 PA4774 PA4916 PA5460 PA5481 a Fold change...”
- σ Factor and Anti-σ Factor That Control Swarming Motility and Biofilm Formation in Pseudomonas aeruginosa
McGuffie, Journal of bacteriology 2015 - “...PA1494 PA2432 PA2895 PA2896 PA3179 PA3569 PA3570 PA3876 PA3923 PA4495 PA5172 PA5315 PA5435 PA5445 PAO1 sbrR pPSV38 vs. PAO1 pPSV38 ical triplicate or...”
- A temporal examination of the planktonic and biofilm proteome of whole cell Pseudomonas aeruginosa PAO1 using quantitative mass spectrometry
Park, Molecular & cellular proteomics : MCP 2014 - “...transporter), PA3236 (a probable glycine betaine-binding protein), PA3923, and PA3922. PA3923 has 77% sequence identity to the adhesion AidA, whereas PA3922...”
- “...variety of Pseudomonas species. The consistent detection of PA3923 in the biofilm samples might be biologically relevant in light of studies in pathogenic...”
- Comparative systems biology analysis to study the mode of action of the isothiocyanate compound Iberin on Pseudomonas aeruginosa
Tan, Antimicrobial agents and chemotherapy 2014 - “...PA3520 PA3554 PA3613 PA3621.1 PA3691 PA3692 PA3724 PA3734 PA3923 PA3974 PA4078 PA4112 PA4141 PA4142 PA4143 PA4144 PA4156 PA4159 PA4160 PA4175 PA4207 PA4209...”
- Food as a source for quorum sensing inhibitors: iberin from horseradish revealed as a quorum sensing inhibitor of Pseudomonas aeruginosa
Jakobsen, Applied and environmental microbiology 2012 - “...PA3331 PA3361 PA3477 PA3478 PA3479 PA3520 PA3692 PA3724 PA3923 PA4129 PA4130 PA4131 PA4132 PA4133 PA4134 PA4141 PA4142 PA4175 PA4209 PA4211 PA4217 PA4738 PA4739...”
- A eukaryotic-type signalling system of Pseudomonas aeruginosa contributes to oxidative stress resistance, intracellular survival and virulence
Goldová, BMC genomics 2011 - “...(Translation, post-translational modification, degradation; Secreted Factors (toxins, enzymes, alginate)) RpoS, PQS PA3922 11.31 0.038 CHP PA3923 b 8.11 0.143 HP PA4497 2.61 0.031 Pr. binding protein component of ABC transporter (Transport of small molecules) PA5481 2.01 0.038 HP PQS/MvfR regulon PA0200 5.10 0.048 HP PA0201 5.10...”
- Adaptation of aerobically growing Pseudomonas aeruginosa to copper starvation
Frangipani, Journal of bacteriology 2008 - “...PA1562 (acnA) PA1761 PA2953 PA3235 PA3531 (bfrB) PA3602 PA3923 PA5300 (cycB) Fold change 6710 FRANGIPANI ET AL. J. BACTERIOL. TABLE 2--Continued Gene (name)...”
- More
PflA506_0906 DUF1302 domain-containing protein from Pseudomonas fluorescens A506
Aligns to 31:619 / 619 (95.2%), covers 100.0% of PF06980, 767.8 bits
PA14_19810 hypothetical protein (NCBI) from Pseudomonas aeruginosa UCBPP-PA14
PA3422 hypothetical protein (NCBI) from Pseudomonas aeruginosa PAO1
Aligns to 31:585 / 585 (94.9%), covers 100.0% of PF06980, 737.5 bits
Psest_1122 predicted exporter of cell wall component, with DUF1329, BNR, and RND proteins (Psest_1123, Psest_1923, Psest_1924) from Pseudomonas stutzeri RCH2
Aligns to 31:601 / 601 (95.0%), covers 99.8% of PF06980, 710.3 bits
- mutant phenotype: PFam PF06980.7 (DUF1302). conserved cofitness
Sama_1588 predicted exporter of cell wall component, with DUF1329, BNR, and RND proteins (Sama_1589, Sama_1590, Sama_1591) from Shewanella amazonensis SB2B
Aligns to 32:691 / 691 (95.5%), covers 99.8% of PF06980, 668.7 bits
- mutant phenotype: PFam PF06980.7 (DUF1302). conserved cofitness
gbt / Q9HZC6 glycine betaine transmethylase (EC 2.1.1.5) from Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) (see paper)
PA3082 glycine betaine transmethylase (NCBI) from Pseudomonas aeruginosa PAO1
Aligns to 36:654 / 654 (94.6%), covers 99.3% of PF06980, 618.5 bits
B158DRAFT_0994 predicted exporter of cell wall component, with DUF1329, BNR, and RND proteins (B158DRAFT_0995, B158DRAFT_0996, B158DRAFT_0997) from Kangiella aquimarina DSM 16071
Aligns to 36:637 / 637 (94.5%), covers 99.8% of PF06980, 577.5 bits
- mutant phenotype: PFam PF06980.7 (DUF1302). conserved cofitness
Kkor_1992 protein of unknown function DUF1302 (RefSeq) from Kangiella koreensis DSM 16069
Aligns to 36:637 / 637 (94.5%), covers 99.8% of PF06980, 566.9 bits
DBX28_14755 DUF1302 domain-containing protein from Pseudomonas aeruginosa
Aligns to 4:528 / 528 (99.4%), covers 99.6% of PF06980, 479.8 bits
Pfl01_2750 hypothetical protein (RefSeq) from Pseudomonas fluorescens Pf0-1
Aligns to 24:548 / 548 (95.8%), covers 99.8% of PF06980, 479.1 bits
ebA1936 DUF1302 domain-containing protein from Aromatoleum aromaticum EbN1
ebA1936 hypothetical protein (NCBI) from Azoarcus sp. EbN1
Aligns to 40:561 / 561 (93.0%), covers 99.8% of PF06980, 450.1 bits
- Anaerobic catabolism of aromatic compounds: a genetic and genomic view
Carmona, Microbiology and molecular biology reviews : MMBR 2009 - “...products of the ebA326 to ebA335, ebA1926 to ebA1936, and ebA5762 to ebA5768 genes were specifically formed during anaerobic growth on p-ethylphenol (379),...”
- “...the bbs cluster, there are five genes (ebA1926 to ebA1936) organized in an operon-like structure, two of which (ebA1932 and ebA1936) encode proteins that are...”
- Substrate-dependent regulation of anaerobic degradation pathways for toluene and ethylbenzene in a denitrifying bacterium, strain EbN1
Kühner, Journal of bacteriology 2005 - “...implicated in ethylbenzene degradation, and the ebA1932 and ebA1936 genes, located 7.2 kb upstream of the bbs operon, are implicated in toluene degradation. In...”
- “...in the promoter regions of bssD, bbsA, and the ebA1936 gene is located 118, 68, and 450 bp upstream of the respective translational starts. VOL. 187, 2005...”
O87938 Uncharacterized protein from Thauera aromatica
Aligns to 43:564 / 564 (92.6%), covers 99.6% of PF06980, 444.1 bits
ebA335 hypothetical protein (NCBI) from Azoarcus sp. EbN1
ebA335 DUF1302 domain-containing protein from Aromatoleum aromaticum EbN1
Aligns to 40:561 / 561 (93.0%), covers 99.8% of PF06980, 438.8 bits
- The predicted σ(54)-dependent regulator EtpR is essential for expression of genes for anaerobic p-ethylphenol and p-hydroxyacetophenone degradation in "Aromatoleum aromaticum" EbN1
Büsing, BMC microbiology 2015 - “...-ethylphenol" gene clusters, i.e., acsA , hped and pchF for the "catabolic" gene cluster and ebA335 , ebA327 and ebA326 for the "efflux" gene cluster (Fig. 3a ). Transcripts of both gene clusters were only detected in wild type and etpR -complemented mutant cells growing with...”
- “...ebA329_212_F ebA329 TGCGGCCCCTGATG 316 ebA329_537_R ACGATGCCGCTGTGG ebA332_488_F e bA 332 CCGGCGTGGAGGTAG 285 ebA332_772_R GGCGCGGGGTTTT ebA335_1092_F ebA335 GCTGGGGGAGACGAA 253 ebA335_1344_R CGCCGCCTTGTTGT Generation of etpR deletion mutation acsA_BamHI_F acsA AA GGATCC CACGAAATGTCTCCTGAACCCTGC 1300 acsA_SphI_R ACCGG GCATGC GCCCACCAGC ebA327_BamHI_F ebA326/ebA327 GATCA GGATCC ACGTCACCG 2350 ebA326_BamHI_R AA GGATCC TGACCGTCGGAGGACCGGATAGATC Identification...”
- Anaerobic catabolism of aromatic compounds: a genetic and genomic view
Carmona, Microbiology and molecular biology reviews : MMBR 2009 - “...additional operon-like structure that contains the ebA326 to ebA335 genes, some of whose products are also upregulated when Azoarcus sp. strain EbN1 cells are...”
- “...of the translational start of the acsA and ebA335 genes, suggesting the transcriptional control of the corresponding promoters by the ebA324 regulator. The...”
- Anaerobic degradation of p-ethylphenol by "Aromatoleum aromaticum" strain EbN1: pathway, regulation, and involved proteins
Wöhlbrand, Journal of bacteriology 2008 - “...85.3 32.5 40.7 pEp and pAc-related proteins EbA329 EbA332 EbA335 2.7 4.2 6.7 2.6 2.1 1.3 15.7 102.1 4.9 32.3 259.7 9.4 Paralogous ethylbenzene gene cluster...”
- “...and four hypothetical proteins (EbA318, EbA329, EbA332, and EbA335). Analogously, expression analysis of pchF and xccA revealed a specific upregulation as well...”
- Nanomolar Responsiveness of an Anaerobic Degradation Specialist to Alkylphenol Pollutants
Vagts, Journal of bacteriology 2020 (secret) - Towards the Response Threshold for p-Hydroxyacetophenone in the Denitrifying Bacterium "Aromatoleum aromaticum" EbN1
Vagts, Applied and environmental microbiology 2018 - “...catabolism (i.e., acsA) and potential efflux (i.e., ebA335). ABSTRACT IMPORTANCE Aromatic compounds are widespread microbial growth substrates with natural as...”
- “...effect on the expression of target genes (e.g., ebA335) (Fig. S4). Thus, the experimental setup afforded cells with adequately energy supplies while at the...”
DelCs14_1756 DUF1302 family protein from Delftia sp. Cs1-4
Aligns to 39:557 / 557 (93.2%), covers 99.6% of PF06980, 383.3 bits
- Nanopods: a new bacterial structure and mechanism for deployment of outer membrane vesicles
Shetty, PloS one 2011 - “...coregulated protein (Hcp) DelCs14_2985 TPR repeat-containing protein DelCs14_3801 Conserved hypothetical protein DelCs14_4061 Unknown function (DUF1302) DelCs14_1756 Unknown function (DUF1329) DelCs14_1757 1 Identified in three independent samples. 2 Numbering in Delftia sp. Cs1-4 genome. 3 Nanopod protein A, see text. The forgoing provided strong evidence supporting our...”
Or search for genetic data about PF06980 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory