Family Search for PF07044 (DUF1329)

April 2024: GapMind for amino acid biosynthesis has been updated to include newly-discovered enzymes and comparative genomics predictions (see details)

PF07044 hits 20 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

PA3081 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 84:450 / 455 (80.7%), covers 100.0% of PF07044, 548.2 bits

• Glycine betaine transmethylase mutant of Pseudomonas aeruginosa
  Serra, Journal of bacteriology 2002
  • “...pJM1 revealed 98% identity to the PAO1 sequence named PA3081. The analysis of the sequence revealed that the transposon had interrupted the locus named PA3082...”
  • “...genome of P. aeruginosa Fildes III. The locations of PA3081, PA3082, and pepN (PA3083) are also shown in the complete genome of P. aeruginosa PAO1 published...”

MPAO1_05390, PaeAG1_01229 DUF1329 domain-containing protein from Pseudomonas aeruginosa
PA14_13140 hypothetical protein from Pseudomonas aeruginosa UCBPP-PA14
PA3922 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 85:450 / 455 (80.4%), covers 100.0% of PF07044, 538.6 bits

• Transcriptomic determinants of the response of ST-111 Pseudomonas aeruginosa AG1 to ciprofloxacin identified by a top-down systems biology approach
  Molina-Mora, Scientific reports 2020
  • “...lecB (PA3361) 13,150.8 17 1.71 3.88 Turquoise Quorum sensing fucose-binding lectin PA-IIL CIP COL AZM PaeAG1_01229 DR97_3944 15 1.3 1.45 Brown Uncharacterized protein PaeAG1_01591 rpoS (PA3622) 15 1.03 1.49 Turquoise Transcription machinery RNA polymerase sigma factor RpoS COL CIP AZM Cu PaeAG1_01361 DR97_4078 19 -1.22 -1.48...”
• An integrated model system to gain mechanistic insights into biofilm-associated antimicrobial resistance in Pseudomonas aeruginosa MPAO1
  Varadarajan, NPJ biofilms and microbiomes 2020
  • “...PhaF 1.22 0.03 MPAO1_23990 Prepilin-type cleavage/methylation domain-containing protein 3.01 0.00 MPAO1_02180 Response regulator 1.13 0.00 MPAO1_05390 DUF1329 domain-containing protein 2.62 0.00 MPAO1_13900 NADP-dependent glyceraldehyde-3-phosphate dehydrogenase 1.11 0.05 MPAO1_13035 Multidrug efflux RND transporter periplasmic adaptor subunit MexE 1.92 0.00 MPAO1_25100 TonB-dependent hemoglobin/transferrin/lactoferrin family receptor 1.17 0.02 MPAO1_09260...”
• The Core Proteome of Biofilm-Grown Clinical Pseudomonas aeruginosa Isolates
  Erdmann, Cells 2019
  • “...biofilm proteins because they had a more than two-fold difference in protein expression are:PdhB (PA14_19910), PA14_13140, the probable nonribosomal peptide synthetase PA14_11140, PA14_71240 and two-component response regulator PA14_30830. Further analyses of the soft-core biofilm proteins revealed that despite substantial variability between the strains, we found a...”
• NtrBC Regulates Invasiveness and Virulence of Pseudomonas aeruginosa During High-Density Infection
  Alford, Frontiers in microbiology 2020
  • “...2.93 PA3620 mutS DNA mismatch repair protein MutS 1.50 1.39 PA3659 Succinyldiaminopimelate transaminase 1.41 1.61 PA3922 Hypothetical protein 2.53 2.75 PA4024 eutB Ethanolamine ammonia-lyase large subunit 4.66 5.59 PA4172 Hypothetical protein 1.58 8.93 PA4308 Exonuclease III 1.03 1.04 PA4338 Hypothetical protein 1.49 2.26 PA4659 MerR family...”
• Tobramycin reduces key virulence determinants in the proteome of Pseudomonas aeruginosa outer membrane vesicles
  Koeppen, PloS one 2019
  • “...FliD, LasA, LasB, LipA, PA2939, PasP, PepA, Piv, PlcN Flagellar FliC, FliD Unknown PA1324, PA2635, PA3922, PA4139, PA4140 Subcellular localization annotations were retrieved from Pseudomonas Genome Database ( http://www.pseudomonas.com/localizations/list ). Proteins can be associated with multiple subcellular localizations. Differential abundance of proteins in Tobi OMVs and...”
• A comprehensive study of conditions of the biodegradation of a plastic additive 2,6-di-tert-butylphenol and proteomic changes in the degrader Pseudomonas aeruginosa san ai
  Medić, RSC advances 2019
  • “...R +1.6 UPF0312 protein PLES_04211 Y421_PSEA8 2659 9 52 20.8 4 S 1.0 Uncharacterized protein PA3922 Y3922_PSEAE 101 3 8 51.2 10 S Presence Uncharacterized protein PA1579 Y1579_PSEAE 60 1 6 22.1 4 S +1.1 a Fold change in relative abundance is the ratio of the...”
• Reorganization of gene network for degradation of polycyclic aromatic hydrocarbons (PAHs) in Pseudomonas aeruginosa PAO1 under several conditions
  Yan, Journal of applied genetics 2017
  • “...and PA4515 were PAH degradation genes. In Fig. 8 , two quorum-sensing genes PA3049 and PA3922 are associated with two PAH degradation genes PA0865 and PA2418, respectively. Again, eight genes (PA0958, PA1432, PA1713, PA1723, PA1777, PA1947, PA4922, and PA5253) were focused in AES-2, however, they are...”
• A temporal examination of the planktonic and biofilm proteome of whole cell Pseudomonas aeruginosa PAO1 using quantitative mass spectrometry
  Park, Molecular & cellular proteomics : MCP 2014
  • “...PA3236 (a probable glycine betaine-binding protein), PA3923, and PA3922. PA3923 has 77% sequence identity to the adhesion AidA, whereas PA3922 only showed...”
• Identification of five structurally unrelated quorum-sensing inhibitors of Pseudomonas aeruginosa from a natural-derivative database
  Tan, Antimicrobial agents and chemotherapy 2013
  • “...(G1)a Gene name(s) PA3862 dauB PA4175 PA5100 PA3922 PA3919 PA2300 PA1372 PA0572 PA0792 PA0400 PA5213 PA2951 PA0586 PA2399 PA3924 PA2290 PA2424...”
• Bis-(3'-5')-cyclic dimeric GMP regulates antimicrobial peptide resistance in Pseudomonas aeruginosa
  Chua, Antimicrobial agents and chemotherapy 2013
  • “...PA3977 PA2119 PA0552 PA4687 PA2413 PA4448 PA5172 PA3686 PA3922 PA2385 PA3729 PA0314 PA2445 PA0084 PA3452 PA0400 PA4138 PA4236 PA0139 PA5322 PA2944 PA3186 PA0036...”
• Exploiting quorum sensing to confuse bacterial pathogens
  LaSarre, Microbiology and molecular biology reviews : MMBR 2013
  • “...which employs multiple AHL acylases (PvdQ, QuiP, HacB, and PA3922) (42, 44, 45, 52). One unique exception is the bacterium Rhizobium sp. strain NGR234, which...”
• More

DR97_3944 DUF1329 domain-containing protein from Pseudomonas aeruginosa
Aligns to 85:450 / 455 (80.4%), covers 100.0% of PF07044, 535.7 bits

• Transcriptomic determinants of the response of ST-111 Pseudomonas aeruginosa AG1 to ciprofloxacin identified by a top-down systems biology approach
  Molina-Mora, Scientific reports 2020
  • “...(PA3361) 13,150.8 17 1.71 3.88 Turquoise Quorum sensing fucose-binding lectin PA-IIL CIP COL AZM PaeAG1_01229 DR97_3944 15 1.3 1.45 Brown Uncharacterized protein PaeAG1_01591 rpoS (PA3622) 15 1.03 1.49 Turquoise Transcription machinery RNA polymerase sigma factor RpoS COL CIP AZM Cu PaeAG1_01361 DR97_4078 19 -1.22 -1.48 Brown...”

PP_0766 adhesin-associated sorting protein (DUF1329) from Pseudomonas putida KT2440
PP0766, PP_0766 conserved hypothetical protein from Pseudomonas putida KT2440
Aligns to 84:449 / 454 (80.6%), covers 100.0% of PF07044, 530.1 bits

• mutant phenotype: Conserved cofit with a putative adhesin (PP_0765). DUF1329 is distantly related to lolB, which inserts lipoproteins into the outer membrane. So we predict that DUF1329 is involved in sorting the adhesin to the outer membrane.
• UEG Week 2023 Poster Presentations
  , United European gastroenterology journal 2023
• Fatty Acid and Alcohol Metabolism in Pseudomonas putida: Functional Analysis Using Random Barcode Transposon Sequencing
  Thompson, Applied and environmental microbiology 2020 (secret)
• Mechanisms of resistance to chloramphenicol in Pseudomonas putida KT2440
  Fernández, Antimicrobial agents and chemotherapy 2012
  • “...PP0529 PP0586 PP0588 PP0613 PP0620 PP0741 PP0742 PP0765 PP0766 PP0951 PP1018 PP1514 PP1516 PP2284 PP2310 PP2512 PP2736 PP2738 PP3352 PP3440 PP3656 PP3657 PP3761...”

Sama_1589 adhesin-associated sorting protein (DUF1329) from Shewanella amazonensis SB2B
Aligns to 83:449 / 454 (80.8%), covers 100.0% of PF07044, 528.5 bits

• mutant phenotype: Conserved cofit with a putative adhesin (Sama_1588). DUF1329 is distantly related to lolB, which inserts lipoproteins into the outer membrane. So we predict that DUF1329 is involved in sorting the adhesin to the outer membrane.

B158DRAFT_0995 adhesin-associated sorting protein (DUF1329) from Kangiella aquimarina DSM 16071
Aligns to 89:455 / 460 (79.8%), covers 100.0% of PF07044, 523.6 bits

• mutant phenotype: Conserved cofit with a putative adhesin (B158DRAFT_0994). DUF1329 is distantly related to lolB, which inserts lipoproteins into the outer membrane. So we predict that DUF1329 is involved in sorting the adhesin to the outer membrane.

Q9HYI4 DUF1329 domain-containing protein from Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
PA3421 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 84:451 / 456 (80.7%), covers 100.0% of PF07044, 522.3 bits

• A Shaving Proteomic Approach to Unveil Surface Proteins Modulation of Multi-Drug Resistant Pseudomonas aeruginosa Strains Isolated From Cystic Fibrosis Patients
  Montemari, Frontiers in medicine 2022
  • “...PA4066 Uncharacterized protein 100 100 Q9HXL0 PA3785 Uncharacterized protein 21.783 Q9HYE2 PA3464 Uncharacterized protein 100 Q9HYI4 PA3421 Uncharacterized protein 100 Q9HYJ1 PA3414 Uncharacterized protein 100 Q9HYJ2 PA3413 Uncharacterized protein 0.01 Q9HYZ0 PA3250 Uncharacterized protein 0.01 0.01 Q9HZ16 PA3224 Uncharacterized protein 100 Q9HZ56 PA3178 Uncharacterized protein 0.01...”
• A Shaving Proteomic Approach to Unveil Surface Proteins Modulation of Multi-Drug Resistant Pseudomonas aeruginosa Strains Isolated From Cystic Fibrosis Patients
  Montemari, Frontiers in medicine 2022
  • “...Uncharacterized protein 100 100 Q9HXL0 PA3785 Uncharacterized protein 21.783 Q9HYE2 PA3464 Uncharacterized protein 100 Q9HYI4 PA3421 Uncharacterized protein 100 Q9HYJ1 PA3414 Uncharacterized protein 100 Q9HYJ2 PA3413 Uncharacterized protein 0.01 Q9HYZ0 PA3250 Uncharacterized protein 0.01 0.01 Q9HZ16 PA3224 Uncharacterized protein 100 Q9HZ56 PA3178 Uncharacterized protein 0.01 Q9HZD2...”
• Identification of QuiP, the product of gene PA1032, as the second acyl-homoserine lactone acylase of Pseudomonas aeruginosa PAO1
  Huang, Applied and environmental microbiology 2006
  • “...P. aeruginosa genome, PA3922 is a close homolog of PA3421 (sharing 69% amino acid identity), and the flanking genes in their respective gene clusters are quite...”

Psest_1123 adhesin-associated sorting protein (DUF1329) from Pseudomonas stutzeri RCH2
Aligns to 82:448 / 453 (81.0%), covers 100.0% of PF07044, 513.0 bits

• mutant phenotype: Conserved cofit with a putative adhesin (Psest_1122). DUF1329 is distantly related to lolB, which inserts lipoproteins into the outer membrane. So we predict that DUF1329 is involved in sorting the adhesin to the outer membrane.

PA0383 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 81:444 / 448 (81.2%), covers 99.7% of PF07044, 484.1 bits

• Genetic circularity of the Pseudomonas aeruginosa PAO chromosome
  Royle, Journal of bacteriology 1981
  • “...collection pur derivative of PA01, MC aro-I derivative of PA0383, MC pyr derivative of PA0384, MC his+ transductant of PA0222 using E79 tv-I This paper This...”
  • “...aro-I pur-75 aro-1 pyrF69 pur-75 met-28 trp-6 lys-12pro-82 ilv-226 PA0383 PA0384 (8) (8) his derivative of PAO131 pro or source propagated on PA01 derivative of...”

ebA1932 hypothetical protein from Azoarcus sp. EbN1
ebA1932 DUF1329 domain-containing protein from Aromatoleum aromaticum EbN1
Aligns to 84:449 / 454 (80.6%), covers 99.5% of PF07044, 429.0 bits

• Anaerobic catabolism of aromatic compounds: a genetic and genomic view
  Carmona, Microbiology and molecular biology reviews : MMBR 2009
  • “...ebA1936) organized in an operon-like structure, two of which (ebA1932 and ebA1936) encode proteins that are highly induced when the cells were grown in toluene...”
  • “...in coping with toxic toluene concentrations (203, 379). Interestingly, ebA1932 and ebA1936 are highly similar to the products of orf1 and orf2 from T. aromatica...”
• Substrate-dependent regulation of anaerobic degradation pathways for toluene and ethylbenzene in a denitrifying bacterium, strain EbN1
  Kühner, Journal of bacteriology 2005
  • “...ebd operon, are implicated in ethylbenzene degradation, and the ebA1932 and ebA1936 genes, located 7.2 kb upstream of the bbs operon, are implicated in toluene...”
  • “...the accession numbers CR792447 (ebA1926, ebA1928, ebA1929, ebA1932, ebA1936, tnpF, and ebA1938), CR792444 (bcrC), CR792558 (mdh), and CR792561 (ssb). J....”

DBX28_14760 DUF1329 domain-containing protein from Pseudomonas aeruginosa
Aligns to 97:469 / 474 (78.7%), covers 100.0% of PF07044, 406.2 bits

• Integrated Comparative Genomic Analysis and Phenotypic Profiling of Pseudomonas aeruginosa Isolates From Crude Oil
  Xu, Frontiers in microbiology 2020
  • “...DBX28_14750 3138492 3140894 CDS RND transporter + DBX28_14755 3140903 3142489 CDS DUF1302 domain-containing protein + DBX28_14760 3142573 3143997 CDS DUF1329 domain-containing protein + DBX28AM_2960 3144149 3144388 CDS protein of unknown function 2SD + + DBX28_14765 3144552 3145199 CDS hypothetical protein 2SD + + DBX28_14770 3145310 3146677...”

PP2810 conserved hypothetical protein from Pseudomonas putida KT2440
PP_2810 DUF1329 domain-containing protein from Pseudomonas putida KT2440
Aligns to 96:468 / 473 (78.9%), covers 99.7% of PF07044, 401.7 bits

• The Regulatory Hierarchy Following Signal Integration by the CbrAB Two-Component System: Diversity of Responses and Functions
  Monteagudo-Cascales, Genes 2022
  • “...putative CbrA sensor domains (SLC5 and PAS domain) and analyzed kinase activity indirectly through measuring PP2810 transcript levels, a CbrB target that, unlike crcZ and crcY , is very sensitive to activity changes in the Cbr system [ 63 ]. The study showed that overexpression of...”
  • “...a mutant containing an in-frame deletion of the PAS domain was unable to activate the PP2810 target at any differential protein levels in any condition, suggesting that it is involved in the perception of an activating signal of the CbrAB system. To validate this hypothesis, further...”
• Unraveling the role of the CbrA histidine kinase in the signal transduction of the CbrAB two-component system in Pseudomonas putida
  Monteagudo-Cascales, Scientific reports 2019
  • “...intensity of a gfp-lacZ transcriptional fusions to the promoter regions of crcZ , crcY and PP2810 (plasmids pMPO356, pMPO357 and pMPO355, respectively). PP2810 is the third characterised CbrB direct target and codes for an efflux pump. It is included in this characterisation since it shows the...”
  • “...23 . Figure 4 shows the differential induction of the targets crcZ , crcY and PP2810 in LB, and in a minimal medium containing succinate, glucose, histidine, citrate or oxaloacetate as carbon sources. In the wild type strain (MPO451), the three targets showed the same pattern...”
• The CbrB Regulon: Promoter dissection reveals novel insights into the CbrAB expression network in Pseudomonas putida
  Barroso, PloS one 2018
  • “...2858405 2856721 2858305 24 PP2541 transcriptional factor-like protein 3.38 Regulatory 2885949 2887273 2886048 2887173 25 PP2810 hypothetical protein 2.98 hypothetical 3202675 3203315 3202705 3203215 26 PP2858 hypothetical protein 2.75 hypothetical 3261156 3261619 3261202 3261519 27 PP3009 hypothetical protein 2.61 hypothetical 3401602 3401909 3401381 3403370 28 PP3012...”
  • “...expression of 12 targets including crcZ was analysed by quantitative RT-PCR (or -galactosidase activity for PP2810) in a wild type and cbrB backgrounds in a medium containing oxaloacetate as carbon source ( Table 2 ). These targets were PP0952 encoding the sigma factor RpoN, PP1206 encoding...”
• Transport and kinase activities of CbrA of Pseudomonas putida KT2440
  Wirtz, Scientific reports 2020
  • “...deletion of the transmembrane domains of CbrA reduces the expression of the CbrA/CbrB target gene PP_2810, and that the phenotype is reversed by overexpression of the soluble histidine kinase domain 14 . Taken together, all these observations suggest that although physical interactions between the SLC5 domain...”

DelCs14_1757 DUF1329 domain-containing protein from Delftia sp. Cs1-4
Aligns to 84:448 / 453 (80.6%), covers 99.7% of PF07044, 396.6 bits

• Nanopods: a new bacterial structure and mechanism for deployment of outer membrane vesicles
  Shetty, PloS one 2011
  • “...TPR repeat-containing protein DelCs14_3801 Conserved hypothetical protein DelCs14_4061 Unknown function (DUF1302) DelCs14_1756 Unknown function (DUF1329) DelCs14_1757 1 Identified in three independent samples. 2 Numbering in Delftia sp. Cs1-4 genome. 3 Nanopod protein A, see text. The forgoing provided strong evidence supporting our hypothesis, inferred from electron...”

AzCIB_4527 DUF1329 domain-containing protein from Azoarcus sp. CIB
Aligns to 52:434 / 437 (87.6%), covers 100.0% of PF07044, 236.2 bits

• Transcriptional Regulation of the Peripheral Pathway for the Anaerobic Catabolism of Toluene and m-Xylene in Azoarcus sp. CIB
  Blázquez, Frontiers in microbiology 2018
  • “...rectangles. The white rectangle next to the bbs operon in Azoarcus sp. CIB represents orfB (AzCIB_4527), orfC (AzCIB_4528), orfD (AzCIB_4529) and orfE (AzCIB_4530) genes, that are also present in A. toluclasticus MF63. In the bss-bbs cluster of Azoarcus sp. CIB, the DNA fragment harboring the bssDCABEFG...”
  • “...translational fusion, a 356-bp Xba I/ Pst I DNA fragment containing the bbsA (AzCIB_4526) -orfB (AzCIB_4527) intergenic region was PCR-amplified from Azoarcus sp. CIB chromosomal DNA by using oligonucleotides 5PbbsA and 3PbbsA (5-AA CTGCAG GACATGACGCCTCCGCAGCATTTG-3 (Supplementary Table S1 ), and then cloned into the XbaI/PstI double-digested...”

WP_049338638 DUF1329 domain-containing protein from Stutzerimonas stutzeri
Aligns to 1:151 / 156 (96.8%), covers 41.4% of PF07044, 213.1 bits

• Phylogenomics studies and molecular markers reliably demarcate genus Pseudomonas sensu stricto and twelve other Pseudomonadaceae species clades representing novel and emended genera
  Rudra, Frontiers in microbiology 2023
  • “...Supplementary Figure S32 1 aa Ins 83127 Stutzeri clade (Genus Stutzerimonas ) DUF1329 domain-containing protein WP_049338638 Supplementary Figure S33 1 aa Del 115121 Autotransporter assembly complex protein TamA $ WP_084904442 Supplementary Figure S34 1 aa Del 112147 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase # WP_014818653 Supplementary Figure S35 1 aa...”

PG1179 conserved hypothetical protein from Porphyromonas gingivalis W83
HMPREF1322_RS06010 outer membrane lipoprotein-sorting protein from Porphyromonas gingivalis W50
2 alignments in 3:259 / 263 (97.7%), covering up to 34.1% of PF07044, 62.0 bits

• Iron Deficiency Modulates Metabolic Landscape of Bacteroidetes Promoting Its Resilience during Inflammation
  Lewis, Microbiology spectrum 2023
  • “...ABC transporter is followed by a gene coding for an outer membrane lipoprotein sorting protein (PG1179) and hypothetical protein (PG1178). An interesting finding was the PG1177 coding for a transposase followed by PG1176 to PG1175 encoding orthologs of BT0508 to BT0509 ( Fig.1D , ii). A...”
• The Porphyromonas gingivalis Hybrid Cluster Protein Hcp Is Required for Growth with Nitrite and Survival with Host Cells
  Belvin, Infection and immunity 2019
  • “...PG1555 PG1570 PG0283 PG1489 PG0285 thiE PG0915 PG0524 cas2-1 PG1179 PG0870 PG0682 thiG PG1554 PG0280 PG1975 PG1904 PG1180 PG1984 PG1655 a aFld, bP fold change...”
• A putative TetR regulator is involved in nitric oxide stress resistance in Porphyromonas gingivalis
  Boutrin, Molecular oral microbiology 2016
  • “...section above. Purified cDNA samples were subsequently subjected to PCR using primers for PG1181, PG1180, PG1179 , and PG1178 ( Supplementary material ), and gel electrophoresis used for analysis of transcripts. Determination of co-transcription for the PG0214-18 locus RNA extraction and cDNA synthesis were carried out...”
  • “...these genes under normal and NO stress conditions was therefore investigated. PG1181 , PG1180 , PG1179 , PG1178 and PG1178-81 were not expressed under normal conditions, but only under NO stress. Also, a full transcript was obtained for PG1178-81 , but only under NO stress. Thus,...”
• Involvement of PG2212 zinc finger protein in the regulation of oxidative stress resistance in Porphyromonas gingivalis W83
  Dou, Journal of bacteriology 2014
  • “...PG1108 Hypothetical protein PG1178 Hypothetical protein PG1179 Hypothetical protein PG1180 Tetr family transcriptional regulator Hypothetical protein PG1236...”
• Nitric oxide stress resistance in Porphyromonas gingivalis is mediated by a putative hydroxylamine reductase
  Boutrin, Journal of bacteriology 2012
  • “...transcriptional unit that includes PG1775, PG1176, PG1177, PG1178, PG1179, and PG1180, all of which were upregulated except PG1177 when P. gingivalis was...”
• Hemin availability induces coordinated DNA methylation and gene expression changes in Porphyromonas gingivalis
  Costeira, mSystems 2023
  • “...P -value Gene symbol Gene product HMPREF1322_RS06000 19,212.04 7.71 0.27 1.21E-184 TetR/AcrR family transcriptional regulator HMPREF1322_RS06010 7,387.12 8.06 0.28 5.34E-183 Outer membrane lipoprotein-sorting protein HMPREF1322_RS06015 24,454.31 7.46 0.28 2.46E-160 Hypothetical protein HMPREF1322_RS06005 47,425.12 7.36 0.30 1.87E-133 MMPL family transporter HMPREF1322_RS05430 7,754.25 5.44 0.23 7.95E-121 Flavodoxin HMPREF1322_RS06790...”
• Hemin availability induces coordinated DNA methylation and gene expression changes in Porphyromonas gingivalis
  Costeira, 2022

TDE2009 conserved hypothetical protein from Treponema denticola ATCC 35405
Aligns to 11:157 / 261 (56.3%), covers 43.1% of PF07044, 56.0 bits

• Transcriptional responses of Treponema denticola to other oral bacterial species
  Sarkar, PloS one 2014
  • “...TDE1072 GATGATGAACTTGCAATGGGCGGT GCAAAGGCAAAGGCATACCTGACA TDE1238 AAGCAATTCGGCCTTCGGCTCAAA CAGTCGGTTGACGTTTCGGTTTGT TDE1408 TGGGCTTATCAGGCTGTTGGAAGT TGGTGGGAACAACATCTACCCAGT TDE1548 TGTATCGGGCGGAGGTCTTGTAAA TGAGCAGCCCTGACTAAATCCTGA TDE1722 CAAGGAGAGGTAACCATCCAGTTA TCTCCGGCTTCTGCTGTAATTCT TDE2009 GCTAAGCGCATAAGCGGTTCATCA GTTTATAATCGTCCACCTTGCGGC 16 s rRNA TAATACCGAATGTGCTCATTTACAT CTGCCATATCTCTATGTCATTGCTCTT Results A comprehensive microarray analysis of interactions between T. denticola and representative members of selected oral complexes is summarized below. Initial analyses revealed...”
  • “...several ORFs encoding cellular functions (TDE0163, TDE2399/2400), membrane associated functions (TDE2006-08), and hypothetical proteins (TDE0164, TDE2009 and TDE2398) as well as repression of some cellular processes (TDE0431, TDE1593/94 and TDE2410) and one hypothetical protein TDE2093. 10.1371/journal.pone.0088361.t008 Table 8 Response in T. denticola members of the Orange...”

VP1287 hyopothetical protein from Vibrio parahaemolyticus RIMD 2210633
Aligns to 149:260 / 263 (42.6%), covers 23.4% of PF07044, 48.3 bits

• Bacteriostatic effects of benzyl isothiocyanate on Vibrio parahaemolyticus: Transcriptomic analysis and morphological verification
  Liu, BMC biotechnology 2021
  • “...0.7717 0.94068 UP VP1980 Hypothetical protein 0.77034 0.34407 DOWN VPA1613 Hypothetical protein 0.7494 1.35230 DOWN VP1287 Hypothetical protein 0.7427 1.93820 UP Other genes VP2826 Transporter 0.81597 0.21954 DOWN VPA1006 LysR family transcriptional regulator 0.75038 0.97802 DOWN VP0653 dnaK Molecular chaperone DnaK 0.80187 0.02678 UP Besides, rpsU-encoded...”

3bk5A / Q87Q63 Crystal structure of putative outer membrane lipoprotein-sorting protein domain from vibrio parahaemolyticus
Aligns to 119:234 / 235 (49.4%), covers 23.4% of PF07044, 48.3 bits

• Ligand: magnesium ion (3bk5A)

TOL_3187 outer membrane lipoprotein-sorting protein from Thalassolituus oleivorans MIL-1
Aligns to 830:955 / 1064 (11.8%), covers 23.7% of PF07044, 31.4 bits

• Differential Protein Expression During Growth on Medium Versus Long-Chain Alkanes in the Obligate Marine Hydrocarbon-Degrading Bacterium Thalassolituus oleivorans MIL-1
  Gregson, Frontiers in microbiology 2018
  • “...long-chain alkanes and may be transported to the outer membrane by the inner-membrane transport protein TOL_3187. The expression of a long-chain fatty acid transport protein (TOL_1625; P < 0.0001) increased ninefold in the presence of n- C 28 when compared to n- C 14 with no...”
  • “...n -C 28 into the periplasm (Figure 4B ). The expression of an uncharacterized protein (TOL_3187; P < 0.0001) increased 42-fold in the presence of n- C 28 when compared to n- C 14 and Tween 80 (Figure 4A ). Domain analysis showed two mycobacterial membrane...”

Or search for genetic data about PF07044 in the Fitness Browser