Family Search for PF07256 (DUF1435)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

PF07256 hits 9 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

YjjZ / b4567 DUF1435 domain-containing protein YjjZ from Escherichia coli K-12 substr. MG1655 (see 3 papers)
P55914 Uncharacterized protein YjjZ from Escherichia coli (strain K12)
b4567 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 1:75 / 78 (96.2%), covers 100.0% of PF07256, 126.4 bits

• Identification of genes induced in vivo during Klebsiella pneumoniae CG43 infection
  Lai, Infection and immunity 2001
  • “...yjjB (P18389) E. coli ydgH (P76177) E. coli yjjZ (P55914) E. coli yhgI (P46846) E. coli yfjB (P37768) E. coli yfaE (P37910) E. coli yjcC (P32701) KPN_CONTIG...”
• Characterization of Bacterial Transcriptional Regulatory Networks in Escherichia coli through Genome-Wide In Vitro Run-Off Transcription/RNA-seq (ROSE)
  Schmidt, Microorganisms 2023
  • “...both genes were also described by Thomason et al. and RegulonDB. The TSS of yjjZ (b4567) has already been described for genomic position 4,605,777 in the E. coli MG1655 genome. According to EcoCyc , there are two ferric uptake regulator (Fur) binding sites in the vicinity...”
• Ferric Citrate Uptake Is a Virulence Factor in Uropathogenic Escherichia coli
  Frick-Cheng, mBio 2022
  • “...Putative DNA-binding transcriptional regulator 4.6 b1477 ydiE Uncharacterized protein 4.2 b1705 yjjZ Uncharacterized protein 7.3 b4567 yncE PQQ-like domain-containing protein 5.0 b1452 yohC Putative inner membrane protein 3.7 b2135 a FC, fold change. 10.1128/mbio.01035-22.10 TABLES2 All genes significantly (adjusted P value of <0.05) differentially regulated (log...”
• Genomic SELEX for Hfq-binding RNAs identifies genomic aptamers predominantly in antisense transcripts
  Lorenz, Nucleic acids research 2010
  • “...Antisense Predicted multidrug efflux system 1518 77 4 604 053 4 604 123 yjjZ; leuV b4567; b4368 Antisense; sense Predicted protein; tRNALeu 405 64 2 581 119 2 581 278 nudK b2467 Antisense Predicted NUDIX hydrolase 1208 58 2 662 835 2 662 948 yfhR b2534...”

DR76_RS12845, E2348C_4667 DUF1435 domain-containing protein from Escherichia coli O127:H6 str. E2348/69
Aligns to 1:75 / 78 (96.2%), covers 100.0% of PF07256, 125.5 bits

• Epidemiology of E. coli in Cystic Fibrosis Airways Demonstrates the Capacity for Persistent Infection but Not Patient-Patient Transmission
  Izydorczyk, Frontiers in microbiology 2020
  • “...Ferric aerobactin receptor IutA 73 DR76_RS25915 2 IS3 family transposase 73 DR76_RS12840 2 Intergenic region DR76_RS12845 73 DR76_RS12860 2 Intergenic region DR76_RS12870 73 DR76_RS12910 2 Intergenic region DR76_RS12915 73 DR76_RS14760 2 Yersiniabactin polyketide synthase HMWP1 73 DR76_RS17040 2 Hypothetical protein 73 DR76_RS28490 4 Hypothetical protein 73...”
• Microarray analysis of the Ler regulon in enteropathogenic and enterohaemorrhagic Escherichia coli strains
  Bingle, PloS one 2014
  • “...putative hemin permease E2348C_3749 6 hmuV hemin importer ATP-binding subunit E2348C_3751 2 hdeB acid-resistance protein E2348C_4667 3 yjjZ hypothetical protein pMAR2_003 2 bfpA major pilin structural unit bundlin pMAR2 pMAR2_004 2 bfpG lipoprotein pMAR2 pMAR2_006 2 bfpC predicted protein pMAR2 pMAR2_007 2 bfpU periplasmic protein pMAR2...”

SF5M90T_4307 DUF1435 domain-containing protein from Shigella flexneri 5a str. M90T
Aligns to 1:75 / 78 (96.2%), covers 100.0% of PF07256, 125.3 bits

• RNA-seq analysis of the influence of anaerobiosis and FNR on Shigella flexneri
  Vergara-Irigaray, BMC genomics 2014
  • “...protein remnant -2.64 SF5M90T_2146 yohO membrane protein -2.96 SF5M90T_1952 putative outer membrane pore protein -2.98 SF5M90T_4307 putative inner membrane protein -3.40 SF1231 conserved hypothetical protein -3.71 -1.60 SF5M90T_427 ybaA conserved hypothetical protein -3.88 Phage related S1668 relF prophage maintenance protein 1.75 SF5M90T_1793 putative phage integrase protein...”

STM4552 putative inner membrane protein from Salmonella typhimurium LT2
SL1344_4483, STM14_5469 DUF1435 domain-containing protein from Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344
Aligns to 1:75 / 78 (96.2%), covers 100.0% of PF07256, 124.6 bits

• Stress response, amino acid biosynthesis and pathogenesis genes expressed in Salmonella enterica colonizing tomato shoot and root surfaces
  Han, Heliyon 2020
  • “...protein 2.2 0.002 2.0 0.003 STM4271 STM4271 murein hydrolase regulator LrgA 1.4 0.006 2.2 0.003 STM4552 STM4552 putative inner membrane protein 2.3 0.002 STM1528 STM1528 putative outer membrane protein; calcium/calmodulin dependent protein kinase ii association 1.9 0.003 STM3030 STM3030 YfdX protein 5.7 0.008 STM04875 STM04875 hypothetical...”
• Evolution of Variable Number Tandem Repeats and Its Relationship with Genomic Diversity in Salmonella Typhimurium
  Fu, Frontiers in microbiology 2016
  • “...L2187 hemX STM3936 Uroporphyrinogen III C-methyltransferase M I L2185 pfkA STM4062 6-phosphofructokinase S R L2168 STM4552 Inner membrane protein P L A phylogenetic tree was inferred from the SNPs (Figure 3B ). Some isolates were indistinguishable by SNP-based typing but were differentiated by MLVA, and vice...”
• Cassette-like variation of restriction enzyme genes in Escherichia coli C and relatives
  Sibley, Nucleic acids research 2004
  • “...are found adjacent to the border (Z5943, yjiT, STM4552 and penicillin acylase), but deletion and homologous recombination have obscured relationships, and two...”
• Investigating howSalmonellacolonise alfalfa using a whole genome screen
  Holden, 2023
• Intracellular niche-specific profiling reveals transcriptional adaptations required for the cytosolic lifestyle of Salmonella enterica
  Powers, PLoS pathogens 2021
  • “...sitABCD operon), SL1802 , SL3990 ( SL3990 - SL3989 operon), sufA ( sufABCDSE operon), yjjZ (SL1344_4483), STnc3080 and STnc3250 (Figs 3 and S3 ). Up-regulation of STnc4000, ilvC and SL1344_2715 was not observed by fluorescence microscopy ( S4 Fig ). Quantification using ImageJ software of the...”
  • “...of S . Typhimurium in the cytosol. While the function of YjjZ remains unknown, yjjZ (SL1344_4483) is part of the Fur regulon in S . Typhimurium [ 112 ] and UPEC [ 113 ]; Fur is the master regulator of iron homeostasis in bacteria [ 114...”
• Proteome remodelling by the stress sigma factor RpoS/σ^S in Salmonella: identification of small proteins and evidence for post-transcriptional regulation
  Lago, Scientific reports 2017
  • “...7, 1114 Bacteria, Archaea and Eukaryota STM14_5292 DUF1107 IPR009491 68 ytfK 7, 1214 - Proteobacteria STM14_5469 65% identity with E . coli YjjZ, 3TM fragments, DUF1435 IPR009885 78 yjjZ 13, 14 Enterobacteriaceae STM14_5479 Not translated under the conditions used 44 Salmonella STM14_5481 Start codon re-annotated, 98%...”
  • “...the uncharacterized small ORFs, for which no protein was identified by LC-MS (STM14_2173, STM14_2189, STM14_5292, STM14_5469, STM14_5479, STM14_5481), was assessed by immunodetection of the corresponding 3xFlag-tagged proteins. Proteins were detected for all of them, except STM14_5469 and STM14_5479 (Fig. 1b ). In the case of STM14_5469,...”

SEN4317 hypothetical protein from Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Aligns to 1:75 / 78 (96.2%), covers 100.0% of PF07256, 124.0 bits

• A DIVA vaccine strain lacking RpoS and the secondary messenger c-di-GMP for protection against salmonellosis in pigs
  Gil, Veterinary research 2020
  • “...plate by PCR, exploiting the chromosomal differences between the two strains. Oligonucleotides sen4315 (cacgattacgccaactcgagttgt) and sen4317 (gtaagataactgtgcgaag) were used in order to amplify a 632bp fragment exclusively from XIII DNA. Amplification of invA with oligonucleotides invA-fw (ggcgatattggtgtttatgg) and invA-rv (catattatcgctatcgccat) was used to amplify a 658bp...”
• Evaluation of a Salmonella Strain Lacking the Secondary Messenger C-di-GMP and RpoS as a Live Oral Vaccine
  Latasa, PloS one 2016
  • “...sequence upstream sen4316 ( Fig 6B ). Oligonucleotide DIVA-2 hybridizes to a DNA sequence downstream sen4317 ( Fig 6B ). PCR conditions were designed in such a way that amplification only took place if the XIII genome acted as template DNA. On the other hand, amplification...”

c5447 Hypothetical protein from Escherichia coli CFT073
Aligns to 38:112 / 115 (65.2%), covers 100.0% of PF07256, 124.0 bits

• Influence of Glucose Availability and CRP Acetylation on the Genome-Wide Transcriptional Response of Escherichia coli: Assessment by an Optimized Factorial Microarray Analysis
  Guebel, Frontiers in microbiology 2018
  • “...genes are the following: c2666, yjfN , c1304, prpB , c1608, ycfQ, bsmA / yjfO, c5447, mocA / ygfJ, ydcS . There, the gene ydcS codifies a protein with activity of polyhydroxybutyrate (PHB) synthase, the bsmA / ycfO gene is related to peroxide resistance, biofilm stress,...”

STY4905 conserved hypothetical protein from Salmonella enterica subsp. enterica serovar Typhi str. CT18
Aligns to 1:75 / 78 (96.2%), covers 100.0% of PF07256, 121.1 bits

• Transcriptomic study of Salmonella enterica subspecies enterica serovar Typhi biofilm
  Chin, BMC genomics 2017
  • “...subunit protein S18 3.25938 2.00E-04 0.00568281 rpsS 50S ribosomal subunit protein L22 2.93416 5.00E-05 0.00183687 STY4905 Hypothetical protein 2.8976 5.00E-05 0.00183687 rplU 50S ribosomal subunit protein L21 2.76352 5.00E-05 0.00183687 rpmA 50S ribosomal subunit protein L27 2.74781 5.00E-05 0.00183687 rpsJ 50S ribosomal subunit protein L3 2.65265...”
  • “...genes. The down-regulated genes include 9 hypothetical proteins. NCBI BLAST analysis showed that the gene STY4905 was similar to gene DUF1435 , a putative membrane protein in Salmonella enterica subsp. enterica serovar Senftenberg. Gene STY1229 was found to code for a protein which was closely related...”

YPO0426 putative membrane protein from Yersinia pestis CO92
Aligns to 1:75 / 79 (94.9%), covers 100.0% of PF07256, 117.5 bits

• New insights into how Yersinia pestis adapts to its mammalian host during bubonic plague
  Pradel, PLoS pathogens 2014
  • “...the homoserine O-succinyltransferase gene metA , the ribonucleoside reductase operon nrdHIEF or the uncharacterized gene ypo0426 required significantly more time to cause fatal plague (median survival 5 days vs 4 days for the mutants and the wild-type strain respectively). The ypo0988 , ptsG and znuABC ypo2062...”
  • “...complement), and the ibpA , ypo3369 , ypo0988 , amn , ypo0617-0618 , ypo2586-2587 and ypo0426 mutants had significant a growth defect (either because they confer a metabolic advantage or effective complement tolerance). 10.1371/journal.ppat.1004029.g006 Figure 6 Stress, metabolic and uncharacterized genes are needed for resistance and/or...”

KPNJ2_04728 DUF1435 domain-containing protein from Klebsiella pneumoniae 30684/NJST258_2
Aligns to 1:75 / 79 (94.9%), covers 97.3% of PF07256, 109.7 bits

• Iron Acquisition and Siderophore Release by Carbapenem-Resistant Sequence Type 258 Klebsiella pneumoniae
  Holden, mSphere 2018
  • “...34.4 28.7 17.3 29.3 97.7 28.8 48.8 220.6 22.7 35.5 240.5 26.1 41.6 2.0 1.51E06 KPNJ2_04728 Hypothetical protein 9.9 69.5 236.0 26.0 81.5 525.5 39.2 260.2 952.2 49.2 272.0 533.2 355.9 681.9 847.1 2.1 9.28E14 KPNJ2_05307 Zinc-cadmium-binding protein 97.2 25.0 17.4 25.0 18.4 15.5 40.3 26.9...”

Or search for genetic data about PF07256 in the Fitness Browser