Family Search for PF07338 (DUF1471)
PF07338.13 hits 58 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
YP_2090 putative exported protein (NCBI) from Yersinia pestis biovar Medievalis str. 91001
YPO2305 putative exported protein (NCBI ptt file) from Yersinia pestis CO92
y2136 hypothetical protein (NCBI ptt file) from Yersinia pestis KIM
YPTB2227 putative exported protein (NCBI) from Yersinia pseudotuberculosis IP 32953
3 alignments in 35:317 / 317 (53.9%), covering up to 100.0% of PF07338, 215.4 bits
- Reannotation of Yersinia pestis Strain 91001 Based on Omics Data
Mao, The American journal of tropical medicine and hygiene 2016 - “...transhydrogenase subunit alpha YP_2089, hypothetical protein YP_2090, hypothetical protein YP_2091, amino acid antiporter YP_2092, hypothetical protein YP_2093,...”
- Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Rosso, BMC microbiology 2008 - “...lipoprotein B precursoR 2.229 (< 0.001) 1.413 (0.032) YPTB2219 YPO2297 hypothetical protein 1.576 (0.031) YPTB2227 YPO2305 putative exported protein 1.37 (0.015) 0.774 (0.042) YPTB2229 YPO2307 conserved hypothetical protein 0.708 (0.026) YPTB2237 (asr) YPO2318 putative acid shock protein 0.654 (0.022) YPTB2269 (pspB) YPO2350 phage shock protein B...”
- Genetic loci of major antigenic protein genes of Edwardsiella tarda
Verjan, Applied and environmental microbiology 2005 - “...binding protein (MalE) Putative exported protein (YPO2305) D-Methionine Putative periplasmic lipoprotein (YraP) Primer sequencesa (F) 5ATACCCTGTTTCCTCACCAG3 (R)...”
- “...sequences had identities to Yersinia pestis putative exported protein YPO2305 and the glycosylase YraM (Table 2) (6, 30). The genetic location of the Et 32 gene...”
- Identification of Erwinia amylovora genes induced during infection of immature pear tissue
Zhao, Journal of bacteriology 2005 - “...Salmonella enterica 56 57 corB* ytfK* 58 59 YPO2305 tolA 60 tolR Salmonella enterica Salmonella enterica serovar Typhimurium Yersinia pestis Salmonella enterica...”
- Role of the PhoP-PhoQ gene regulatory system in adaptation of Yersinia pestis to environmental stress in the flea digestive tract
Vadyvaloo, Microbiology (Reading, England) 2015 - “...Y. pestis KIM6+ genome contained five YhcN protein family genes (y1667, y0666, y0640, y3909 and y2136) that encoded predicted proteins of 86, 87, 53, 92 and 317 amino acids, respectively. In E. coli , four of the 10 YhcN family proteins were shown to influence biofilm...”
- Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Rosso, BMC microbiology 2008 - “...inducible lipoprotein B precursoR 2.229 (< 0.001) 1.413 (0.032) YPTB2219 YPO2297 hypothetical protein 1.576 (0.031) YPTB2227 YPO2305 putative exported protein 1.37 (0.015) 0.774 (0.042) YPTB2229 YPO2307 conserved hypothetical protein 0.708 (0.026) YPTB2237 (asr) YPO2318 putative acid shock protein 0.654 (0.022) YPTB2269 (pspB) YPO2350 phage shock protein...”
YPK_1940 hypothetical protein (RefSeq) from Yersinia pseudotuberculosis YPIII
3 alignments in 35:317 / 317 (53.9%), covering up to 100.0% of PF07338, 215.4 bits
- Genome-Scale Mapping Reveals Complex Regulatory Activities of RpoN in Yersinia pseudotuberculosis
Mahmud, mSystems 2020 - “...TTGGCACGACTCTTGATT + 11.44 70,54 YPK_1894 E,S,V 37 IGS11 2153679 4.7 5.4 NA CTGGTGCAGATTTTGCAG 9.6 70,24,54 YPK_1940 4, 14 IGS12 2194598 16.6 16.8 13.8 TTGGCACGATAACTGCTT 10.96 38,70,54 YPK_1974 14, 43 IGS12 2194598 16.6 16.8 13.8 AGGGGTTAATATTTGCGT + 9.34 54,70,38 YPK_1975 61, 141 IGS13 2298808 7.2 3.5 5.2...”
SSON_1556 hypothetical protein (NCBI) from Shigella sonnei Ss046
3 alignments in 34:314 / 314 (54.1%), covering up to 100.0% of PF07338, 202.7 bits
- High yield production process for Shigella outer membrane particles
Berlanda, PloS one 2012 - “...gi|74312061 Unknown 57 3 putative receptor [S. sonnei Ss046] SSON_1681 gi|74312191 58 2 hypothetical protein SSON_1556 [S. sonnei Ss046] ydgH gi|74312071 59 2 hypothetical protein SSON_3340 [S.sonnei Ss046] yrbC gi|74313729 60 2 putative lipoprotein [Shigella dysenteriae Sd197] ybjP gi|82777619 61 1 hypothetical protein S3269 [S. flexneri...”
YdgH / b1604 DUF1471 domain-containing protein YdgH from Escherichia coli K-12 substr. MG1655
P76177 Protein YdgH from Escherichia coli (strain K12)
b1604 hypothetical protein (NCBI) from Escherichia coli str. K-12 substr. MG1655
3 alignments in 34:314 / 314 (54.1%), covering up to 100.0% of PF07338, 202.7 bits
- The Escherichia coli proteome: past, present, and future prospects
Han, Microbiology and molecular biology reviews : MMBR 2006 - “...YdiJ YdiY YdjA YeaD YeaZ P77318 P77804 P76177 P0AC69 P77552 P0ACX3 P0A8A4 P77748 P76206 P0ACY1 P39173 P76256 5.38/59,928.8 5.07/54,689 9.1/31,910.83...”
- Identification of genes induced in vivo during Klebsiella pneumoniae CG43 infection
Lai, Infection and immunity 2001 - “...AJ292302 AJ292314 E. coli yjjB (P18389) E. coli ydgH (P76177) E. coli yjjZ (P55914) E. coli yhgI (P46846) E. coli yfjB (P37768) E. coli yfaE (P37910) E....”
- 18th Congress of the European Hematology Association, Stockholm, Sweden, June 13–16, 2013
, Haematologica 2013 - Interfering with different steps of protein synthesis explored by transcriptional profiling of Escherichia coli K-12
Sabina, Journal of bacteriology 2003 - “...livJ nikE nuoL ycdY gadA gadB b1284 gapA hmpA yjfQ apbA b1604 hdeB ibpB livK uhpB yhaB yiaA b1045 serC yeaG ynfM b3254 mraY sucA udp b1057 b2252 b1973 b2220...”
- “...b2278 b1035 b3517 b1493 b1284 b1779 b2552 b4191 b0425 b1604 b3509 b3686 b3458 b3668 b3120 b3562 b1045 b0907 b1783 b1596 b3254 b0087 b0726 b3831 b1057 0.02 0.02...”
SF1625 orf, conserved hypothetical protein (NCBI ptt file) from Shigella flexneri 2a str. 301
3 alignments in 34:314 / 314 (54.1%), covering up to 100.0% of PF07338, 202.3 bits
- Virulence and Stress Responses of Shigella flexneri Regulated by PhoP/PhoQ
Lin, Frontiers in microbiology 2017 - “...ttggc TAAACG g Phosphoglycerol transferase I uspF Chromosome c GcTTTA ggtct GGTTTA t Stress-induced protein SF1625 Chromosome a GGaTTA aaatt GGTTTA a Hypothetical protein sbcD Chromosome a GaTTTA tgaca GaTTTA t Exonuclease SbcD icsA pCP301 t GGTTgA ggctt TGTTTA a Hypothetical protein yffB Chromosome t GaTTTA...”
c1996 Protein ydgH precursor (NCBI ptt file) from Escherichia coli CFT073
3 alignments in 34:314 / 314 (54.1%), covering up to 100.0% of PF07338, 201.5 bits
PMI1199 hypothetical protein (RefSeq) from Proteus mirabilis HI4320
3 alignments in 35:317 / 317 (53.6%), covering up to 100.0% of PF07338, 197.1 bits
STM1478 putative periplasmic protein (NCBI ptt file) from Salmonella typhimurium LT2
STM14_1785 DUF1471 domain-containing protein from Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
3 alignments in 34:314 / 314 (54.1%), covering up to 100.0% of PF07338, 196.4 bits
- The target spectrum of SdsR small RNA in Salmonella
Fröhlich, Nucleic acids research 2016 - “...STM0487.S 2,22 heat shock protein 90 (45 to +60 in htpG)::gfp FC yes no ydgH STM1478 2,18 putative periplasmic protein (58 to +60 in ydgH)::gfp WB yes no crp STM3466 2,16 cAMP-regulatory protein (172 to +30 in crp)::gfp FC yes no ( 16 , 17 )...”
- Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
Eletsky, PloS one 2014 - “...secretion [2] , though the host factors with which it interacts are not known. SssB (STM1478, also known as YdgH) is another Salmonella DUF1471 paralogue implicated in pathogenesis. Like SrfN, it appears to be secreted into macrophages by a mechanism independent of Type III secretion, and...”
- Discovery of novel secreted virulence factors from Salmonella enterica serovar Typhimurium by proteomic analysis of culture supernatants
Niemann, Infection and immunity 2011 - “...STM0359, STM1026 (GtgA), STM1055 (GtgE), STM1087 (PipA), STM1478 (YdgH), STM1599 (PdgL), STM1809, STM2139, STM2585, STM3762 (CigR), and STM4082 (YiiQ)....”
- Comparative proteomic analysis of Salmonella enterica serovar Typhimurium ppGpp-deficient mutant to identify a novel virulence protein required for intracellular survival in macrophages
Haneda, BMC microbiology 2010 - “...037 STM0209 htrA 0.6 0.032 0.60 0.35 040 STM2638 rseB 0.3 0.011 0.88 0.35 040-2 STM1478 ydgH 0.3 0.011 0.17 0.06 c 041 STM1375 ynhG 0.3 0.011 EC 056 STM1746 oppA 0.6 0.001 0.15 0.05 c 058 STM1746 oppA 0.5 0.006 0.15 0.05 c 059 STM1849...”
- Diverse secreted effectors are required for Salmonella persistence in a mouse infection model
Kidwai, PloS one 2013 - “...STM14_2265 pagK1 ATTCCAATGCAAGGTGCAACCAGC STM14_3167 pagK2 CAAAGTGCAATGAGAGTACTTGGC STM14_1501 pagC ACGCGCATTGTGGGTACAAGGGTA STM14_1497 pagD CGTATTGTTGTGGGAAGTCTCGTT STM14_0421 sssA GCTGGTATCATGATTCGCATGCTG STM14_1785 sssB GAAGTTTTTGTTCTTATGCTTGGT Each mutant strain was mixed in equal proportions with a wild-type reference strain and co-infected by IP injection into female 56 week old 129SvJ mice at 10 4...”
A6T8N5 Uncharacterized protein from Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
3 alignments in 34:316 / 316 (53.8%), covering up to 100.0% of PF07338, 194.0 bits
t1398 putative exported protein (NCBI ptt file) from Salmonella enterica subsp. enterica serovar Typhi Ty2
3 alignments in 34:314 / 314 (54.1%), covering up to 100.0% of PF07338, 193.7 bits
- Genetic diversity and risk factors for the transmission of antimicrobial resistance across human, animals and environmental compartments in East Africa: a review
Katale, Antimicrobial resistance and infection control 2020 - “...November 2011, MRSA cattle PCR, Multiplex PCR, PFGE SCC mec type V (21/23; 91.3%) t7753, t1398, t2112, t3992, t127 Uganda [ 78 ] July to August 2013 MRSA human PCR, WGS SCC mec A ST612 t690 Tanzania [ 66 ] Between December 2014 and September 2015...”
STM3362 putative periplasmic protein (NCBI ptt file) from Salmonella typhimurium LT2
Aligns to 35:88 / 88 (61.4%), covers 100.0% of PF07338, 81.2 bits
STM3361 putative outer membrane protein (NCBI ptt file) from Salmonella typhimurium LT2
t3276 conserved hypothetical protein (NCBI ptt file) from Salmonella enterica subsp. enterica serovar Typhi Ty2
Aligns to 34:87 / 87 (62.1%), covers 98.2% of PF07338, 79.6 bits
YhcN / b3238 DUF1471 domain-containing stress-induced protein YhcN from Escherichia coli K-12 substr. MG1655 (see 5 papers)
b3238 orf, hypothetical protein (VIMSS) from Escherichia coli str. K-12 substr. MG1655
P64614 Uncharacterized protein YhcN from Escherichia coli (strain K12)
Aligns to 34:87 / 87 (62.1%), covers 98.2% of PF07338, 79.0 bits
- Global transcriptomic responses of Escherichia coli K-12 to volatile organic compounds
Yung, Scientific reports 2016 - “...1.70 1.99 1.43 UPF0304 family protein; K09161 hypothetical protein Oxidative stress b dms nmp t b3238 yhcN 1.92 1.11 1.39 1.39 1.6 2.25 1.26 1.69 Cadmium and peroxide resistance protein Oxidative stress b chp cp dma dms nmp nms t b3495 uspA* 1.79 1.63 1.49 1.29...”
- Whole-Transcriptome Analysis of Verocytotoxigenic Escherichia coli O157:H7 (Sakai) Suggests Plant-Species-Specific Metabolic Responses on Exposure to Spinach and Lettuce Extracts
Crozier, Frontiers in microbiology 2016 - “...accounted for high levels of differential expression: e.g., in spinach leaf lysates two hypothetical genes (b3238, b1722) were ranked as #2 and 3 for level of induction, at 50-fold. Probes corresponding to Z5022 and ECs4474 were induced 270- to 300-fold in spinach root exudates, but repressed...”
- Transcriptomic analysis of carboxylic acid challenge in Escherichia coli: beyond membrane damage
Royce, PloS one 2014 - “...b1493 gadB 0.000 0.015 25.3 AR2 decarboxylase b3509 hdeB 0.000 0.004 21.1 AR1 chaperone protein b3238 yhcN 0.002 0.064 15.2 Acid response b3510 hdeA 0.000 0.000 13.7 AR1 chaperone protein b4439 micF 0.003 0.078 11.9 Antisense RNA regulator of OmpF porin b3512 gadE 0.004 0.115 10.1...”
- Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
King, Applied and environmental microbiology 2010 - “...b3585 b3755 b3179 b0380 b0631 b1445 b1848 b2141 b3238 b3346 b3536 b4537 Translation, ribosomal structure and biogenesis Poorly characterized or not present in...”
- The BaeSR two-component regulatory system mediates resistance to condensed tannins in Escherichia coli
Zoetendal, Applied and environmental microbiology 2008 - “...marB marR 2.6 2.6 21.5 27.4 b0005 b2390 b0618 b3687 b3686 b3238 b2675 yaaX ypeC citC ibpA ibpB yhcN nrdE 4.9 2.8 34.6 6.9 9.5 3.1 26.8 26.6 20.5 14.7 10.4 48.0...”
- Global gene expression profiling of asymptomatic bacteriuria Escherichia coli during biofilm growth in human urine
Hancock, Infection and immunity 2007 - “...mdtL yhcN yqgA rydB sgaB c2436 c2424 b2583 c3859 b3710 b3238 b2966 b4430 b4194 19.8 19.6 19.0 18.9 18.3 17.3 17.2 17.1 16.5 1,196 1,408 1,863 3,664 1,862 5,790...”
- “...yhcN ibpB bfd b3782 b3556 b3687 b4414 b2153 b0802 b1112 b3238 b3686 b3337 6,476 6,387 6,120 6,025 5,942 5,817 5,804 5,790 5,787 5,582 1.8 15.9 8.7 1.0 1.2 8.2...”
- Global gene expression profiling of the asymptomatic bacteriuria Escherichia coli strain 83972 in the human urinary tract
Roos, Infection and immunity 2006 - “...c3973 c1382 b1445 b0620 c2901 b3241 b1335 Z1954 b1430 b3238 b0849 b0151 fepE ydhC evgA nlpI Z4919 c0674 b1660 b2369 b3163 Z4919 a Function or product...”
- Genome-wide localization of mobile elements: experimental, statistical and biological considerations
Martinez-Vaz, BMC genomics 2005 - “...yi52_8, ccmH 10. glcC, b2981, yi52_9, b2983, pitB 11. yhcD, yhcE, yi52_10, b3219, b3221, sspB, b3238 12. yhiS, yi52_11 , yhiF, tnaA We confirmed the presence of an IS5 element in the flhDC / yecG intergenic region by PCR. A 2720 bp PCR product was obtained...”
- More
- Stress response of Escherichia coli to essential oil components - insights on low-molecular-weight proteins from MALDI-TOF
Božik, Scientific reports 2018 - “...protein spectrum were observed. Guaiacol induced the most distinct protein profile: UPF0434 protein (m/z 6960.26, P64614, YcaR) and 23S rRNA methylase leader peptide (Erythromycin resistance leader peptide, m/z 3802.46, P10739, ermC) were detected only in the guaiacol-treated sample at very high levels. The former protein is...”
ECs4111 hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
Aligns to 51:104 / 104 (51.9%), covers 98.2% of PF07338, 78.4 bits
YPTB0458 putative exported protein (NCBI) from Yersinia pseudotuberculosis IP 32953
y0666 hypothetical protein (NCBI ptt file) from Yersinia pestis KIM
Aligns to 34:87 / 87 (62.1%), covers 100.0% of PF07338, 76.9 bits
- IscR is essential for yersinia pseudotuberculosis type III secretion and virulence
Miller, PLoS pathogens 2014 - “...biosynthetic protein pdxJ 2.2 Hypothetical Proteins(9) YPTB0391 putative exported protein 2.1 YPTB0449 hypothetical protein 3.3 YPTB0458 putative exported protein 2.2 YPTB1093 hypothetical protein 3.6 YPTB1571 hypothetical protein 2.1 YPTB2255 putative exported protein 2.3 YPTB2277 hypothetical protein 2.6 YPTB2496 hypothetical protein 2.8 YPTB3109 hypothetical protein 4.1 a...”
- Role of the PhoP-PhoQ gene regulatory system in adaptation of Yersinia pestis to environmental stress in the flea digestive tract
Vadyvaloo, Microbiology (Reading, England) 2015 - “...as per the manufacturer's instructions. Samples were amplified using oligonucleotide primers for crr (y1485), y1667, y0666, y3909, y3519, y2882 ( psaA ), y1918 and the IQ SYBR Green Supermix (Bio-Rad) via a two-step protocol on a Bio-Rad CFX384 real-time system. Oligonucleotide sequences are tabulated in Table...”
- “...1.0 YPO1087 * HigB2 toxin 2.3 1.2 1.0 1.1 YhcN family (DUF1471) multiple stress resistance y0666 yhcN Multiple stress resistance protein 9.3 (1.5) 1.3 1.1 y1667 Multiple stress resistance protein 12.4 (1.9) 1.0 1.2 * Gene not annotated in Y. pestis KIM (YPO number indicates Y....”
YPTB3770 putative exported protein (NCBI) from Yersinia pseudotuberculosis IP 32953
YPO0130 putative exported protein (NCBI ptt file) from Yersinia pestis CO92
Aligns to 36:89 / 89 (60.7%), covers 100.0% of PF07338, 75.2 bits
- Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Rosso, BMC microbiology 2008 - “...protein 0.379 (< 0.001) YPTB3769 (feoC) YPO0131 ferrous iron transport protein C 1.899 (< 0.001) YPTB3770 YPO0130 putative exported protein 0.43 (< 0.001) YPTB3781 YPO3935 putative membrane protein 0.717 (0.036) YPTB3789 or2712 putative invasin 0.614 (0.01) YPTB3811 (uspB) YPO3969 universal stress protein B 0.665 (0.04) YPTB3834...”
- Comparative Global Gene Expression Profiles of Wild-Type Yersinia pestis CO92 and Its Braun Lipoprotein Mutant at Flea and Human Body Temperatures
Galindo, Comparative and functional genomics 2010 - “...dismutase precursor (Cu-Zn) sodC Resistance to reactive oxygen species 18.2 Unknown functions various genes (y3398, YPO0130, 0198, 1087, 1560, 1996, 2153, 2854, and 3699) * Functions were obtained from the CMR online database ( http://cmr.jcvi.org ) and from the literature. FC = fold-change, which was calculated...”
- Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Rosso, BMC microbiology 2008 - “...0.379 (< 0.001) YPTB3769 (feoC) YPO0131 ferrous iron transport protein C 1.899 (< 0.001) YPTB3770 YPO0130 putative exported protein 0.43 (< 0.001) YPTB3781 YPO3935 putative membrane protein 0.717 (0.036) YPTB3789 or2712 putative invasin 0.614 (0.01) YPTB3811 (uspB) YPO3969 universal stress protein B 0.665 (0.04) YPTB3834 (pelY)...”
y3909 hypothetical protein (NCBI ptt file) from Yersinia pestis KIM
Aligns to 39:92 / 92 (58.7%), covers 100.0% of PF07338, 75.1 bits
- Role of the PhoP-PhoQ gene regulatory system in adaptation of Yersinia pestis to environmental stress in the flea digestive tract
Vadyvaloo, Microbiology (Reading, England) 2015 - “...per the manufacturer's instructions. Samples were amplified using oligonucleotide primers for crr (y1485), y1667, y0666, y3909, y3519, y2882 ( psaA ), y1918 and the IQ SYBR Green Supermix (Bio-Rad) via a two-step protocol on a Bio-Rad CFX384 real-time system. Oligonucleotide sequences are tabulated in Table S1....”
- “...). The Y. pestis KIM6+ genome contained five YhcN protein family genes (y1667, y0666, y0640, y3909 and y2136) that encoded predicted proteins of 86, 87, 53, 92 and 317 amino acids, respectively. In E. coli , four of the 10 YhcN family proteins were shown to...”
KPK_4095 hypothetical protein (RefSeq) from Klebsiella pneumoniae 342
Aligns to 33:90 / 90 (64.4%), covers 100.0% of PF07338, 72.5 bits
- Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
Eletsky, PloS one 2014 - “...hormaechei , HMPREF9086_0329, ZP_08496071 (65%); Eae, Enterobacter aerogenes EAE_13230, YP_004592839 (70%); Kpn, Klebsiella pneumonia , KPK_4095, YP_002239898 (68%); Pan, Pantoea sp., Pat9b_3745, YP_004117591 (61%). Notes: Other Salmonella, Klebsiella, and Enterobacter species and strains contain identical or nearly identical sequences to the representatives shown here. However, some...”
A6T5S6 DUF1471 domain-containing protein from Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
KPN_00497 hypothetical protein (RefSeq) from Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Aligns to 33:90 / 90 (64.4%), covers 100.0% of PF07338, 70.8 bits
- Direct identification of bacterial and human proteins from infected wounds in living 3D skin models
Havlikova, Scientific reports 2020 - “...0.0066 -Hemolysin Q6G7S2 fMet, G10S substitution 88 48 K. pneumoniae KP257 7,698.9926 7,698.9638 3.7382 KPN_00497 A6T5S6 -Signal peptide (119), R49K substitution 19 48 9,471.1664 9,471.1468 2.0673 DNA-binding protein HU- A6TGQ7 30 48 P. aeruginosa PS1054 5,731.9826 5,731.9816 0.1814 PA0039 Q9I793 -Signal peptide (121) 13 48 8,557.5098...”
- Direct identification of bacterial and human proteins from infected wounds in living 3D skin models
Havlikova, Scientific reports 2020 - “...3,034.6413 0.0066 -Hemolysin Q6G7S2 fMet, G10S substitution 88 48 K. pneumoniae KP257 7,698.9926 7,698.9638 3.7382 KPN_00497 A6T5S6 -Signal peptide (119), R49K substitution 19 48 9,471.1664 9,471.1468 2.0673 DNA-binding protein HU- A6TGQ7 30 48 P. aeruginosa PS1054 5,731.9826 5,731.9816 0.1814 PA0039 Q9I793 -Signal peptide (121) 13 48...”
- “...KP257, two proteins were identified. Firstly, an uncharacterized protein predicted on the basis of gene KPN_00497 was identified. The protein was detected with a cleaved signal peptide (119) and a RK substitution at position 49. Secondly, DNA-binding protein HU-, which is involved in stabilization of DNA...”
STY1254 putative secreted protein (NCBI ptt file) from Salmonella enterica subsp. enterica serovar Typhi str. CT18
Aligns to 33:85 / 85 (62.4%), covers 98.2% of PF07338, 70.5 bits
- Transcriptomic study of Salmonella enterica subspecies enterica serovar Typhi biofilm
Chin, BMC genomics 2017 - “...in the track represent the log 2 -fold change of each gene, e.g. up-regulated genes STY1254 (1,207,090...1207347), and yheA (4,231,386...4231580), and down-regulated genes rmf (1,066,679...1066846) and STY1156 (1,116,294...1116461) Table 2 Selected differentially up-regulated genes and their functions in S. Typhi biofilm cells Gene Gene function log...”
- “...bacteria membrane matrix The gene that was most highly up-regulated in the biofilm cells was STY1254 , a multiple stress resistance protein, bhsA . It plays a role in the membrane structure of S. Typhi [ 16 ]. According to a study by Zhang et al....”
STM1214 putative outer membrane protein (NCBI ptt file) from Salmonella typhimurium LT2
NP_460184 multiple stress resistance protein BhsA from Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
SL1344_1151 DUF1471 domain-containing protein from Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344
Aligns to 33:85 / 85 (62.4%), covers 98.2% of PF07338, 70.5 bits
- Stress response, amino acid biosynthesis and pathogenesis genes expressed in Salmonella enterica colonizing tomato shoot and root surfaces
Han, Heliyon 2020 - “...SIGNALING [M] Cell wall/membrane/envelope biogenesis yhdV STM3392 outer membrane lipoprotein 1.7 0.002 3.7 0.003 ycfR STM1214 Reduces the permeability of the outer membrane to copper. Seems to be involved in the regulation of biofilm formation. May decrease biofilm formation by repressing cell-cell interaction and cell surface...”
- Mapping and regulation of genes within Salmonella pathogenicity island 12 that contribute to in vivo fitness of Salmonella enterica Serovar Typhimurium
Tomljenovic-Berube, Infection and immunity 2013 - “...3.53 1.63E22 1.83E15 2.07E20 4.71E43 3.41E23 1.05E16 2.49E12 STM1214 STM3828 STM0701 STM0152 ycfR dgoA speF aceE 3.18 3.17 3.12 3.06 3.53E09 2.88E39 2.87E76...”
- Effects of indole on drug resistance and virulence of Salmonella enterica serovar Typhimurium revealed by genome-wide analyses
Nikaido, Gut pathogens 2012 - “...ybiJ Putative periplasmic protein 3.2 11 STM1156 yceA Putative enzyme related to sulfurtransferases 4.3 8.0 STM1214 ycfR Putative outer membrane protein 4.6 37 STM1251 Putative molecular chaperone (small heat shock protein) 11 9.2 STM1355 ydiP Putative transcription regulator, AraC family 11 7.5 STM1472 Putative periplasmic protein...”
- Transcriptomic responses of Salmonella enterica serovars Enteritidis and Typhimurium to chlorine-based oxidative stress
Wang, Applied and environmental microbiology 2010 - “...regulatory protein STM0823 ybiJ Putative periplasmic protein STM1214 ycfR Putative outer membrane protein STM2430 cysK O-Acetylserine sulfhydrolase A STM2338...”
- Roles of YcfR in Biofilm Formation in Salmonella Typhimurium ATCC 14028.
Kim, Molecular plant-microbe interactions : MPMI 2019 (PubMed)- GeneRIF: YcfR is an essential constituent of Salmonella outer membrane architecture and its absence may cause multifaceted structural changes, thereby compromising bacterial envelope integrity
- Tigecycline challenge triggers sRNA production in Salmonella enterica serovar Typhimurium
Yu, BMC microbiology 2012 - “...in the cDNA library, e.g. dinF and a gene encoding a putative outer membrane protein (SL1344_1151). The dinF gene is a member of the SOS response family and encodes an efflux pump which belongs to the multidrug and toxic compound extrusion (MATE) family [ 31 ],...”
EAE_13230 DUF1471 domain-containing protein from Klebsiella aerogenes KCTC 2190
Aligns to 33:90 / 90 (64.4%), covers 100.0% of PF07338, 70.3 bits
- Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
Eletsky, PloS one 2014 - “...rodentium , ROD_12311, YP_003364817 (80%); Eho, Enterobacter hormaechei , HMPREF9086_0329, ZP_08496071 (65%); Eae, Enterobacter aerogenes EAE_13230, YP_004592839 (70%); Kpn, Klebsiella pneumonia , KPK_4095, YP_002239898 (68%); Pan, Pantoea sp., Pat9b_3745, YP_004117591 (61%). Notes: Other Salmonella, Klebsiella, and Enterobacter species and strains contain identical or nearly identical sequences...”
ComC / b1112 DUF1471 domain-containing multiple stress resistance outer membrane protein BhsA from Escherichia coli K-12 substr. MG1655 (see 10 papers)
BHSA_ECOLI / P0AB40 Multiple stress resistance protein BhsA; Copper-induced outer membrane component from Escherichia coli (strain K12) (see 2 papers)
bhsA multiple stress resistance protein bhsA from Escherichia coli K12 (see 4 papers)
ECs1490 hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
NP_309517 multiple stress resistance protein BhsA from Escherichia coli O157:H7 str. Sakai
NP_415630 DUF1471 domain-containing multiple stress resistance outer membrane protein BhsA from Escherichia coli str. K-12 substr. MG1655
b1112 hypothetical protein (NCBI) from Escherichia coli str. K-12 substr. MG1655
c1386 Hypothetical protein ycfR precursor (NCBI ptt file) from Escherichia coli CFT073
DR76_RS20000, ETEC_1177 multiple stress resistance protein BhsA from Escherichia coli ETEC H10407
Aligns to 33:85 / 85 (62.4%), covers 98.2% of PF07338, 69.7 bits
- function: Reduces the permeability of the outer membrane to copper. Seems to be involved in the regulation of biofilm formation. May decrease biofilm formation by repressing cell-cell interaction and cell surface interaction.
disruption phenotype: Disruption of this gene increases copper sensitivity, induces stress response genes in biofilms, increases aggregation and cell surface hydrophobicity, and decreases indole synthesis. - Pre-Harvest Survival and Post-Harvest Chlorine Tolerance of Enterohemorrhagic Escherichia coli on Lettuce
Tyagi, Toxins 2019 - “...3.7 3.9 ECs1417 csgD Transcriptional regulator CsgD 4.5 3.3 ECs1438 bssS biofilm regulator 3.4 4.2 ECs1490 bhsA multiple stress resistance protein (YcfR) 3.5 4.2 ECs1926 zntB Zinc transport protein ZntB 1.8 1.8 ECs2062 ybfL type IV secretion protein Rhs 3.9 3.0 ECs2155 nleG6-2 T3SS secreted effector...”
- Gene expression induced in Escherichia coli O157:H7 upon exposure to model apple juice
Bergholz, Applied and environmental microbiology 2009 - “...ECs1318 ECs1342 ECs1350 ECs1397 ECs1438 ECs1441 ECs1488 ECs1490 ECs1576 ECs1588 ECs1593 ECs1612 ECs1654 ECs1655 ECs1691 ECs1760 ECs1763 ECs1771 ECs1775 ECs1823...”
- Functional analysis of ycfR and ycfQ in Escherichia coli O157:H7 linked to outbreaks of illness associated with fresh produce.
Deng, Applied and environmental microbiology 2011 - GeneRIF: These findings suggest that gene regulation via ycfQ and ycfR may be a mechanism by which Escherichia coli O157:H7 strain Sakai could survive in the postharvest processing environment.
- The copper-inducible ComR (YcfQ) repressor regulates expression of ComC (YcfR), which affects copper permeability of the outer membrane of Escherichia coli.
Mermod, Biometals : an international journal on the role of metal ions in biology, biochemistry, and medicine 2012 (PubMed)- GeneRIF: ComC is an outer membrane protein which lowers the permeability of the outer membrane to copper, and its expression is controlled by ComR, a novel, TetR-like copper-responsive repressor.
- Top-Down LESA Mass Spectrometry Protein Analysis of Gram-Positive and Gram-Negative Bacteria
Kocurek, Journal of the American Society for Mass Spectrometry 2017 - “...24 h, 37 C Storage: 15 days, 4 C 1088.8935 +6 6527.32 -1.1 BhsA a P0AB40 35 -signal peptide 1094.2255 +8 8745.75 -0.6 YnaE P76073 62 1212.1269 +6 7266.72 -0.4 CspC P0A9Y6 37 Incubation: 24 h, 37 C Storage: 2 days, room temperature -Met 1356.6814 +3...”
- Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure
LaVoie, BMC genomics 2018 - “...Name Product Description Hg t10 Hg t30 Hg t60 PMA t10 PMA t30 PMA t60 b1112 bhsA Biofilm, cell surface and signaling defects, YhcN family 1949 563 94 46 21 n.s. b4458 oxyS OxyS sRNA activates genes that detoxify oxidative damage 1524 1292 150 10 6...”
- “...n.s. b1531 marA Transcriptional activator for multiple antibiotic resistance; 15 9 n.s. 46 31 n.s. b1112 bhsA Biofilm, cell surface and signaling defects, YhcN family 1949 563 94 46 21 n.s. b1532 marB marRAB multiple antibiotic resistance operon 16 8 n.s. 45 27 n.s. b4663 azuC...”
- Transcriptomic analysis of carboxylic acid challenge in Escherichia coli: beyond membrane damage
Royce, PloS one 2014 - “...0.002 0.003 3.5 Biofilm formation- rapid acid treatment b3516 gadX 0.001 0.014 3.5 AR2 TR b1112 bhsA 0.002 0.003 3.3 Influencing biofilm through hydrophobicity and SR b2012 yeeD 0.010 0.106 3.0 Uncharacterized b1164 ycgZ 0.006 0.107 2.9 Cold shock stimulon b4554 (c4419) yibT 0.001 0.056 2.8...”
- Global gene expression profiling of asymptomatic bacteriuria Escherichia coli during biofilm growth in human urine
Hancock, Infection and immunity 2007 - “...ycfR yhcN ibpB bfd b3782 b3556 b3687 b4414 b2153 b0802 b1112 b3238 b3686 b3337 6,476 6,387 6,120 6,025 5,942 5,817 5,804 5,790 5,787 5,582 1.8 15.9 8.7 1.0 1.2...”
- luxS-dependent gene regulation in Escherichia coli K-12 revealed by genomic expression profiling
Wang, Journal of bacteriology 2005 - “...b1022 b1437 b4186 b2406 b3939 b3945 b0648 b1680 b0823 b1112 b4288 b4310 b3103 b0621 b1407 b0076 b2723 b3683 b3028 b2968 b0579 b3220 b0260 b3046 b2919 b3906...”
- Gene expression in Escherichia coli biofilms
Ren, Applied microbiology and biotechnology 2004 (PubMed)- “...of unknown function (ybaJ, ychM, yefM, ygfA, b1060, b1112, b2377, b3022, b1373, b1601, and b0836). The DNA microarray results were corroborated with RNA dot...”
- “...3 trpE b1264 Unknown genes ybaJ b0461 b2377 b2377 b1112 b1112 b3022 b3022 2 4 Heat shock protein Regulation of superoxide response regulon, global regulator...”
- Prominent roles of the NorR and Fur regulators in the Escherichia coli transcriptional response to reactive nitrogen species
Mukhopadhyay, Proceedings of the National Academy of Sciences of the United States of America 2004 - “...b1684 b0127 b4367 b2875 b3106 b4357 b2579 b0484 b3744 b4381 b3774 b0802 b2715 b1200 b1241 b1112 173 338 70 38 2 3 11 2 17 18 1 1 6 5 2 1 15 2 6 7 9 1 1 1 1 2 4...”
- Evolutionary comparisons suggest many novel cAMP response protein binding sites in Escherichia coli
Brown, Proceedings of the National Academy of Sciences of the United States of America 2004 - “...(b1779) ydeA (b1528) hpt (b0125); ged (b0124) yefQ (b1111); ycfR (b1112) proP (b4111) ygiG (b3073); aer (b3072) -- -- 3.33 9.14 -- -- -- -- 5.87 -- 4.47 6.70...”
- Elucidation of the antibacterial mechanism of the Curvularia haloperoxidase system by DNA microarray profiling
Hansen, Applied and environmental microbiology 2004 - “...chain b0365 Taurine transport system periplasmic protein b1112 ORF, hypothetical protein b1649 ORF, hypothetical protein b1650 N-Ethylmaleimide reductase b1651...”
- More
- Phenolic Compounds Reduce the Fat Content in Caenorhabditis elegans by Affecting Lipogenesis, Lipolysis, and Different Stress Responses
Aranaz, Pharmaceuticals (Basel, Switzerland) 2020 (no snippet) - Structural determinants of NH3 and NH4+ transport by mouse Rhbg, a renal Rh glycoprotein
Abdulnour-Nakhoul, American journal of physiology. Renal physiology 2016 (secret) - Virulence and transcriptome profile of multidrug-resistant Escherichia coli from chicken
Hussain, Scientific reports 2017 - “...0.01 DR76_RS05090 HdeB Acid-resistance protein HdeB 5.17 0.01 DR76_RS05080 HdeD Acid-resistance protein HdeD 5.81 0.01 DR76_RS20000 BhsA Multiple stress resistance protein BhsA 1.30 0.01 DR76_RS04045 IbpB Heat shock chaperone IbpB 2.80 0.01 DR76_RS04040 IbpA Heat shock protein IbpA 1.91 0.01 DR76_RS14975 Hsp31 Heat shock protein Hsp31...”
- The molecular basis for control of ETEC enterotoxin expression in response to environment and host
Haycocks, PLoS pathogens 2015 - “...1263558 T T TGA CGGCTA TCAC G ETEC_1166 ptsG 1274886 TGTGA TCTGGA TCACA ETEC_1176 / ETEC_1177 ycfQ / bhsA 1301786 GA TGA TCCGCA TCACA ( ETEC_1206 )/ ETEC_1207 ETEC-specific/ETEC-specific 1348166 AT TGA ACAGGA TCACA (ETEC_1259)/ETEC_1260 (rluE)/icd 1376374 G GTGA GCTGGC TCACA ETEC_1292 / ETEC_1293 ycgB /...”
ETEC_4545 DUF1471 domain-containing protein from Escherichia coli ETEC H10407
Aligns to 35:91 / 91 (62.6%), covers 98.2% of PF07338, 68.8 bits
YjfY / b4199 DUF1471 domain-containing protein YjfY from Escherichia coli K-12 substr. MG1655 (see paper)
b4199 hypothetical protein (NCBI) from Escherichia coli str. K-12 substr. MG1655
Z5808 orf, hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 EDL933
ECs5175 hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
Aligns to 35:91 / 91 (62.6%), covers 98.2% of PF07338, 68.8 bits
- Global gene expression profiling of asymptomatic bacteriuria Escherichia coli during biofilm growth in human urine
Hancock, Infection and immunity 2007 - “...c3865 fxsA b0824 b1532 b4198 Z0555 b4212 b3556 b4199 c3865 b4140 Homolog of Salmonella cold shock protein Cold shock-like protein Heat shock protein Multiple...”
- Combined, functional genomic-biochemical approach to intermediary metabolism: interaction of acivicin, a glutamine amidotransferase inhibitor, with Escherichia coli K-12
Smulski, Journal of bacteriology 2001 - “...b3928 b3937 b3995 b4030 b4126 b4127 b4135 b4178 b4189 b4199 b4206 b4234 b4255 b4311 b4325 b4326 b2300 b2302 b2303 b2442 b2529 b2530 b2597 b2664 b2665 b2856...”
- “...b3875 b3923 b3928 b3937 b3995 b4030 b4126 b4127 b4135 b4178 b4189 b4199 b4206 b4234 b4255 b4311 b4325 b4326 3.2 3.6 2.8 2.2 2.1 2.7 23.6 3.2 4.7 2.6 2.1 2.1 2.0...”
- Comparison of strand-specific transcriptomes of enterohemorrhagic Escherichia coli O157:H7 EDL933 (EHEC) under eleven different environmental conditions including radish sprouts and cattle feces
Landstorfer, BMC genomics 2014 - “...(47) 0.4 (17) 1.0 (7) 6.2 (0) 0.9 (16) 1.7 (25) 5.8 (430) 0.3 (2) Z5808 yjfY , biofilm formation [ 47 49 ] radish 1 (13) 2.7 (50) 1.5 (6) 0.4 (15) 3.0 (99) 1.8 (12) 2.1 (19) 0.3 (7) 1.8 (27) 7.5 (1365) 4.5...”
- “...LB medium (D1), minimal medium (D2), and on radish sprouts (D3). E1-E3: regulated hypothetical gene Z5808 (see Table 2 ), in LB medium (E1), minimal medium (E2), and on radish sprouts (E3). The color map values range from 0.1 to 3 10 5 , the exact...”
- Influence of Glucose Availability and CRP Acetylation on the Genome-Wide Transcriptional Response of Escherichia coli: Assessment by an Optimized Factorial Microarray Analysis
Guebel, Frontiers in microbiology 2018 - “...a set of four genes that codify periplasmic proteins with dodecin-like structure (ECs5165, ECs0884, ECs5164, ECs5175; FDR = 2.1 10 2 ) and another set of five genes which codify enzymes involved in L-arginine degradation ( astA [arginine N-succinyltransferase], astB [N-succinylarginine dihydrolase], astC [bifunctional enzyme succinylornithine...”
SBG_0068 DUF1471 domain-containing protein from Salmonella bongori NCTC 12419
Aligns to 35:92 / 96 (60.4%), covers 100.0% of PF07338, 68.4 bits
- Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
Eletsky, PloS one 2014 - “...Salmonella enterica Typhimurium, STM0082 (SrfN), NP_459087 and many other Salmonella strains; Sbo, Salmonella bongori , SBG_0068, YP_004728986 (93%); Cro, Citrobacter rodentium , ROD_12311, YP_003364817 (80%); Eho, Enterobacter hormaechei , HMPREF9086_0329, ZP_08496071 (65%); Eae, Enterobacter aerogenes EAE_13230, YP_004592839 (70%); Kpn, Klebsiella pneumonia , KPK_4095, YP_002239898 (68%); Pan,...”
YPTB2554 putative exported protein (NCBI) from Yersinia pseudotuberculosis IP 32953
YPO2521 putative exported protein (NCBI ptt file) from Yersinia pestis CO92
y1667 hypothetical protein (NCBI ptt file) from Yersinia pestis KIM
Aligns to 34:86 / 86 (61.6%), covers 100.0% of PF07338, 68.2 bits
- Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Rosso, BMC microbiology 2008 - “...(0.001) YPTB2540 or3654 conserved hypothetical protein 2.145 (0.008) YPTB2552 YPO2515 hypothetical 1.46 (0.023) 1.396 (0.042) YPTB2554 YPO2521 putative exported protein 0.648 (0.044) YPTB2562 YPO2530 conserved hypothetical protein 0.527 (0.026) YPTB2623 (flk) YPO2760 putative flagellar assembly regulatory protein. flk 0.549 (0.008) YPTB2699 YPO2976 conserved hypothetical protein 4.448...”
- Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Rosso, BMC microbiology 2008 - “...YPTB2540 or3654 conserved hypothetical protein 2.145 (0.008) YPTB2552 YPO2515 hypothetical 1.46 (0.023) 1.396 (0.042) YPTB2554 YPO2521 putative exported protein 0.648 (0.044) YPTB2562 YPO2530 conserved hypothetical protein 0.527 (0.026) YPTB2623 (flk) YPO2760 putative flagellar assembly regulatory protein. flk 0.549 (0.008) YPTB2699 YPO2976 conserved hypothetical protein 4.448 (<...”
- Role of the PhoP-PhoQ gene regulatory system in adaptation of Yersinia pestis to environmental stress in the flea digestive tract
Vadyvaloo, Microbiology (Reading, England) 2015 - “...Technologies) as per the manufacturer's instructions. Samples were amplified using oligonucleotide primers for crr (y1485), y1667, y0666, y3909, y3519, y2882 ( psaA ), y1918 and the IQ SYBR Green Supermix (Bio-Rad) via a two-step protocol on a Bio-Rad CFX384 real-time system. Oligonucleotide sequences are tabulated in...”
- “...family (DUF1471) multiple stress resistance y0666 yhcN Multiple stress resistance protein 9.3 (1.5) 1.3 1.1 y1667 Multiple stress resistance protein 12.4 (1.9) 1.0 1.2 * Gene not annotated in Y. pestis KIM (YPO number indicates Y. pestis CO92 homologue). Elevated transcription of four putative toxinantitoxin (TA)...”
SEN_RS21580 DUF1471 domain-containing protein from Salmonella enterica subsp. enterica serovar Enteritidis str.
Aligns to 35:90 / 91 (61.5%), covers 98.2% of PF07338, 67.9 bits
Q8GHK9 DUF1471 domain-containing protein from Serratia marcescens
Aligns to 38:91 / 94 (57.4%), covers 100.0% of PF07338, 67.0 bits
Ent638_3824 protein of unknown function DUF1471 (RefSeq) from Enterobacter sp. 638
Aligns to 36:89 / 89 (60.7%), covers 100.0% of PF07338, 67.0 bits
Pat9b_3745 DUF1471 domain-containing protein from Pantoea sp. At-9b
Aligns to 33:90 / 90 (64.4%), covers 100.0% of PF07338, 66.7 bits
- Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
Eletsky, PloS one 2014 - “...Enterobacter aerogenes EAE_13230, YP_004592839 (70%); Kpn, Klebsiella pneumonia , KPK_4095, YP_002239898 (68%); Pan, Pantoea sp., Pat9b_3745, YP_004117591 (61%). Notes: Other Salmonella, Klebsiella, and Enterobacter species and strains contain identical or nearly identical sequences to the representatives shown here. However, some Pantoea species do not contain homologues...”
STM0082 putative secreted protein (NCBI ptt file) from Salmonella typhimurium LT2
NP_459087 hypothetical protein from Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
SEN0084 probable secreted protein (RefSeq) from Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Aligns to 35:92 / 96 (60.4%), covers 98.2% of PF07338, 66.4 bits
- Salmonella Establishment in Agricultural Soil and Colonization of Crop Plants Depend on Soil Type and Plant Species
Jechalke, Frontiers in microbiology 2019 - “...expression of genes associated with infection and host-pathogen interaction was increased ( feoB , STM1808, STM0082), as well as genes associated with biofilm formation ( yaiC, luxS ). Interestingly, sulA , which is associated with filamentation and downregulation of SPI-1 as well as celC , encoding...”
- “...growth of Salmonella during systemic infection of mice ( Karlinsey et al., 2012 ) and STM0082, also referred to as gene srfN , which was reported for S. enterica to be important for intra-host fitness even though, the exact function of this gene is not known...”
- The RNA Complement of Outer Membrane Vesicles From Salmonella enterica Serovar Typhimurium Under Distinct Culture Conditions
Malabirade, Frontiers in microbiology 2018 - “...the stable presence of transcripts of T3SS-independent effectors such as ydgH (or sssB ) and STM0082 (or srfN ) ( Eletsky et al., 2014 ). No enrichment of T3SS-independent effectors was observed in OMVs isolated from SPI-2ind conditions even though their intracellular expression is increased in...”
- InvS Coordinates Expression of PrgH and FimZ and Is Required for Invasion of Epithelial Cells by Salmonella enterica serovar Typhimurium
Wang, Journal of bacteriology 2017 - “...derived from the 3= untranslated region (UTR) of srfN (STM0082) (8). A Northern blot analysis confirmed the size of InvS and that it is cotranscribed with srfN...”
- “...that InvS sRNA is encoded in the 3= UTR of STM0082. For this, we tested whether the overexpression of these regulators would rescue the invasion defect of the...”
- Temporal Regulation of a Salmonella Typhimurium Virulence Factor by the Transcriptional Regulator YdcR
Liu, Molecular & cellular proteomics : MCP 2017 - “...volcano plot the only protein near YdcR is SrfN (STM0082), indicating its marked repression in the ydcR strain. Furthermore, like YdcR, SrfN was not detected in...”
- “...strain at 18 hpi Gene Protein description ydcR STM0082 nupC cysN STM2234 pipB yfgC frdB Putative GntR family regulatory protein Putative secreted protein NUP...”
- The Impact of 18 Ancestral and Horizontally-Acquired Regulatory Proteins upon the Transcriptome and sRNA Landscape of Salmonella enterica serovar Typhimurium
Colgan, PLoS genetics 2016 - “...< > 0.89 - c STnc3090 oadG STM0057 < > < 0.87 - STnc470 (InvS) STM0082 STM0081 > < < 0.85 - STnc3020 prgJ prgH as to prgI 0.84 Yes STnc3180 ybdO dsbG < > < 0.83 - PinT STM4310 STM4312 > > < 0.82 -...”
- Global analysis of Salmonella alternative sigma factor E on protein translation
Li, Journal of proteome research 2015 - “...were verified by Western blot analysis of the relative protein levels of CspA and SrfN (STM0082) in the three growth conditions studied ( Figure 2A,C ). By using chromosomal HA-tagged fusion proteins, we found that CspA expression was significantly higher in the rpoE strain compared to...”
- Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
Eletsky, PloS one 2014 - “...and similarity to SrfN, excluding the signal sequence, are as follows: Sty, Salmonella enterica Typhimurium, STM0082 (SrfN), NP_459087 and many other Salmonella strains; Sbo, Salmonella bongori , SBG_0068, YP_004728986 (93%); Cro, Citrobacter rodentium , ROD_12311, YP_003364817 (80%); Eho, Enterobacter hormaechei , HMPREF9086_0329, ZP_08496071 (65%); Eae, Enterobacter...”
- “...some Pantoea species do not contain homologues that fall within this DUF1471 subfamily. The SrfN (STM0082 in S . Typhimurium LT2) protein is one of a few DUF1471 paralogues for which limited experimental data has provided some clues to the function. SrfN has close homologues in...”
- Mixed-isotope labeling with LC-IMS-MS for characterization of protein-protein interactions by chemical cross-linking
Merkley, Journal of the American Society for Mass Spectrometry 2013 - “...for providing the plasmid construct for expressing SrfN/ STM0082 and the mixture of unlabeled and 13C,15N-labeled SO_2176, Dr. Sam Payne and Dr. Gordon Slysz...”
- More
- Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
Eletsky, PloS one 2014 - “...to SrfN, excluding the signal sequence, are as follows: Sty, Salmonella enterica Typhimurium, STM0082 (SrfN), NP_459087 and many other Salmonella strains; Sbo, Salmonella bongori , SBG_0068, YP_004728986 (93%); Cro, Citrobacter rodentium , ROD_12311, YP_003364817 (80%); Eho, Enterobacter hormaechei , HMPREF9086_0329, ZP_08496071 (65%); Eae, Enterobacter aerogenes EAE_13230,...”
- Genetic diversity and evolution of Salmonella enterica serovar Enteritidis strains with different phage types
Zheng, Journal of clinical microbiology 2014 - “...to KF449715 for the intergenic sequence (IGS) between SEN0084 and SEN0085, KF449716 to KF449813 for SEN0629, KF449814 to KF449911 for SEN0999-SEN1000, KF449912...”
SC0077 putative secreted protein (NCBI) from Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
Aligns to 35:92 / 96 (60.4%), covers 98.2% of PF07338, 66.4 bits
- Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
Eletsky, PloS one 2014 - “...which has described previously [29] . Briefly, the coding sequences of the STM0082 (SrfN) and SC0077 (YahO) genes of Salmonella enterica serovars Typhimurium LT2 and Choleraesuis, respectively, were cloned into vector pET21_NESG coding for a C-terminal affinity tag (LEHHHHHH) to yield the plasmids StR109-21.1 and StR106-21.1....”
- “...( http://psimr.asu.edu/ ). The sequence of YahO from Salmonella Typhimurium LT2 (STM0366) is identical to SC0077. The plasmids were transformed separately into E. coli BL21(DE3) pMgK cells and cultured in MJ9 medium [30] containing 2 g/L [ U - 13 C]-glucose and 1 g/L [ U...”
YjfN / b4188 protease activator YjfN from Escherichia coli K-12 substr. MG1655 (see 5 papers)
b4188 orf, hypothetical protein (VIMSS) from Escherichia coli str. K-12 substr. MG1655
Aligns to 35:90 / 91 (61.5%), covers 98.2% of PF07338, 66.1 bits
ECs5164 hypothetical protein (NCBI) from Escherichia coli O157:H7 str. Sakai
Aligns to 39:94 / 95 (58.9%), covers 98.2% of PF07338, 65.9 bits
Z5795 orf, hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 EDL933
Aligns to 44:99 / 100 (56.0%), covers 98.2% of PF07338, 65.7 bits
YbiM / b0806 DUF1471 domain-containing protein McbA from Escherichia coli K-12 substr. MG1655 (see 2 papers)
MCBA_ECOLI / P0AAX6 Uncharacterized protein McbA; MqsR-controlled colanic acid and biofilm protein A from Escherichia coli (strain K12) (see paper)
mcbA / ECOCYC|G6415-MONOMER MqsR-controlled colanic acid and biofilm protein A from Escherichia coli K12 (see paper)
b0806 orf, hypothetical protein (VIMSS) from Escherichia coli str. K-12 substr. MG1655
NP_415327 DUF1471 domain-containing protein McbA from Escherichia coli str. K-12 substr. MG1655
Aligns to 34:86 / 86 (61.6%), covers 100.0% of PF07338, 65.0 bits
- function: Affects biofilm formation and mucoidy.
- 5-azacytidine induces transcriptome changes in Escherichia coli via DNA methylation-dependent and DNA methylation-independent mechanisms
Militello, BMC microbiology 2016 - “...A; homodimeric; selenate, azaserine, chromate resistance; alkali-inducible, sulfate starvation-inducible protein SSI5; cysteine desulfhydrase 1.58 2.86E-03 b0806 mcbA Stimulates colanic acid mucoidy, YhcN family, periplasmic; suppresses biofilm formation; repressed by McbR 1.71 5.11E-04 b2425 cysP Thiosulfate-binding protein, periplasmic 1.84 1.90E-04 b0506 allR Repressor for all (allantoin) and...”
- YcfR (BhsA) influences Escherichia coli biofilm formation through stress response and surface hydrophobicity
Zhang, Journal of bacteriology 2007 - “...function ybiM ybaA yceK yjbJ yjdN ygaM ymgE b0806 b0456 b1050 b4045 b4107 b2672 b1195 Hypothetical protein Hypothetical protein Hypothetical protein Highly...”
- Combined, functional genomic-biochemical approach to intermediary metabolism: interaction of acivicin, a glutamine amidotransferase inhibitor, with Escherichia coli K-12
Smulski, Journal of bacteriology 2001 - “...b0607 b0643 b0662 b0707 b0753 b0786 b0789 b0790 b0800 b0806 b0836 b0865 b0897 b0964 b0966 b1003 b1045 b1050 b1060 b1103 b1104 b1105 b1107 b1108 b1111 b1112...”
- The C-terminal part of microcin B is crucial for DNA gyrase inhibition and antibiotic uptake by sensitive cells.
Shkundina, Journal of bacteriology 2014 - GeneRIF: The C-terminal part of McbA is crucial for DNA gyrase inhibition and antibiotic uptake.
- Proton motive force dissipation precludes interaction of microcin J25 with RNA polymerase, but enhances reactive oxygen species overproduction.
Dupuy, Biochimica et biophysica acta 2009 (PubMed)- GeneRIF: Data show that the deleterious reactive oxygen species would be produced as a consequence of the minor fraction of MccJ25 that interacts with the bacterial plasma membrane from the periplasmic side.
- Escherichia coli transcription factor YncC (McbR) regulates colanic acid and biofilm formation by repressing expression of periplasmic protein YbiM (McbA).
Zhang, The ISME journal 2008 (PubMed)- GeneRIF: YncC inhibits colanic acid overproduction and thereby inhibits mucoidy by repressing expression of periplasmic protein YbiM
ROD_12311 hypothetical protein (RefSeq) from Citrobacter rodentium ICC168
Aligns to 51:108 / 112 (51.8%), covers 98.2% of PF07338, 65.0 bits
- Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
Eletsky, PloS one 2014 - “...many other Salmonella strains; Sbo, Salmonella bongori , SBG_0068, YP_004728986 (93%); Cro, Citrobacter rodentium , ROD_12311, YP_003364817 (80%); Eho, Enterobacter hormaechei , HMPREF9086_0329, ZP_08496071 (65%); Eae, Enterobacter aerogenes EAE_13230, YP_004592839 (70%); Kpn, Klebsiella pneumonia , KPK_4095, YP_002239898 (68%); Pan, Pantoea sp., Pat9b_3745, YP_004117591 (61%). Notes: Other...”
ECs0884 hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
Z1027 orf, hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 EDL933
Aligns to 82:134 / 134 (39.6%), covers 100.0% of PF07338, 63.5 bits
- Influence of Glucose Availability and CRP Acetylation on the Genome-Wide Transcriptional Response of Escherichia coli: Assessment by an Optimized Factorial Microarray Analysis
Guebel, Frontiers in microbiology 2018 - “...significant classes a set of four genes that codify periplasmic proteins with dodecin-like structure (ECs5165, ECs0884, ECs5164, ECs5175; FDR = 2.1 10 2 ) and another set of five genes which codify enzymes involved in L-arginine degradation ( astA [arginine N-succinyltransferase], astB [N-succinylarginine dihydrolase], astC [bifunctional...”
- Comparison of strand-specific transcriptomes of enterohemorrhagic Escherichia coli O157:H7 EDL933 (EHEC) under eleven different environmental conditions including radish sprouts and cattle feces
Landstorfer, BMC genomics 2014 - “...(2) 1.5 (45) 2.5 (25) 0.9 (3) 1.7 (35) 1.7 (31) 6.6 (945) 3.3 (28) Z1027 ybiM , biofilm formation [ 44 ] radish 1 (17) 0.3 (8) 5.6 (0) 3.1 (1) 0.3 (12) 0.0 (4) 5.6 (0) 5.6 (0) 2.3 (2) 7.5 (1751) 5.6 (0)...”
- “...LB medium (B1), minimal medium (B2), and on radish sprouts (B3). C1-C3: regulated hypothetical gene Z1027 (see Table 2 ), in LB medium (C1), minimal medium (C2), and on radish sprouts (C3). D1-D3: regulated hypothetical gene Z4396 (Table 2 ), in LB medium (D1), minimal medium...”
- Transcriptional responses of Escherichia coli K-12 and O157:H7 associated with lettuce leaves
Fink, Applied and environmental microbiology 2012 - “...expression Symbol Description Day 1 Day 3 Biofilm Z1027 Z1697 ybiM yceP (bssS) Hypothetical protein Hypothetical protein 31.30 7.90 68.30 7.90 Cell envelope...”
STY0860 putative exported protein (NCBI ptt file) from Salmonella enterica subsp. enterica serovar Typhi str. CT18
STM0823 putative periplasmic protein (NCBI ptt file) from Salmonella typhimurium LT2
Aligns to 34:86 / 86 (61.6%), covers 100.0% of PF07338, 62.3 bits
ECs0880 hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
Z1023 orf, hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 EDL933
Aligns to 34:86 / 86 (61.6%), covers 100.0% of PF07338, 61.0 bits
- Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
King, Applied and environmental microbiology 2010 - “...ECs3081 b2190 ECs2359 ECs3396 ECs0128 ECs3328 ECs0503 ECs0880 ECs0927 ECs2042 b0802 b0847 b1438 b2530 b0124 b2466 b0449 ECs0512 ECs5566 ECs2316 ECs0252...”
- Comparison of strand-specific transcriptomes of enterohemorrhagic Escherichia coli O157:H7 EDL933 (EHEC) under eleven different environmental conditions including radish sprouts and cattle feces
Landstorfer, BMC genomics 2014 - “...(0) 4.6 (3) 0.0 (0) 0.0 (0) 0.0 (0) 3.3 (1) 5.7 (4) 0.0 (0) Z1023 ybiJ , biofilm formation [ 42 , 43 ] radish 1 (17) 0.2 (8) 0.2 (3) 2.6 (2) 1.5 (45) 2.5 (25) 0.9 (3) 1.7 (35) 1.7 (31) 6.6 (945)...”
- “...found on the forward strand of this region. B1-B3: example for a regulated hypothetical gene, Z1023 (see Table 2 ), in LB medium (B1), minimal medium (B2), and on radish sprouts (B3). C1-C3: regulated hypothetical gene Z1027 (see Table 2 ), in LB medium (C1), minimal...”
YbiJ / b0802 DUF1471 domain-containing protein YbiJ from Escherichia coli K-12 substr. MG1655 (see 5 papers)
ETEC_0869 DUF1471 domain-containing protein from Escherichia coli ETEC H10407
b0802 hypothetical protein (NCBI) from Escherichia coli str. K-12 substr. MG1655
Aligns to 34:86 / 86 (61.6%), covers 100.0% of PF07338, 60.9 bits
- The molecular basis for control of ETEC enterotoxin expression in response to environment and host
Haycocks, PLoS pathogens 2015 - “...C GT T A CCCTTG TC G CA ETEC_0680 rihA 941002 TGTGA TGAGTA TCAC G ETEC_0869 ybiJ 958866 TGTGT ACGAAA TCACA ETEC_0886/ETEC_0887 ybiS/ybiT 1128472 n.d. ( ETEC_1030 ) ( yccS ) 1205350 A GTGA TGTAGA TCACA ETEC_1101 ycgZ TG A GA TCGAGCA CACA 1263558 T T...”
- Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
King, Applied and environmental microbiology 2010 - “...ECs2359 ECs3396 ECs0128 ECs3328 ECs0503 ECs0880 ECs0927 ECs2042 b0802 b0847 b1438 b2530 b0124 b2466 b0449 ECs0512 ECs5566 ECs2316 ECs0252 b0459 b4458 b1610...”
- Global gene expression profiling of asymptomatic bacteriuria Escherichia coli during biofilm growth in human urine
Hancock, Infection and immunity 2007 - “...ybiJ ycfR yhcN ibpB bfd b3782 b3556 b3687 b4414 b2153 b0802 b1112 b3238 b3686 b3337 6,476 6,387 6,120 6,025 5,942 5,817 5,804 5,790 5,787 5,582 1.8 15.9 8.7 1.0...”
- Prominent roles of the NorR and Fur regulators in the Escherichia coli transcriptional response to reactive nitrogen species
Mukhopadhyay, Proceedings of the National Academy of Sciences of the United States of America 2004 - “...b2717 b0795 b1684 b0127 b4367 b2875 b3106 b4357 b2579 b0484 b3744 b4381 b3774 b0802 b2715 b1200 b1241 b1112 173 338 70 38 2 3 11 2 17 18 1 1 6 5 2 1 15 2 6 7...”
LQ47_22005 DUF1471 domain-containing protein from Klebsiella pneumoniae
Aligns to 35:91 / 91 (62.6%), covers 98.2% of PF07338, 59.3 bits
y0640 hypothetical protein (RefSeq) from Yersinia pestis KIM
Aligns to 48:103 / 103 (54.4%), covers 100.0% of PF07338, 56.9 bits
- Role of the PhoP-PhoQ gene regulatory system in adaptation of Yersinia pestis to environmental stress in the flea digestive tract
Vadyvaloo, Microbiology (Reading, England) 2015 - “...1998 ). The Y. pestis KIM6+ genome contained five YhcN protein family genes (y1667, y0666, y0640, y3909 and y2136) that encoded predicted proteins of 86, 87, 53, 92 and 317 amino acids, respectively. In E. coli , four of the 10 YhcN family proteins were shown...”
STM14_0428 DUF1471 domain-containing protein from Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
STM0366 putative periplasmic protein (NCBI ptt file) from Salmonella typhimurium LT2
STY0398 probable secreted protein (NCBI ptt file) from Salmonella enterica subsp. enterica serovar Typhi str. CT18
t2498 probable secreted protein (NCBI ptt file) from Salmonella enterica subsp. enterica serovar Typhi Ty2
Aligns to 37:89 / 91 (58.2%), covers 100.0% of PF07338, 56.8 bits
- Quantitative proteomic analysis of the Salmonella-lettuce interaction
Zhang, Microbial biotechnology 2014 - “...1.7E-02 1 Putative type II restriction enzyme methylase subunit D0ZU54 5.5 2.2E-03 1 Hypothetical protein STM14_0428 D0ZM36 yahO 5.7 1.9E-02 2 Hypothetical protein STM14_0454 D0ZM62 psiF 3.9 7.5E-04 4 Putative cytoplasmic protein D0ZVJ6 14.0 1.0E-04 2 Hypothetical protein STM14_1588 D0ZW41 spy 5.4 2.8E-02 3 Putative cytoplasmic...”
- Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
Eletsky, PloS one 2014 - “...and even lower similarity to other DUF1471 sequences apart from SssB. The Salmonella protein YahO (STM0366) from DUF1471 has not been characterized prior to the work presented here. YahO occurs in Salmonella, Escherichia , and numerous other genera from the Enterobacteriaceae. The yahO gene was identified...”
- “...the PSI Materials Repository ( http://psimr.asu.edu/ ). The sequence of YahO from Salmonella Typhimurium LT2 (STM0366) is identical to SC0077. The plasmids were transformed separately into E. coli BL21(DE3) pMgK cells and cultured in MJ9 medium [30] containing 2 g/L [ U - 13 C]-glucose and...”
- Global transcriptional analysis of dehydrated Salmonella enterica serovar Typhimurium
Gruzdev, Applied and environmental microbiology 2012 - “...aceK (STM4185) phoH (STM1126) minE (STM1816) yahO (STM0366) ybeL (STM0653) tke1 (STM_sRNA) STM1731 Putative acetyl coenzyme A synthetase 2-Methylcitrate...”
- Intraspecies variation in the emergence of hyperinfectious bacterial strains in nature
Heithoff, PLoS pathogens 2012 - “...[95] . STM1602 sifB 1.47 0.56 0.68 SPI-2 effector; translocated to macrophage cytoplasm [146] . STM0366 yahO 1.22 0.43 1.13 Modification of cell envelope [147] . STM0614 ybdQ 1.46 0.37 0.09 Universal stress protein [144] . PhoB/PhoR STM4287 phnO 0.16 1.43 0.96 Regulator of phosphocarbonate breakdown...”
- Quantitative mass spectrometry catalogues Salmonella pathogenicity island-2 effectors and identifies their cognate host binding partners
Auweter, The Journal of biological chemistry 2011 - “...STM2817 STM2444 STM2287 STM2780 STM1263 STM0781 STM3053 STM1119 STM1891 STM4561 STM1033 STM0366 STM1088 STM2892 11 5 4 9 9 14 26 6 4 10 13 14 3 12 2 3 9 8...”
- Transcriptomic study of Salmonella enterica subspecies enterica serovar Typhi biofilm
Chin, BMC genomics 2017 - “...5.00E-05 0.001837 yiiU FtsZ stabilizer 2.10309 5.00E-05 0.001837 cspB Cold shock protein 2.18312 5.00E-05 0.001837 STY0398 Propionate catabolism operon regulatory protein 2.29804 5.00E-05 0.001837 STY0788 Hypothetical protein 2.35255 5.00E-05 0.001837 osmE Osmotically inducible lipoprotein E 2.36034 5.00E-05 0.001837 tatE Sec-independent protein translocase protein TatE 2.41698 5.00E-05...”
- Prevalence and Characterization of Staphylococcus aureus in Growing Pigs in the USA
Sun, PloS one 2015 - “...of isolates (%) Number of herds ST9 t337 384 (32) 25 t3446 73 (6) 5 t2498 59 (5) 3 t2315 23 (2) 1 t1334 14 (1) 1 t2462 3 (0.3) 2 unknown 1 * 2 (0.2) 1 t10494 2 (0.2) 1 unknown 2 * 1 (0.1)...”
- “...single spa type, including six herds with ST9 variants [spa type t337 (5 herds) or t2498 (1 herd)], and 3 with ST398 variants [spa types t034 (2 herds); t5838 (1 herd)]. The most frequent scenario (15/37, 41%) was detection of two spa types in a herd,...”
YjfO / b4189 DUF1471 domain-containing putative lipoprotein BsmA from Escherichia coli K-12 substr. MG1655 (see 4 papers)
BSMA_ECOLI / P39297 Lipoprotein BsmA; Biofilm stress and motility protein from Escherichia coli (strain K12) (see paper)
NP_418610 DUF1471 domain-containing putative lipoprotein BsmA from Escherichia coli str. K-12 substr. MG1655
b4189 orf, hypothetical protein (VIMSS) from Escherichia coli str. K-12 substr. MG1655
Aligns to 53:108 / 109 (51.4%), covers 100.0% of PF07338, 54.3 bits
- function: Involved in protection of biofilms against oxidative stress.
disruption phenotype: Mutant exhibits reduced microcolony formation and greatly enhanced flagellar motility. Biofilms from the mutant strain are less able to resist acid and peroxide stresses. - A previously uncharacterized gene, yjfO (bsmA), influences Escherichia coli biofilm formation and stress response.
Weber, Microbiology (Reading, England) 2010 - GeneRIF: yjfO mutants are altered in biofilm structure and cell motility, and in their ability as biofilms to respond to pH and oxidative stresses.
- A previously uncharacterized gene, yjfO (bsmA), influences Escherichia coli biofilm formation and stress response
Weber, Microbiology (Reading, England) 2010 - “...the present study, we observed the uncharacterized gene yjfO (b4189) to be upregulated. This same gene has been found to be upregulated in at least two previous...”
- Genome-wide analysis of lipoprotein expression in Escherichia coli MG1655
Brokx, Journal of bacteriology 2004 - “...b2809 b2813 b2833 b2865 b2963 b3150 b3163 b3267 b3369 b3661 b4149 b4189 b4288 1,177.4 P 2,142.5 P 75 P 45.55 P 48.6 P 107.7 P 136.6 P 126.4 P 172.1 P 587.4...”
- DNA microarray analyses of the long-term adaptive response of Escherichia coli to acetate and propionate
Polen, Applied and environmental microbiology 2003 - “...b4188 yjfN 1 ORF, hypothetical protein 0.39* 0.50 0.67 b4189 yjfO 1 ORF, hypothetical protein 0.28* 0.40* 0.88 b4239 b4240 treC treB 1 1 Trehalase-6-phosphate...”
- Combined, functional genomic-biochemical approach to intermediary metabolism: interaction of acivicin, a glutamine amidotransferase inhibitor, with Escherichia coli K-12
Smulski, Journal of bacteriology 2001 - “...b3923 b3928 b3937 b3995 b4030 b4126 b4127 b4135 b4178 b4189 b4199 b4206 b4234 b4255 b4311 b4325 b4326 b2300 b2302 b2303 b2442 b2529 b2530 b2597 b2664 b2665...”
- “...b3861 b3875 b3923 b3928 b3937 b3995 b4030 b4126 b4127 b4135 b4178 b4189 b4199 b4206 b4234 b4255 b4311 b4325 b4326 3.2 3.6 2.8 2.2 2.1 2.7 23.6 3.2 4.7 2.6 2.1...”
ECs5165 hypothetical protein (NCBI) from Escherichia coli O157:H7 str. Sakai
S4614 hypothetical protein (RefSeq) from Shigella flexneri 2a str. 2457T
Aligns to 53:108 / 109 (51.4%), covers 100.0% of PF07338, 53.2 bits
- Influence of Glucose Availability and CRP Acetylation on the Genome-Wide Transcriptional Response of Escherichia coli: Assessment by an Optimized Factorial Microarray Analysis
Guebel, Frontiers in microbiology 2018 - “...as significant classes a set of four genes that codify periplasmic proteins with dodecin-like structure (ECs5165, ECs0884, ECs5164, ECs5175; FDR = 2.1 10 2 ) and another set of five genes which codify enzymes involved in L-arginine degradation ( astA [arginine N-succinyltransferase], astB [N-succinylarginine dihydrolase], astC...”
- Whole-Transcriptome Analysis of Verocytotoxigenic Escherichia coli O157:H7 (Sakai) Suggests Plant-Species-Specific Metabolic Responses on Exposure to Spinach and Lettuce Extracts
Crozier, Frontiers in microbiology 2016 - “...NS NS 4.87 ECs4976 x x Galactidol-1-phosphatol dehydrogenase, Citrobacter rodentium (92) NS NS NS 7.13 ECs5165 Biofilm stress and motility protein A, Shigella flexneri Shi06HN006 (99) -6.01 60.15 NS -7.03 Homologs in E. coli K-12 strain MG1655 and O157:H7 isolate EDL933 are indicated by or x...”
- In vitro transcription profiling of the σS subunit of bacterial RNA polymerase: re-definition of the σS regulon and identification of σS-specific promoter sequence elements
Maciag, Nucleic acids research 2011 - “...yddM ) N.A. 1.71 c0703 Unknown, annotated in CFT073 (antisense of citF ) N.A. 1.74 ECs5165 yjfO (biofilm-related protein) in O157:H7 SAKAI N.A. 1.86 IG1903284_1903567-r Intergenic region downstream of yobD , transcribed in opposite direction N.A. 1.87 IG3358642_3358810-f Intergenic region downstream of gltD N.A. 1.89 IG2190243_2190534-r...”
- Alcohol and the Intestine
Patel, Biomolecules 2015 - “...P. Epithelial crosstalk at the microbiota-mucosal interface Proc. Natl. Acad. Sci. USA 2011 108 S4607 S4614 10.1073/pnas.1000092107 20826446 56. Shulzhenko N. Morgun A. Hsiao W. Battle M. Yao M. Gavrilova O. Orandle M. Mayer L. Macpherson A.J. McCoy K.D. Crosstalk between B lymphocytes, microbiota and the...”
SEN0541 hypothetical secreted protein (RefSeq) from Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
SC0602 putative periplasmic protein (NCBI) from Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
Aligns to 25:78 / 78 (69.2%), covers 100.0% of PF07338, 52.5 bits
- Transcriptional Profiling and Molecular Characterization of the yccT Mutant Link: A Novel STY1099 Protein with the Peroxide Stress Response and Cell Division of Salmonella enterica Serovar Enteritidis
Vidovic, Biology 2019 - “...of the 22 genes, 13 genes ( narGHIJK , hycDF , dmsA3 , rrmJ , SEN0541, SEN1163, SEN1249 and SEN3184) were unique to the oxidative response, and nine genes ( citEFT , kdgT , nirC , yccT , SEN0167, SEN0271 and SEN0992) of the oxidative stimulon...”
- “...was a group of genes that encodes proteins of unknown function (SEN0167, SEN0271, SEN1163 and SEN0541). To investigate how the yccT gene deletion specifically affected the physiology of growing cells, we compared the transcriptomes of exponentially growing culture of the yccT mutant to that of the...”
- The addition of lac+ chromosome fragments to the E. coli proA-proB-lac deletion 13 chromosome
Stodolsky, Genetics 1972 (secret)
STM0565 putative periplasmic protein (NCBI ptt file) from Salmonella typhimurium LT2
Aligns to 25:78 / 78 (69.2%), covers 100.0% of PF07338, 52.5 bits
EDL933_0387 DUF1471 domain-containing protein from Escherichia coli O157:H7 str. EDL933
ECs0383 hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
Aligns to 37:89 / 91 (58.2%), covers 100.0% of PF07338, 51.5 bits
- Overexpressed Proteins in Hypervirulent Clade 8 and Clade 6 Strains of Escherichia coli O157:H7 Compared to E. coli O157:H7 EDL933 Clade 3 Strain
Amigo, PloS one 2016 - “...3.6808 0.0001 ECSP_5106 [TW14359] b 3.25 0.021 General secretion pathway protein G EDL933_p0034 3.2944 0.00078 EDL933_0387 3.14 0.00078 Type III secretion protein EscF 3.2944 0.021 YicS, putative secreted protein (EDL933_4982) 3.12 0.0001 Conserved phage protein EDL933_1401 3.1383 0.0001 Phage protein ECSP_2742 [TW14359] b 2.91 0.0001 Phage...”
- “...ECSP_5106 present in clade 8 and present but not annotated in EDL933 and Sakai; and EDL933_0387 are also overexpressed; as well as two putative exported proteins, YebF and YicS. YebF was found in the cell extract of the three stains tested in this study ( S2...”
- Physiological Response of Escherichia coli O157:H7 Sakai to Dynamic Changes in Temperature and Water Activity as Experienced during Carcass Chilling
King, Molecular & cellular proteomics : MCP 2016 - “.../ ECs2098 ), cell filamentation ( fic / ECs4212 ), and encoding hypothetical proteins ( ECs0383 , ECs0886 , ycaC / ECs0982 , ECs1692 , ECs2695 , ECs2785 , ECs2888 , ECs3588 , ECs4112 , yhfG / ECs4213 , ECs4323 , ysgA / ECs4760 , ECs5089...”
- Global transcriptional response of Escherichia coli O157:H7 to growth transitions in glucose minimal medium
Bergholz, BMC microbiology 2007 - “...dinJ 2.46 2 ECs0991 aroA -4.24 1 ECs0269 proB -2.11 1 ECs1007 mukB -2.12 1 ECs0383 yahO 4.53 2 ECs1013 asnS -2.74 1 ECs0384 prpR 3.63 2 ECs1014 pncB -2.37 1 ECs0390 codA -2.78 1 ECs1022 ycbR -3.16 1 ECs0415 afuA 5.21 2 ECs1048 - 2.44...”
ETAE_2188 hypothetical protein (RefSeq) from Edwardsiella tarda EIB202
Aligns to 33:89 / 89 (64.0%), covers 98.2% of PF07338, 50.6 bits
- Edwardsiella piscicida: A versatile emerging pathogen of fish
Leung, Virulence 2019 - “...6 ETAE_2186, Trxlp T3SS Thioredoxin-like, promote inflammasome NLRC4 activation [ 72 , 73 ] 7 ETAE_2188 T3SS Hypothetical protein [ 72 ] 8 ETAE_3282 T3SS Hypothetical protein [ 72 ] 9 ETAE_1303, EseL T6SS Major cold shock protein? [ 71 ] 10 ETAE_2316, EseM T6SS Major...”
- Systematic Identification of Intracellular-Translocated Candidate Effectors in Edwardsiella piscicida
Zhang, Frontiers in cellular and infection microbiology 2018 - “...on T6SS (Figure 2A ). Another eight candidate effectors, including ETAE_0247, ETAE_0275, ETAE_0490, ETAE_2080, ETAE_2186, ETAE_2188, ETAE_2399, and ETAE_2473, showed similar levels of secretion from the wild-type, T3SS mutant and T6SS mutant, indicating that their secretion is not dependent on either T3SS or T6SS (Figure 2B...”
Q1RFK1 DUF1471 domain-containing protein from Escherichia coli (strain UTI89 / UPEC)
UTI89_C0362 hypothetical protein (NCBI) from Escherichia coli UTI89
Aligns to 37:89 / 91 (58.2%), covers 100.0% of PF07338, 50.1 bits
- Adhesive fiber stratification in uropathogenic Escherichia coli biofilms unveils oxygen-mediated control of type 1 pili
Floyd, PLoS pathogens 2015 - “...chaperone protein, HdeB (UniProt KB Q1R595, m/z 9,064), and the uncharacterized protein YahO (UniProt KB Q1RFK1, m/z 7,718) were also identified ( Table 1 ). HdeB localized to the air-liquid interface and was most abundant towards the liquid-exposed surface, while YahO localized throughout the biofilm (...”
- “...Response Acid stress-response protein, HdeB Q1R595 12,522 aa133 / 3,475 Da 9,065 9,064 Uncharacterized YahO Q1RFK1 9,929 aa121 / 2,240 Da 7,707 7,718 *Predicted signal peptides obtained using the SignalP Server. # Observed average mass obtained from IMS analysis of one representative 48 hour UPEC biofilm....”
- Defining the phylogenomics of Shigella species: a pathway to diagnostics
Sahl, Journal of clinical microbiology 2015 - “...EcHS_A0402 HMPREF9530_02672 ECNG_01839 ECSTEC94C_0398 ECAA86_00424 ECSE_0359 UTI89_C0362 EIQ72748 EcSMS35_0562 0.98 0.98 0.97 0.86 0.9 0.96 0.99 0.98 0.97...”
B2G73_RS15900 biofilm peroxide resistance protein BsmA from Citrobacter werkmanii
Aligns to 53:108 / 109 (51.4%), covers 100.0% of PF07338, 50.0 bits
YahO / b0329 DUF1471 domain-containing protein YahO from Escherichia coli K-12 substr. MG1655 (see 3 papers)
b0329 hypothetical protein (NCBI) from Escherichia coli str. K-12 substr. MG1655
P75694 Uncharacterized protein YahO from Escherichia coli (strain K12)
ETEC_0386 DUF1471 domain-containing protein from Escherichia coli ETEC H10407
Aligns to 37:89 / 91 (58.2%), covers 100.0% of PF07338, 49.8 bits
- A Molecular Genetic Basis Explaining Altered Bacterial Behavior in Space
Zea, PloS one 2016 - “...16 genes, we have data for 15 (we did not find the expression of yahO (b0329) in the E . coli (DH10B) sequence that was downloaded from the UCSC genome browser), 12 of which were overexpressed (80%) in the spaceflight samples in between 2.10x and 24.76x....”
- Evolutionary dynamics of small RNAs in 27 Escherichia coli and Shigella genomes
Skippington, Genome biology and evolution 2012 - “...sdaC b2796 omrA 27 Core Incongruent No ompR b3405 omrA 27 Core Incongruent No yahO b0329 omrA 20 Variable Incongruent No dppB b3543 omrA 27 Core Incongruent No yjcH b4068 omrA 24 Variable Congruent No dppF b3540 omrA 27 Core Incongruent No fimA b4314 omrA 2...”
- Reconfiguring the quorum-sensing regulator SdiA of Escherichia coli to control biofilm formation via indole and N-acylhomoserine lactones
Lee, Applied and environmental microbiology 2009 - “...ompF expression Hypothetical yahK yahO ybaS b0325 b0329 b0485 5.7 7.0 7.5 2.6 2.8 2.3 Hypothetical zinc-type alcohol dehydrogenase-like protein Hypothetical...”
- Autoinducer 2 controls biofilm formation in Escherichia coli through a novel motility quorum-sensing regulator (MqsR, B3022)
González, Journal of bacteriology 2006 - “...b3717 b1511 b2252 b3143 b4217 b1160 b1257 b3690 b0513 b1258 b0329 b4068 b1443 yncG spf yjcO ymgB ymgC yeaQ amyA gatC b1454 b3864 b4078 b1166 b1167 b1795 b1927...”
- Parallel adaptive evolution cultures of Escherichia coli lead to convergent growth phenotypes with different gene expression states
Fong, Genome research 2005 - “...Hypothetical/putative None Annotated ppsA, yihK p=1- i=0 Glycerol b0329, b1266, b1678, b1934, b2302, b3021, b4109, proM, alaX, murA, prfC, psiF, rpsV, motA,...”
- SigmaS-dependent gene expression at the onset of stationary phase in Escherichia coli: function of sigmaS-dependent genes and identification of their promoter sequences
Lacour, Journal of bacteriology 2004 - “...(adherence) protein (b0232) Hypothetical protein (b0329) Hypothetical (inner membrane) protein (b0707) Putative enzyme (b0865) Hypothetical protein,...”
- Global analysis of genes regulated by EvgA of the two-component regulatory system in Escherichia coli
Nishino, Journal of bacteriology 2003 - “...b3512 b0867 b1597 b2359 b1492 b2390 b0897 b0329 b2358 b3514 b0485 b4242 b2371 Adaptation (starvation) Regulation Metabolism Adaptation (stress) Extrachromosomal...”
- Definition of the Escherichia coli MC4100 genome by use of a DNA array
Peters, Journal of bacteriology 2003 - “...b0309, b0317, b0319, b0320, b0321, b0322, b0326, b0327, b0329, b0332, b0334, b0335, b0347, b1137,a b1138, b1141, b1142, b1143, b1144, b1146, b1147, b1148,...”
- More
- Identification of specific protein amino acid substitutions of extended-spectrum β-lactamase (ESBL)-producing Escherichia coli ST131: a proteomics approach using mass spectrometry
Nakamura, Scientific reports 2019 - “...this study. The m/z 7655 peak was identified as uncharacterized protein YahO (Uniprot accession no. P75694) belonging to the Bhs/McbA family. The chain domain of the YahO protein was DUF1471, and its function is unknown. The m/z 8351 peak was identified as UPF0337 protein YjbJ (Uniprot...”
- Top-Down LESA Mass Spectrometry Protein Analysis of Gram-Positive and Gram-Negative Bacteria
Kocurek, Journal of the American Society for Mass Spectrometry 2017 - “...temperature -Met 978.9706 +6 5867.78 -2.0 YciG P21361 36 -Met 1101.2759 +7 7701.88 -1.5 YahO P75694 91 -signal peptide 1189.5904 +7 8320.08 -1.3 UPF0337 protein YjbJ a P68206 80 1254.2614 +7 8772.78 -2.2 YdfK P76154 31 1494.9477 +7 10,457.58 +1.02 Da YbgS P0AAV6 45 -signal peptide;...”
- Identification of RpoS (sigma(S))-regulated genes in Salmonella enterica serovar typhimurium
Ibanez-Ruiz, Journal of bacteriology 2000 - “...P37663 (YhjY), P07003 (PoxB), P76114 (YncC), P27250 (YjgB), P75694 (YahO), P39169 (YgaU), P31677 (OtsA), P77391 (YeaG), P21179 (KatE), P21362 (YciF), and P29013...”
- The molecular basis for control of ETEC enterotoxin expression in response to environment and host
Haycocks, PLoS pathogens 2015 - “...G C G TTCCACG TCACA (ETEC_0150) (hemL) 408885 TGTGA TCTCTC TC G CA ETEC_0385 / ETEC_0386 yahN / yahO 461874 TGTG CGCAAGA TCACA ETEC_0434 ddlA 463095 TT TG CGCGAGG TCACA (ETEC_0436) (phoA) 468009 A G G GA TCTGCG TCACA ETEC_0443 aroM 492973 ATC GA TTGCGT TCAC...”
LV106 hypothetical protein (RefSeq) from Klebsiella pneumoniae
Aligns to 34:86 / 86 (61.6%), covers 96.4% of PF07338, 49.6 bits
- Comparison of paenibacillus azotofixans strains isolated from rhizoplane, rhizosphere, and non-root-associated soil from maize planted in two different brazilian soils
Seldin, Applied and environmental microbiology 1998 - “...MRV100, MRV105, MRV106, MRV108, MRV111, MRV117 PV104, LV106, LV107, LV114, LV115, CRiP103, CRiP104, CRiP105, CRiP115, CRiP125, CRiP126, CRiP127, CRiP128,...”
- “...MSV55, MSV63, MSV66, MSV68, LV53, LV56, MSV108, LV106, MRV153, MRV154, MRV156, CRiP21, CRiL56, CSM56, CRiP57, CSM116, CRiL151, CRiP165 LV107, LV115, PV104,...”
EC042_RS01800 DUF1471 domain-containing protein from Escherichia coli 042
Aligns to 28:78 / 78 (65.4%), covers 91.1% of PF07338, 44.7 bits
RclB / b0303 DUF1471 domain-containing protein RclB from Escherichia coli K-12 substr. MG1655 (see 2 papers)
RCLB_ECOLI / P75687 Uncharacterized protein RclB; Reactive chlorine resistance protein B from Escherichia coli (strain K12) (see paper)
b0303 orf, hypothetical protein (VIMSS) from Escherichia coli str. K-12 substr. MG1655
Aligns to 28:78 / 78 (65.4%), covers 91.1% of PF07338, 40.9 bits
- function: Probably involved in reactive chlorine species (RCS) stress resistance.
disruption phenotype: Mutants are more sensitive to HOCl treatment than wild-type cells. - Elucidation of the antibacterial mechanism of the Curvularia haloperoxidase system by DNA microarray profiling
Hansen, Applied and environmental microbiology 2004 - “...0.3 1.3 0.2 0.2 0.3 0.5 0.1 0.5 0.9 b0301 b0302 b0303 b0304 b0305 a The loge ratio of transcript level 9 to 10 min after stress induction with the Curvularia...”
- Definition of the Escherichia coli MC4100 genome by use of a DNA array
Peters, Journal of bacteriology 2003 - “...ykgE, ykg, ykgH, b0279, b0280, b0295, b0298, b030, b0303, b0309, b0317, b0319, b0320, b0321, b0322, b0326, b0327, b0329, b0332, b0334, b0335, b0347, b1137,a...”
KP1_4563 hypothetical protein (RefSeq) from Klebsiella pneumoniae NTUH-K2044
Aligns to 34:81 / 81 (59.3%), covers 85.7% of PF07338, 32.7 bits
Or search for genetic data about PF07338 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory