Family Search for PF07510 (GmrSD_C)

PF07510 hits 54 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

NP_463839 similar to unknown protein from Listeria monocytogenes EGD-e
Aligns to 416:546 / 553 (23.7%), covers 97.8% of PF07510, 104.7 bits

• Actinomycete integrative and conjugative elements
  te, Antonie van Leeuwenhoek 2008
  • “...of AICE Sco 5349 (65% G + C) is 28% identical to a hypothetical protein (NP_463839) of the food-borne pathogen Listeria monocytogenes EGD-e. This indicates that AICEs may also mediate genetic exchange outside of the actinomycetes. However, database searches fail to identify clear AICE homologues in...”

cg0841 hypothetical protein from Corynebacterium glutamicum ATCC 13032
Aligns to 410:552 / 811 (17.6%), covers 99.3% of PF07510, 101.7 bits

• Ciprofloxacin triggered glutamate production by Corynebacterium glutamicum
  Lubitz, BMC microbiology 2016
  • “...protein 1.88 0.000 cg1978 - Hypothetical protein 1.72 0.000 cg1917 - Hypothetical protein 1.50 0.002 cg0841 - Conserved hypothetical protein 1.39 0.016 cg1743 - Conserved hypothetical protein 1.38 0.006 cg1937 - Putative secreted protein 1.22 0.015 cg3018 - Hypothetical protein 1.22 0.002 cg0451 - Putative membrane...”
  • “..., radA , lexA (autoregulation) and divS and several genes of unknown function (cg2381, cg2026, cg0841, cg1977) of the 48 genes of the LexA regulon were upregulated. As known for C. glutamicum and other bacteria, autoproteolytic cleavage of the transcriptional regulator LexA is induced by RecA...”
• The Zur regulon of Corynebacterium glutamicum ATCC 13032
  Schröder, BMC genomics 2010
  • “...sequence representing a regulatory gene region with a LexA binding site located in front of cg0841 [ 40 ] served as additional negative control. Likewise, Zur did not interact in vitro with the 21-bp motif located upstream of the adhA promoter region (Fig. 8A ). Furthermore,...”
  • “...The negative control assay was performed with a 40-mer deduced from the upstream region of cg0841. (B) , DNA band shift assays with mutated versions of the 40-mers. Mutated versions were generated by introducing transitions into the candidate Zur-binding sites or into the genomic flanking regions....”

c5426 Conserved hypothetical protein from Escherichia coli CFT073
Aligns to 409:550 / 557 (25.5%), covers 89.9% of PF07510, 97.7 bits

• The inner membrane protein YhiM links copper and CpxAR envelope stress responses in uropathogenic E. coli
  Saenkham-Huntsinger, mBio 2024
  • “...protein Cytosol ycjG c1797 Hypothetical protein Cytosol c5382 Hypothetical protein Cytosol c2508 Hypothetical protein Cytosol c5426 Conserved hypothetical protein Cytosol c5304 Putative conserved protein Cytosol c3171 Putative capsid protein of prophage Unknown ykfF c0279 Hypothetical protein Unknown c2748 Hypothetical protein Unknown c0293 Hypothetical protein Unknown c4303...”
• Pedigrees of some mutant strains of Escherichia coli K-12
  Bachmann, Bacteriological reviews 1972

Z5950 orf; conserved hypothetical protein from Escherichia coli O157:H7 EDL933
Aligns to 304:445 / 452 (31.4%), covers 90.6% of PF07510, 96.6 bits

• Cassette-like variation of restriction enzyme genes in Escherichia coli C and relatives
  Sibley, Nucleic acids research 2004
  • “...a PCR product across this gap, one primer in the Z5950 coding sequence (pMS4) and one primer in yjiX (pMS3) from E.coli C genomic DNA. Genes hpaC and hpaB...”
  • “...sequence. dDesignation is from E.coli CFT073 sequence; the Z5950 sequence found in C and CFT073 represents a fusion of the coding sequences designated Z4949...”

SCO5329 hypothetical protein from Streptomyces coelicolor A3(2)
Aligns to 412:541 / 565 (23.0%), covers 94.9% of PF07510, 94.6 bits

• Expression of genes of the Pho regulon is altered in Streptomyces coelicolor
  Millan-Oropeza, Scientific reports 2020
  • “...all time points on both carbon sources (Fig. S3 ). Interestingly the genes sco6638 , sco5329 and sco0324 encoding putative endonuclease or nucleosidase are present and expressed in SC but absent or truncated in the SL . The abundance of these proteins in SC suggests the...”
• Actinomycete integrative and conjugative elements
  te, Antonie van Leeuwenhoek 2008
  • “...proteins (ZP_01980106; ZP_01705385) of the -proteobacteria Vibrio cholerae MZO-2 and Shewanella putrefaciens 200. The gene SCO5329 (52% G + C) of AICE Sco 5349 (65% G + C) is 28% identical to a hypothetical protein (NP_463839) of the food-borne pathogen Listeria monocytogenes EGD-e. This indicates that...”

jhp0462 putative from Helicobacter pylori J99
Aligns to 404:538 / 706 (19.1%), covers 99.3% of PF07510, 93.3 bits

• Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori
  Saunders, BMC genomics 2005
  • “...159 176 49 121 hypothetical protein HP0058 JHP0051 394 16 53 122 hypothetical protein HP0513 JHP0462 104 28 15 125 type I restriction enzyme M protein (hsdM) HP1403 JHP1423 299 340 44 132 hypothetical protein HP0731 JHP0668 110 80 32 139 hypothetical protein HP0508 JHP0458 84...”
  • “...protein JHP0336 HP1089 27 54 53 hypothetical protein JHP0940 NAH 39 393 54 hypothetical protein JHP0462 HP0513 104 11 55 type II restriction enzyme (methyltransferase) JHP1409 NAH 37 15 58 hypothetical protein JHP1285 HP1371 55 25 59 hypothetical protein JHP0693 HP0756 19 1490 62 cag pathogenicity...”

HP0513 hypothetical protein from Helicobacter pylori 26695
Aligns to 359:493 / 658 (20.5%), covers 99.3% of PF07510, 92.5 bits

• Riboregulation in the Major Gastric Pathogen Helicobacter pylori
  Tejada-Arranz, Frontiers in microbiology 2021
  • “...asRNA Hp1116 Sharma et al. (2010) HPnc6000 asRNA Hp1116 Sharma et al. (2010) HPnc2450 asRNA Hp0513 Sharma et al. (2010) HPnc1470 asRNA Hp0357 Sharma et al. (2010) HPnc7450 asRNA HPr06 Sharma et al. (2010) HPnc3320 asRNA Hp0660 Sharma et al. (2010) HPnc1810 asRNA Hp0423 Sharma et...”
• Alteration of the Helicobacter pylori membrane proteome in response to changes in environmental salt concentration
  Voss, Proteomics. Clinical applications 2015
  • “...D7FCG9 NA 1.78 Outer membrane protein HopQ HP1177 HPB8_729 D7FDN0 NA 1.78 Putative uncharacterized protein HP0513 HPB8_1047 * D7FEJ7 NA 1.78 Putative uncharacterized protein HP0836|HP0837 HPB8_972 * D7FEC2 NA 1.77 Putative uncharacterized protein HP0764 HPB8_24 D7FBM4 oxidation-reduction process 1.75 Riboflavin biosynthesis protein (RibG) HP1505 HPB8_375 *...”
• Using macro-arrays to study routes of infection of Helicobacter pylori in three families
  Raymond, PloS one 2008
  • “...HP0483+ pseudo HP0489 hypothetical protein HP0492 neuraminyl-lactose binding hemagglutinin HP0503 hypothetical protein HP0505 hypothetical protein HP0513 hypothetical protein HP0519 hypothetical protein HP0522 cag pathogenicity island protein (cag3) HP0523 cag pathogenicity island protein (cag4) HP0524 cag pathogenicity island protein (cag5) HP0525 virB11 homolog HP0526 cag pathogenicity island...”
• Requirement of histidine kinases HP0165 and HP1364 for acid resistance in Helicobacter pylori
  Loh, Infection and immunity 2006
  • “...HP0109 HP0110 HP0129 HP0148 HP0225 HP0294 HP0460 HP0490 HP0513 HP0642 HP0668 HP0682 HP0708 HP0723 HP0807 HP0900 HP0948 HP1019 HP1104 HP1203 HP1238 HP1317 HP1329...”
  • “...HP0109 HP0110 HP0118 HP0119 HP0148 HP0225 HP0294 HP0490 HP0513 HP0531 HP0668 HP0708 HP0723 HP0756 HP0772 HP0807 HP0900 HP0948 HP1001 HP1019 HP1084 HP1192 HP1203...”
• Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori
  Saunders, BMC genomics 2005
  • “...JHP0723 159 176 49 121 hypothetical protein HP0058 JHP0051 394 16 53 122 hypothetical protein HP0513 JHP0462 104 28 15 125 type I restriction enzyme M protein (hsdM) HP1403 JHP1423 299 340 44 132 hypothetical protein HP0731 JHP0668 110 80 32 139 hypothetical protein HP0508 JHP0458...”
  • “...JHP0336 HP1089 27 54 53 hypothetical protein JHP0940 NAH 39 393 54 hypothetical protein JHP0462 HP0513 104 11 55 type II restriction enzyme (methyltransferase) JHP1409 NAH 37 15 58 hypothetical protein JHP1285 HP1371 55 25 59 hypothetical protein JHP0693 HP0756 19 1490 62 cag pathogenicity island...”
• Global analysis of Helicobacter pylori gene expression in human gastric mucosa
  Graham, Gastroenterology 2002
  • “...b Hypothetical protein HP1432 Histidine- and glutamine-rich protein HP0513 Hypothetical protein HP1452 Thiophene and furan oxidizer ( tdhF ) HP0601 b Flagellin...”

HPB8_729 DUF262 and DUF1524 domain-containing protein from Helicobacter pylori B8
D7FDN0 DUF262 domain-containing protein from Helicobacter pylori (strain B8)
Aligns to 407:541 / 687 (19.7%), covers 100.0% of PF07510, 92.1 bits

• Alteration of the Helicobacter pylori membrane proteome in response to changes in environmental salt concentration
  Voss, Proteomics. Clinical applications 2015
  • “...Putative uncharacterized protein comL HP1378 HPB8_319 * D7FCG9 NA 1.78 Outer membrane protein HopQ HP1177 HPB8_729 D7FDN0 NA 1.78 Putative uncharacterized protein HP0513 HPB8_1047 * D7FEJ7 NA 1.78 Putative uncharacterized protein HP0836|HP0837 HPB8_972 * D7FEC2 NA 1.77 Putative uncharacterized protein HP0764 HPB8_24 D7FBM4 oxidation-reduction process 1.75...”
• Alteration of the Helicobacter pylori membrane proteome in response to changes in environmental salt concentration
  Voss, Proteomics. Clinical applications 2015
  • “...uncharacterized protein comL HP1378 HPB8_319 * D7FCG9 NA 1.78 Outer membrane protein HopQ HP1177 HPB8_729 D7FDN0 NA 1.78 Putative uncharacterized protein HP0513 HPB8_1047 * D7FEJ7 NA 1.78 Putative uncharacterized protein HP0836|HP0837 HPB8_972 * D7FEC2 NA 1.77 Putative uncharacterized protein HP0764 HPB8_24 D7FBM4 oxidation-reduction process 1.75 Riboflavin...”

alr5159 unknown protein from Nostoc sp. PCC 7120
Aligns to 189:334 / 341 (42.8%), covers 98.6% of PF07510, 91.8 bits

• The insertion sequences of Anabaena sp. strain PCC 7120 and their effects on its open reading frames
  Wolk, Journal of bacteriology 2010
  • “...fuses the start of alr5156 and the end of alr5159 and that has homologs in diverse cyanobacteria and other bacteria. BLASTn shows that IS(all7002, all7001) can...”

K747_06625 DUF262 and DUF1524 domain-containing protein from Helicobacter pylori UM298
Aligns to 407:541 / 689 (19.6%), covers 99.3% of PF07510, 88.6 bits

• Immunometabolism in biofilm infection: lessons from cancer
  Mirzaei, Molecular medicine (Cambridge, Mass.) 2022
  • “...that seem to be correlated with biofilm production. Indeed, three hypothetical genes (K74_10375, K747_09130, and K747_06625) were remarkably associated with biofilm production (Wong et al. 2016 ). K747_06625 is prognosticated to hold a homing endonuclease and a ParB-like domain, the latter of which is correlated with...”
• Biophysical characterization of the homodimers of HomA and HomB, outer membrane proteins of Helicobacter pylori
  Tamrakar, Scientific reports 2021
  • “...globular domain likely contributes to dimer formation. Some of the hypothetical proteins (K74_10375, K747_09130, and K747_06625) and outer membrane protein is associated with biofilm formation, HomD, a member of Hom OMP family is associated with moderate biofilm former (58.3%) to hyper biofilm former (66.7%) H. pylori...”
• Helicobacter pylori Biofilm Formation and Its Potential Role in Pathogenesis
  Hathroubi, Microbiology and molecular biology reviews : MMBR 2018
  • “...Indeed, three hypothetical genes (K74_10375, K747_09130, and K747_06625) were significantly correlated with biofilm formation (34). K747_06625 is predicted to...”
  • “...formation by H. pylori Gene K74_10375 K747_09130 K747_06625 fucT homD cagA Gene product Hypothetical gene Hypothetical gene Hypothetical gene...”
• Comparative Genomics Revealed Multiple Helicobacter pylori Genes Associated with Biofilm Formation In Vitro
  Wong, PloS one 2016
  • “...95C, 5min; 35x (95C, 30s; 57C, 30s; 72C, 1min); 72C, 7min Reverse: AGCTCCAAAAGAGGGGTAGC hypothetical protein K747_06625 Forward: GGCTCACCACTATACCGCTT 1089 95C, 5min; 35x (95C, 30s; 57C, 30s; 72C, 1min); 72C, 7min Reverse: TGACCGGCTCTTTTGTGTCA outer membrane protein ( homD ) Forward: GACGCTCAAGGCAAGGTAGT 1409 95C, 5min; 35x (95C, 30s;...”
  • “...forming strains, with 3 hypothetical genes (Hypothetical protein K747_10375, Hypothetical protein K747_09130 and Hypothetical protein K747_06625) and 4 functional genes (flagellar protein, cag pathogenicity island protein, outer membrane protein ( homD ) and alpha-(1,3)- fucosyltransferase) were identified to be significantly correlating with capability of forming biofilm...”

Arch_1061 HNH endonuclease family protein from Arcanobacterium haemolyticum DSM 20595
Aligns to 99:239 / 244 (57.8%), covers 99.3% of PF07510, 88.2 bits

• Arcanolysin is a cholesterol-dependent cytolysin of the human pathogen Arcanobacterium haemolyticum
  Jost, BMC microbiology 2011
  • “...transcriptional terminator with a G = -18.05 kcal/mol. Downstream of aln and divergently transcribed is Arch_1061. The Arch_1061 protein displays amino acid similarity to hypothetical proteins from a number of genome sequences, including Corynebacterium jeikeium (GenBank YP_249820.1 ), and features a signal sequence. Further downstream is...”

jhp1302 putative from Helicobacter pylori J99
Aligns to 6:180 / 201 (87.1%), covers 63.8% of PF07510, 86.6 bits

• The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
  Kao, Frontiers in microbiology 2017
  • “...1.78 *** /3.24 jhp1049 b Putative 3.53 *** /2.94 jhp1242 HP1322 Putative 2.60 ** /2.48 jhp1302 HP1409 Putative 2.83 ns /2.70 jhp1332 HP1439 Putative 1.85 ns /1.23 jhp1333 HP1440 Putative 7.22 *** /11.63 jhp1430 HP1397 Putative 3.23 *** /2.97 jhp1431 HP1396 Putative 3.74 *** /4.12 jhp1436...”
• Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
  Romo-González, Infection and immunity 2009
  • “...N/A, N/A, N/A, N/A, JHP0925 HP0992, N/A HP1409, JHP1301, JHP1302 HP1410, JHP1303 HP0425, N/A HP0674, N/A (absent in all cancer isolates) N/A, JHP0940 (absent in...”
• Identification of target genes regulated by the two-component system HP166-HP165 of Helicobacter pylori
  Dietz, Journal of bacteriology 2002
  • “...are split into two separate ORFs (JHP1301 and JHP1302, JHP1304 and JHP1305, and JHP1306 and JHP1307, respectively). The ORFs adjacent to the operons HP1408...”

HPF57_0653 DUF262 domain-containing protein from Helicobacter pylori F57
Aligns to 414:547 / 682 (19.6%), covers 98.6% of PF07510, 84.7 bits

• Genome-wide association study of gastric cancer- and duodenal ulcer-derived Helicobacter pylori strains reveals discriminatory genetic variations and novel oncoprotein candidates
  Tuan, Microbial genomics 2021
  • “...HP1247 4.1 1111855 HPF57_1042 [1111772 1112203] (+) hemX haem interaction C 84 HP0375 4.1 686823 HPF57_0653 [686461688509] (+) mdr modification-specific restriction restriction C 363 no ortholog position in F57 reference genome. We also conducted a SNP-GWAS using another programme, pyseer, which can adjust for population structure,...”

jhp0572 putative from Helicobacter pylori J99
Aligns to 414:547 / 683 (19.6%), covers 98.6% of PF07510, 84.5 bits

• The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
  Kao, Frontiers in microbiology 2017
  • “...OR UNKNOWN FUNCTION jhp0436 HP0484 Putative 3.38 *** /2.45 jhp0550 HP0603 Putative 2.17 *** /2.24 jhp0572 HP0629 Putative 1.54 * /3.54 jhp0753 HP0817 Putative 1.54 *** /1.69 jhp0936 b Putative 1.78 *** /3.24 jhp1049 b Putative 3.53 *** /2.94 jhp1242 HP1322 Putative 2.60 ** /2.48 jhp1302...”
• Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
  Romo-González, Infection and immunity 2009
  • “...pepA, HP0570, JHP0517 aspS, HP0617, JHP0560 N/A, HP0629, JHP0572 N/A, HP0698, N/A N/A, HP0704, N/A fecA, fecA_2, HP0807, JHP0743 omp19, babB, HP0896, JHP1164...”

HP1409 hypothetical protein from Helicobacter pylori 26695
HP0426 hypothetical protein from Helicobacter pylori 26695
Aligns to 400:557 / 578 (27.3%), covers 62.3% of PF07510, 82.8 bits

• A Helicobacter pylori flagellar motor accessory is needed to maintain the barrier function of the outer membrane during flagellar rotation
  Rosinke, PLoS pathogens 2025
  • “...and the basal disk protein FlgP in a high-throughput yeast two-hybrid screen [ 30 ]. HP1409 and HP0426 are predicted cytoplasmic proteins and are unlikely to interact with FapH within the context of the flagellar basal body. To identify additional FapH interaction partners, we expressed a...”
• The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
  Kao, Frontiers in microbiology 2017
  • “...*** /3.24 jhp1049 b Putative 3.53 *** /2.94 jhp1242 HP1322 Putative 2.60 ** /2.48 jhp1302 HP1409 Putative 2.83 ns /2.70 jhp1332 HP1439 Putative 1.85 ns /1.23 jhp1333 HP1440 Putative 7.22 *** /11.63 jhp1430 HP1397 Putative 3.23 *** /2.97 jhp1431 HP1396 Putative 3.74 *** /4.12 jhp1436 HP1391...”
• Association between Helicobacter pylori cagA-related genes and clinical outcomes in Colombia and Japan
  Watada, BMC gastroenterology 2011
  • “...file 1 . Among the 37 genes, the status of 9 genes (hp0186, hp0713, hp0967, hp1409, hp1410, jhp0045, jhp0046, jhp0950 , and jhp0951 ) were significantly correlated with the cagA status in our microarray data [ 18 ] (P = 0.026, 0.026, 0.014, 0.048, 0.030, 0.033,...”
• New implications on genomic adaptation derived from the Helicobacter pylori genome comparison
  Lara-Ramírez, PloS one 2011
  • “...of beta bands. The interactions with three proteins HP0887 (vacuolating cytotoxin precursor), HP0588 (ferrodoxin-like protein), HP1409 (hypothetical protein) was demonstrated by two-hybrid test [60] . HP1580, an uncharacterized protein and its H. pylori homologs in other H. pylori strains have been annotated in two sizes in...”
• Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
  Romo-González, Infection and immunity 2009
  • “...N/A, N/A, N/A, N/A, N/A, N/A, JHP0925 HP0992, N/A HP1409, JHP1301, JHP1302 HP1410, JHP1303 HP0425, N/A HP0674, N/A (absent in all cancer isolates) N/A, JHP0940...”
  • “...two-component system confers urease-independent acid adaptation. The HP1409 and HP1410 genes, of unknown function, were also less frequent in cancer isolates...”
• Identification of a genetic marker of Helicobacter pylori strains involved in gastric extranodal marginal zone B cell lymphoma of the MALT-type
  Lehours, Gut 2004
  • “...JHP961* JHP1297 JHP1409 JHP1462 HP322 HP476 HP1105 HP1116 HP1371 HP1409 HP1402 None None None None None None None None None None None Putative poly E-rich...”
• Identification of target genes regulated by the two-component system HP166-HP165 of Helicobacter pylori
  Dietz, Journal of bacteriology 2002
  • “...(PCR amplified with primer pair 1187-5-1187-3) and HP1409 (PCR amplified with primer pair 1409-5-1409-3), respectively. RNA isolation. RNA was prepared as...”
  • “...(9) and a 504-bp PstI-SacI fragment derived from ORF HP1409 which was obtained by PCR performed with primer pair HP1409-5-HP1409-3 on chromosomal DNA of H....”
• A Helicobacter pylori flagellar motor accessory is needed to maintain the barrier function of the outer membrane during flagellar rotation
  Rosinke, PLoS pathogens 2025
  • “...basal disk protein FlgP in a high-throughput yeast two-hybrid screen [ 30 ]. HP1409 and HP0426 are predicted cytoplasmic proteins and are unlikely to interact with FapH within the context of the flagellar basal body. To identify additional FapH interaction partners, we expressed a c-Myc-tagged FapH...”
• High-Salt Conditions Alter Transcription of Helicobacter pylori Genes Encoding Outer Membrane Proteins
  Loh, Infection and immunity 2018
  • “...HP0219 HP0213 HP0157 HP0135 HP0113 HP0112 HP0054 HP0427 HP0426 HP0426 HP0036 HP0025 HP0016 HP0015 HP1564 HP1541 HP1399 Gene name or function Membrane protein...”
• Screening Helicobacter pylori genes induced during infection of mouse stomachs
  Singh, World journal of gastroenterology 2012
  • “...Ycf5 F Ycf5 R HP0423 F HP0423 R HP0424 F HP0424 R HP0426 F HP0426 R HP0427 F HP0427 R Table 2 Primers used in this study Genes Primer sequences 5'-3' HP1 HP2A...”
  • “...Type IV secretion system Predicted coding region HP0426 Predicted coding region HP0427 Predicted coding region HP0423 Predicted coding region HP0424 Motility...”
• Using macro-arrays to study routes of infection of Helicobacter pylori in three families
  Raymond, PloS one 2008
  • “...HP0414 IS200 insertion sequence from SARA17 HP0423 hypothetical protein HP0424 hypothetical protein HP0425 hypothetical protein HP0426 hypothetical protein HP0428 phage/colicin/tellurite resistance cluster terY protein HP0431 protein phosphatase 2C homolog (ptc1) HP0432 protein kinase C-like protein HP0433 hypothetical protein HP0434 hypothetical protein HP0436 hypothetical protein HP0437 IS605...”
• Characterization of the ArsRS regulon of Helicobacter pylori, involved in acid adaptation
  Pflock, Journal of bacteriology 2006
  • “...HP0081 HP0118 HP0120 HP0242* HP0305 HP0307* HP0423 HP0425 HP0426 HP0641 HP0731 HP0733 HP0963 HP0964 HP1154 HP1187 HP1188 HP1223 HP1408 HP1412 JHP0110 JHP0227...”

HP0629 hypothetical protein from Helicobacter pylori 26695
Aligns to 413:546 / 681 (19.7%), covers 98.6% of PF07510, 82.7 bits

• Helicobacter pylori Modulates Heptose Metabolite Biosynthesis and Heptose-Dependent Innate Immune Host Cell Activation by Multiple Mechanisms
  Hauke, Microbiology spectrum 2023
  • “...2.2 0 HP0602 ( magIII ) 333.82 1.77 3.42 4.91E10 HP0603 80.49 1.86 3.64 2.29E03 HP0629 54.18 0.95 1.94 8.87E05 HP0715 556.56 1.71 3.27 0 HP0751 ( flaG ) 1,284.04 2.40 5.29 0 HP0752 ( fliD ) 688.1 1.59 3.01 0 HP0753 ( fliS ) 270.58...”
• The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
  Kao, Frontiers in microbiology 2017
  • “...UNKNOWN FUNCTION jhp0436 HP0484 Putative 3.38 *** /2.45 jhp0550 HP0603 Putative 2.17 *** /2.24 jhp0572 HP0629 Putative 1.54 * /3.54 jhp0753 HP0817 Putative 1.54 *** /1.69 jhp0936 b Putative 1.78 *** /3.24 jhp1049 b Putative 3.53 *** /2.94 jhp1242 HP1322 Putative 2.60 ** /2.48 jhp1302 HP1409...”
• Comparative genomic analysis of East Asian and non-Asian Helicobacter pylori strains identifies rapidly evolving genes
  Duncan, PloS one 2013
  • “...HP0635 hypothetical protein Hypothetical Conserved HP0897 hypothetical protein Hypothetical Conserved HP0398 hypothetical protein Hypothetical Conserved HP0629 hypothetical protein Hypothetical Conserved HP0973 hypothetical protein Hypothetical Conserved HP0167 hypothetical protein Hypothetical Conserved HP0120 hypothetical protein Hypothetical Conserved HP0583 hypothetical protein Hypothetical Conserved HP0119 hypothetical protein Hypothetical Conserved HP0681...”
• Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
  Romo-González, Infection and immunity 2009
  • “...N/A pepA, HP0570, JHP0517 aspS, HP0617, JHP0560 N/A, HP0629, JHP0572 N/A, HP0698, N/A N/A, HP0704, N/A fecA, fecA_2, HP0807, JHP0743 omp19, babB, HP0896,...”

jhp0957 putative from Helicobacter pylori J99
Aligns to 14:172 / 200 (79.5%), covers 91.3% of PF07510, 81.6 bits

• Role of Helicobacter pylori plasticity region genes in development of gastroduodenal diseases
  Sugimoto, Journal of clinical microbiology 2012
  • “...of H. pylori (i.e., jhp0915 [100%], jhp0955 [94%], and jhp0957 [94%]). Genes found in less than 20% include jhp0914 (17%), jhp0925 (19%), jhp0926 (19%), and...”
• Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis
  Yamaoka, Journal of medical microbiology 2008
  • “...Strains hybridized/positive (%) NIH-PA Author Manuscript jhp0954 63 jhp0955 94 jhp0956 86 jhp0957 94 jhp0958 72 jhp0959 13 jhp0960 38 jhp0961 44 NIH-PA Author...”
• Genetic analysis of Helicobacter pylori strain populations colonizing the stomach at different times postinfection
  Salama, Journal of bacteriology 2007
  • “...2007 3839 Genomic locus Between HP0160 and HP0162c Between JHP0957 and JHP0960 Between HP0879 and HP0883 (ruvA)c Between HP0961 and HP0963c HPAG1 Clade 2b NAd...”
• Global analysis of Helicobacter pylori gene expression in human gastric mucosa
  Graham, Gastroenterology 2002
  • “...HP1250 JHP0044 JHP0956 HP0167 HP0489 HP0800 HP1258 JHP0164 JHP0957 HP0168 HP0562 HP0882 HP1259 JHP0165 JHP0958 e HP0188 HP0579 HP0972 HP1264 JHP0318 JHP0959...”

VC0395_A1364 hypothetical protein from Vibrio cholerae O395
Aligns to 512:655 / 663 (21.7%), covers 99.3% of PF07510, 77.3 bits

• Vibrio cholerae pathogenicity island 2 encodes two distinct types of restriction systems
  Vizzarro, Journal of bacteriology 2024
  • “...GmrSD fusion proteins ( 53 ). Notably, the TgvB homolog from classical biotype V. cholerae (VC0395_A1364) was also identified as a GmrSD homolog in this study ( 53 ). These double domain forms of GmrSD function as modification-dependent type IV restriction enzymes, and are known to...”
• Vibrio choleraepathogenicity island 2 encodes two distinct types of restriction systems
  Vizzarro, 2024

VC1766 conserved hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 512:655 / 663 (21.7%), covers 99.3% of PF07510, 77.3 bits

• A <i>Vibrio cholerae</i> Type IV restriction system targets glucosylated 5-hydroxymethylcytosine to protect against phage infection
  Gomez, Journal of bacteriology 2024 (secret)
• Vibrio choleraepathogenicity island 2 encodes two distinct types of restriction systems
  Vizzarro, 2024
• Vibrio cholerae pathogenicity island 2 encodes two distinct types of restriction systems
  Vizzarro, Journal of bacteriology 2024
  • “...ype I-embedded G mrSD-like system of V PI-2, tgvA ( VC1767 ) and tgvB ( VC1766 ). Interestingly, the strain carrying only the tgvAB genes showed significantly less protection (between 10- and 100-fold reduction) against several tested phages compared to the strain harboring the entire gene...”
  • “...Bioinformatic analysis of the TgvAB system revealed that TgvA ( VC1767 ) and TgvB ( VC1766 ) both possess an N-terminal DUF262 domain, while TgvB additionally contains a C-terminal DUF1524 domain ( Fig. 4a and b ). Interestingly, previous work by Machnicka et al. found that...”
• Impact of Gene Repression on Biofilm Formation of Vibrio cholerae
  Pombo, Frontiers in microbiology 2022
  • “...VC1714-1717 VC1714 Cell division protein MukB, chromosome partition protein 1 VC1718 Hypothetical protein 6 VC1766-1769 VC1766 Hypothetical protein 2 VC1768 Hypothetical protein 1 VC1769 DNA methylase HsdM; type I restriction enzyme M protein 1 VC1784 Neuraminidase, sialidase 1 VC1832 Hypothetical protein 2 VC1911 Orotidine 5-phosphate decarboxylase...”

HPYLSS1_01469 DUF262 domain-containing protein from Helicobacter pylori SS1
Aligns to 395:577 / 584 (31.3%), covers 93.5% of PF07510, 76.9 bits

• Helicobacter pylori Biofilm Involves a Multigene Stress-Biased Response, Including a Structural Role for Flagella
  Hathroubi, mBio 2018
  • “...protein homD 3.26 HPYLSS1_01113 Putative outer membrane protein 2.91 HPYLSS1_01021 Outer membrane protein homC 2.69 HPYLSS1_01469 Putative outer membrane protein 2.52 Cellular processes cagE (HPYLSS1_00705) Type IV secretion system protein VirB4/DNA transfer 2.46 cagW (HPYLSS1_00718) cag pathogenicity island protein CagW ( cag10 ) 2.31 cagL (HPYLSS1_00710)...”

CLOLEP_00167 hypothetical protein from Clostridium leptum DSM 753
Aligns to 98:237 / 252 (55.6%), covers 100.0% of PF07510, 73.6 bits

• Analysis of complete genomes of Propionibacterium acnes reveals a novel plasmid and increased pseudogenes in an acne associated strain
  Kasimatis, BioMed research international 2013
  • “...the abortive infection defense system is ORF PAGK_0182. It is a hypothetical protein homologous to CLOLEP_00167 in C. leptum . As described above, the plasmid pIMPLE-HL096PA1 contains a cluster of genes with high similarities to C. leptum DSM753 genes CLOLEP_00122CLOLEP_00166, while the homolog of CLOLEP_00167 lies...”

B8F899 DUF262 domain-containing protein from Glaesserella parasuis serovar 5 (strain SH0165)
Aligns to 412:548 / 680 (20.1%), covers 97.1% of PF07510, 72.3 bits

• Transcriptomics of Haemophilus (Glässerella) parasuis serovar 5 subjected to culture conditions partially mimetic to natural infection for the search of new vaccine antigens.
  Álvarez-Estrada, BMC veterinary research 2018
  • “...protein P CP HAPS_RS09000 hypothetical protein B8F7Q0 |HAPS_1850|Uncharacterized protein P IM HAPS_RS10195 DUF262 domain-containing protein B8F899 |HAPS_2100|Uncharacterized protein P CP HAPS_RS10530 TolC family protein tolC B8F8F2 |tolC|RND efflux system outer membrane lipoprotein/RND superfamily resistance-nodulation-cell division antiporter P OM HAPS_RS10585 ligand-gated channel B8F8G2 |hxuC|Heme/hemopexin utilization protein C/outer...”
  • “...domain HAPS_RS07950 CP Domain of the Thioredoxin-like superfamily HAPS_RS09000 B8F7Q0 IM Homology with permease HAPS_RS10195 B8F899 CP ParB-like and HNH nuclease domains The locus in the reference genome (SH0165 strain) is also indicated. a indicates that this was a single protein recognized as two different ones...”

HP0186 hypothetical protein from Helicobacter pylori 26695
Aligns to 247:392 / 404 (36.1%), covers 97.8% of PF07510, 71.3 bits

• AI-2 Induces Urease Expression Through Downregulation of Orphan Response Regulator HP1021 in Helicobacter pylori
  Yang, Frontiers in medicine 2022
  • “...1.2716 HP0605 Membrane protein 1.2728 HP1400 Iron(III) dicitrate transport protein FecA 1.2869 HP1238 Formamidase 1.2907 HP0186 Hypothetical protein 1.2945 HP0753 Flagellar biosynthesis protein FliS 1.3035 HP0455 Pseudogene 1.3066 HP0607 Multidrug resistance protein 1.3128 HP0808 Holo-[acyl-carrier-protein] synthase 1.3146 HP0939 Amino acid ABC transporter permease 1.3303 HP1166 Glucose-6-phosphate...”
• Association between Helicobacter pylori cagA-related genes and clinical outcomes in Colombia and Japan
  Watada, BMC gastroenterology 2011
  • “...shown in additional file 1 . Among the 37 genes, the status of 9 genes (hp0186, hp0713, hp0967, hp1409, hp1410, jhp0045, jhp0046, jhp0950 , and jhp0951 ) were significantly correlated with the cagA status in our microarray data [ 18 ] (P = 0.026, 0.026, 0.014,...”
• Using macro-arrays to study routes of infection of Helicobacter pylori in three families
  Raymond, PloS one 2008
  • “...HP0108 hypothetical protein HP0113+ hypothetical protein HP0129 hypothetical protein HP0167 hypothetical protein HP0174 hypothetical protein HP0186 hypothetical protein HP0197+ S-adenosylmethionine synthetase 2 (metX) HP0205 hypothetical protein HP0208 lipopolysaccharide 1,2-glucosyltransferase (rfaJ) (frameshift) HP0217 cgtA, 14 N acetyl galactosamine transferase HP0236 hypothetical protein HP0241 hypothetical protein HP0246+ flagellar...”
• Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori
  Saunders, BMC genomics 2005
  • “...39 46 histidine and glutamine-rich metal-binding protein HP1432 JHP1321 15 9 1432 47 hypothetical protein HP0186 JHP0174 29 130 276 48 fucosyltransferase HP0651 JHP0596 105 43 75 49 translation elongation factor EF-Tu (tufB) HP1205 JHP1128 81 64 166 50 virulence associated protein homolog (vacB) HP1248 JHP1169...”
  • “...HP1371 JHP1285 52 23 120 adenine/cytosine DNA methyltransferase HP0054 NAH 109 20 130 hypothetical protein HP0186 JHP0174 47 276 137 DNA mismatch repair protein (MutS) HP0621 JHP0565 22 64 147 outer membrane protein HP0486 JHP0438 26 142 149 DNA topoisomerase I (topA) HP0440 NAH 63 24...”
• Identification of genes with fast-evolving regions in microbial genomes
  Zheng, Nucleic acids research 2004
  • “...HP1396 HP0850 HP1142 HP1379 HP1499 HP0338 HP1053 HP1472 HP0186 HP0651 HP1079 HP0710 HP0669 HP0392 HP0583 HP0747 HP1363 HP1521 HP0203 HP0417 HP0717 HP0805...”
  • “...protein (mod) H.pylori predicted coding region HP0186 fucosyltransferase H.pylori predicted coding region HP1079 conserved hypothetical protein H.pylori...”
• Chronic Helicobacter pylori infection with Sydney strain 1 and a newly identified mouse-adapted strain (Sydney strain 2000) in C57BL/6 and BALB/c mice
  Thompson, Infection and immunity 2004
  • “...HP0686 HP1341 HP0853 HP0710 HP1337 HP1484 HP0102 HP0105 HP0186 HP0720 HP0189 HP0408 HP1353 HP0594 HP0057 HP0924 HP0783 HP0311 HP0823 JHP0950 HP1097 infA thiB...”
• A whole-genome microarray reveals genetic diversity among Helicobacter pylori strains
  Salama, Proceedings of the National Academy of Sciences of the United States of America 2000
  • “...PAI gene OMP, adhesin Type II DNA methyltransferase HP0186 HP0767 HP0963 HP1417 0.822 0.822 0.813 0.813 CIave 0.2 JHP0046 JHP0045 HP1426 HP0670 Putative Type...”

BCAL1172 hypothetical protein from Burkholderia cenocepacia J2315
Aligns to 421:582 / 590 (27.5%), covers 95.7% of PF07510, 71.0 bits

• Various Evolutionary Trajectories Lead to Loss of the Tobramycin-Potentiating Activity of the Quorum-Sensing Inhibitor Baicalin Hydrate in Burkholderia cenocepacia Biofilms
  Sass, Antimicrobial agents and chemotherapy 2019
  • “...CDS (10 bp 1012042 to 1012051) 100 repressor, GlpR BCAL1172 Conserved hypothetical protein, in BcenGI5 Deletion of first 148 bp of gene 100 92 BCAL1315...”
• The Mla Pathway Plays an Essential Role in the Intrinsic Resistance of Burkholderia cepacia Complex Species to Antimicrobials and Host Innate Components
  Bernier, Journal of bacteriology 2018
  • “...regulator 14C3 BCAL1048 Putative alpha/beta hydrolase 37B7 BCAL1172 Hypothetical protein 28H12 BCAL1246 Putative malonyl coenzyme A-acyl carrier protein 37H7...”
• Use of suppression-subtractive hybridization to identify genes in the Burkholderia cepacia complex that are unique to Burkholderia cenocepacia
  Bernier, Journal of bacteriology 2005
  • “...YP_109966g ZP_00213820 ZP_00222251 ZP_00222248 BCAL1291 BCAL1292 BCAL1172 BCAL1122 pBCA044 pBCA032 pBCA033 BCAM0327 BCAM0340 BCAM0514 BCAM0524 BCAS0034 BCAM2275...”

D9Q9Y9 DUF1524 domain-containing protein from Corynebacterium pseudotuberculosis (strain C231)
Cp1002B_1782, CpC231_0884 HNH endonuclease family protein from Corynebacterium pseudotuberculosis
Aligns to 128:268 / 273 (51.6%), covers 98.6% of PF07510, 68.5 bits

• In silico functional prediction of hypothetical proteins from the core genome of Corynebacterium pseudotuberculosis biovar ovis
  Araújo, PeerJ 2020
  • “...ligase C-terminal domain Cp1002B_1661 D9QA99 Bifunctional nucleaseDNAse and RNAse Cp1002B_1681 D9QA83 Phosphatidylglycerol lysyltransferase (mprF) Cp1002B_1782 D9Q9Y9 HNH endonuclease Cp1002B_1797 D9Q9X4 ACT-like enzyme Cp1002B_1850 D9Q9S4 SWIM-like zinc finger protein Cp1002B_1860 D9Q9R4 Cell wall-anchor domain LPxTG Cp1002B_1865 D9Q9Q9 Ferric reductase FhuF Cp1002B_1885 D9Q9N9 DivIVA-containing protein Cp1002B_1903 D9Q9M1 Fosfomycin...”
• Changes in protein abundance are observed in bacterial isolates from a natural host
  Rees, Frontiers in cellular and infection microbiology 2015
  • “...lutA CpC231_0829 Lactate utilization protein A 0.239 1.848 * 2.476 * Energy production and conversion D9Q9Y9 CpC231_0884 CpC231_0884 Uncharacterized protein 1.794 * D9QAC0 cobG CpC231_1019 Precorrin-3B synthase 0.773 * 1.959 * 1.946 * Inorganic ion transport and metabolism D9QAC1 cobH CpC231_1020 Precorrin-8X methyl mutase 0.111 1.440...”
• In silico functional prediction of hypothetical proteins from the core genome of Corynebacterium pseudotuberculosis biovar ovis
  Araújo, PeerJ 2020
  • “...acid ligase C-terminal domain Cp1002B_1661 D9QA99 Bifunctional nucleaseDNAse and RNAse Cp1002B_1681 D9QA83 Phosphatidylglycerol lysyltransferase (mprF) Cp1002B_1782 D9Q9Y9 HNH endonuclease Cp1002B_1797 D9Q9X4 ACT-like enzyme Cp1002B_1850 D9Q9S4 SWIM-like zinc finger protein Cp1002B_1860 D9Q9R4 Cell wall-anchor domain LPxTG Cp1002B_1865 D9Q9Q9 Ferric reductase FhuF Cp1002B_1885 D9Q9N9 DivIVA-containing protein Cp1002B_1903 D9Q9M1...”
• Changes in protein abundance are observed in bacterial isolates from a natural host
  Rees, Frontiers in cellular and infection microbiology 2015
  • “...CpC231_0829 Lactate utilization protein A 0.239 1.848 * 2.476 * Energy production and conversion D9Q9Y9 CpC231_0884 CpC231_0884 Uncharacterized protein 1.794 * D9QAC0 cobG CpC231_1019 Precorrin-3B synthase 0.773 * 1.959 * 1.946 * Inorganic ion transport and metabolism D9QAC1 cobH CpC231_1020 Precorrin-8X methyl mutase 0.111 1.440 *...”

NMA2230 hypothetical protein from Neisseria meningitidis Z2491
Aligns to 423:553 / 571 (22.9%), covers 82.6% of PF07510, 63.6 bits

• Microarray genomotyping of key experimental strains of Neisseria gonorrhoeae reveals gene complement diversity and five new neisserial genes associated with Minimal Mobile Elements
  Snyder, BMC genomics 2004
  • “...probe for XNG1618 or to the alternate N. meningitidis strain Z2491 probes for NMA0001 and NMA2230 . Figure 2 The MME flanked by nuoL and nuoM . This MME contains a hypothetical gene in N. gonorrhoeae strain FA1090 [ 16 ], short intergenic sequences in N....”

CjjRM3420_1536 DUF262 domain-containing protein from Campylobacter jejuni subsp. jejuni str. RM3420
Aligns to 423:547 / 555 (22.5%), covers 97.8% of PF07510, 63.6 bits

• Biomolecule sulphation and novel methylations related to Guillain-Barré syndrome-associated Campylobacter jejuni serotype HS:19
  Heikema, Microbial genomics 2021
  • “...97 33 CjjRM3420_1453 capsular polysaccharide biosynthesis protein 100 34 CjjRM3420_1454 Sam-dependent methyltransferase 97 6 ST-21/HS:8 CjjRM3420_1536, rloF cluster IIX restriction modification linked orf restriction modification 97 16 ST-257/HS:11, ST-574/HS:mix, ST:48/HS:4, ST-677/HS:4 CjjRM3420_1537, hsdS type I restriction-modification system, specificity subunit S 100 12 ST-257/HS:11, ST-574/HS:mix, ST:48/HS:4 CjjRM3420_1677...”

DDV75_00040 DUF262 domain-containing protein from Campylobacter jejuni
Aligns to 418:553 / 563 (24.2%), covers 76.1% of PF07510, 62.3 bits

• Identification of Novel Phage Resistance Mechanisms in Campylobacter jejuni by Comparative Genomics
  Sørensen, Frontiers in microbiology 2021
  • “...Position Product Gene Position Product Query cover Similarity E -value DDR89_00040 12.64214.393 DUF262 domain-containing protein DDV75_00040 12.65314.344 DUF262 domain-containing protein No significant similarity DDR89_00180 46.40450.144 Eco 57I restriction-modification methylase domain-containing protein DDV75_00180 46.52150.294 Eco 57I restriction-modification methylase domain-containing protein 88% 94.5% 0.0 DDR89_00185 50.147-52.291 AAA family...”
  • “...sensitive CAMSA2002 and phage resistant CAMSA2038 both encode a DUF262-containing protein ( DDR89_00040 in CAMSA2002, DDV75_00040 in CAMSA2038) in the same location of the genomes, but the protein sequences show no similarity ( Table 2 ). We therefore conducted a detailed in silico analysis to predict...”

pCM1_0018 putative secreted protein from Clavibacter michiganensis subsp. michiganensis NCPPB 382
Aligns to 102:239 / 252 (54.8%), covers 92.0% of PF07510, 59.9 bits

• A Proteomic Study of Clavibacter Michiganensis Subsp. Michiganensis Culture Supernatants
  Hiery, Proteomes 2015
  • “...putative sugar ABC transporter substrate-binding protein +/+ CMM_2941 putative metal ABC transporter substrate-binding protein +/+ pCM1_0018 putative secreted protein +/+ pCM1_0020 CelA +/+ pCM1_0023 putative extracellular serine protease pCM2_0025 putative secreted protein +/+ pCM2_0028 conserved secreted protein +/+ pCM2_0053 putative extracellular serine protease +/+ pCM2_0054 Pat-1...”
• Comparative genome analysis of pathogenic and non-pathogenic Clavibacter strains reveals adaptations to their lifestyle
  Załuga, BMC genomics 2014
  • “...DNA fragments of LMG 26808 showed to be highly similar to two plasmid-encoded genes, namely pCM1_0018 and pCM1_0020, the reciprocal BLAST search revealed that these sequences from the non-pathogenic Clavibacter genome are more similar to the chromosomally encoded CMM_1065 and CMM_2443, respectively. Interestingly, the latter gene...”

jhp1431 putative from Helicobacter pylori J99
Aligns to 98:286 / 293 (64.5%), covers 96.4% of PF07510, 59.7 bits

• The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
  Kao, Frontiers in microbiology 2017
  • “...1.85 ns /1.23 jhp1333 HP1440 Putative 7.22 *** /11.63 jhp1430 HP1397 Putative 3.23 *** /2.97 jhp1431 HP1396 Putative 3.74 *** /4.12 jhp1436 HP1391 Putative 2.16 ** /2.13 jhp1437 b HcpA family protein 1.63 ** /1.69 jhp1474 HP1566 Membrane protein 1.77 *** /1.88 a Gene expression in...”
• Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
  Romo-González, Infection and immunity 2009
  • “...HP0964, JHP0898, JHP0899 N/A, HP0965, JHP0899 N/A, HP1396, JHP1431 N/A, HP1397, JHP1430 N/A, N/A, JHP0616 N/A, N/A, JHP0961 N/A, N/A, JHP0959 N/A, N/A, JHP0960...”
• Identification of genes with fast-evolving regions in microbial genomes
  Zheng, Nucleic acids research 2004
  • “...jhp0476 jhp1330 jhp0941 jhp0029 jhp0274 jhp1164 jhp0458 jhp1431 jhp0786 jhp1070 jhp1293 jhp1392 jhp0320 jhp0372 jhp1365 jhp0174 jhp0596 jhp0346 jhp0649 jhp0613...”

HP1396 hypothetical protein from Helicobacter pylori 26695
Aligns to 115:288 / 288 (60.4%), covers 93.5% of PF07510, 59.7 bits

• Helicobacter pylori Modulates Heptose Metabolite Biosynthesis and Heptose-Dependent Innate Immune Host Cell Activation by Multiple Mechanisms
  Hauke, Microbiology spectrum 2023
  • “...3.89 0 HP1233 62.97 1.02 2.03 0.09 HP1248 ( vacB ) 56.09 2.02 4.04 1.18E06 HP1396 164.94 1.02 2.03 4.77E06 HP1439 13.65 0.81 1.75 0.61 HP1566 57.96 3.70 12.97 8.50E03 a The subset of the differential expression analysis shows CsrA-dependent genes according to reference 43 ;...”
• The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
  Kao, Frontiers in microbiology 2017
  • “...ns /1.23 jhp1333 HP1440 Putative 7.22 *** /11.63 jhp1430 HP1397 Putative 3.23 *** /2.97 jhp1431 HP1396 Putative 3.74 *** /4.12 jhp1436 HP1391 Putative 2.16 ** /2.13 jhp1437 b HcpA family protein 1.63 ** /1.69 jhp1474 HP1566 Membrane protein 1.77 *** /1.88 a Gene expression in the...”
• Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
  Romo-González, Infection and immunity 2009
  • “...N/A, HP0964, JHP0898, JHP0899 N/A, HP0965, JHP0899 N/A, HP1396, JHP1431 N/A, HP1397, JHP1430 N/A, N/A, JHP0616 N/A, N/A, JHP0961 N/A, N/A, JHP0959 N/A, N/A,...”
• Using macro-arrays to study routes of infection of Helicobacter pylori in three families
  Raymond, PloS one 2008
  • “...HP1382 putative endonuclease HP1383 restriction modification system S subunit HP1388 hypothetical protein HP1390 hypothetical protein HP1396 hypothetical protein HP1397 hypothetical protein HP1400+ iron(III) dicitrate transport protein (fecA) HP1402 type I restriction enzyme R protein (hsdR) HP1410 hypothetical protein HP1411 hypothetical protein HP1412 hypothetical protein HP1415 tRNA...”
• Identification of genes with fast-evolving regions in microbial genomes
  Zheng, Nucleic acids research 2004
  • “...HP1354 HP0527 HP1437 HP0995 HP0033 HP0289 HP0896 HP0508 HP1396 HP0850 HP1142 HP1379 HP1499 HP0338 HP1053 HP1472 HP0186 HP0651 HP1079 HP0710 HP0669 HP0392 HP0583...”
  • “...coding region HP0508 H.pylori predicted coding region HP1396 type I restriction enzyme M protein (hsdM) H.pylori predicted coding region HP1142 ATP-dependent...”
• Comparison of genetic divergence and fitness between two subclones of Helicobacter pylori
  Björkholm, Infection and immunity 2001
  • “...HP0984, JHP0950, HP0999, HP1074, JHP0332, HP1250, HP1324, HP1396, HP1397, HP1405, HP1412, HP1439, JHP1408, HP1586 NA hsdS Ribosomal protein L28 Acyl carrier...”

jhp0174 putative from Helicobacter pylori J99
Aligns to 410:555 / 567 (25.7%), covers 97.8% of PF07510, 58.7 bits

• Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori
  Saunders, BMC genomics 2005
  • “...12 51 54 28 JHP1426 iron(III) dicitrate transport protein (fecA) HP1400 32 78 111 29 JHP0174 hypothetical protein HP0187 / 8 / 6 47&1127&596 88 90 30 JHP1297 type III restriction enzyme (res) NAH - 63 28 31 JHP0953 hypothetical protein NAH - 26 1463 32...”
  • “...46 histidine and glutamine-rich metal-binding protein HP1432 JHP1321 15 9 1432 47 hypothetical protein HP0186 JHP0174 29 130 276 48 fucosyltransferase HP0651 JHP0596 105 43 75 49 translation elongation factor EF-Tu (tufB) HP1205 JHP1128 81 64 166 50 virulence associated protein homolog (vacB) HP1248 JHP1169 79...”
• Genomic diversity in Campylobacter jejuni: identification of C. jejuni 81-176-specific genes
  Poly, Journal of clinical microbiology 2005
  • “...enterica serovar Typhi CT18 (NP_457434) Hypothetical protein jhp0174, H. pylori strain J99 (NP_222895) Hypothetical protein, Bacillus cereus ATCC 14579...”
• Identification of genes with fast-evolving regions in microbial genomes
  Zheng, Nucleic acids research 2004
  • “...jhp0786 jhp1070 jhp1293 jhp1392 jhp0320 jhp0372 jhp1365 jhp0174 jhp0596 jhp0346 jhp0649 jhp0613 jhp0989 jhp0530 jhp0684 jhp1281 jhp1410 jhp0189 jhp0967 jhp0655...”

MSMEG_2404 extracellular deoxyribonuclease from Mycobacterium smegmatis str. MC2 155
Aligns to 86:217 / 234 (56.4%), covers 86.2% of PF07510, 58.4 bits

• The specialized secretory apparatus ESX-1 is essential for DNA transfer in Mycobacterium smegmatis
  Coros, Molecular microbiology 2008
  • “...to the same site within the conserved gene, Msmeg_2404, which encodes a putative extracellular deoxyribonuclease. This is the last gene in a three-gene operon,...”

Rv2972c POSSIBLE CONSERVED MEMBRANE OR EXPORTED PROTEIN from Mycobacterium tuberculosis H37Rv
Mb2997c POSSIBLE CONSERVED MEMBRANE OR EXPORTED PROTEIN from Mycobacterium bovis AF2122/97
Aligns to 89:230 / 237 (59.9%), covers 94.9% of PF07510, 56.4 bits

• Identification of gene targets that potentiate the action of rifampicin on <i>Mycobacterium bovis</i> BCG
  Chand, Microbiology (Reading, England) 2024
  • “...Acyl-CoA synthetase, PGL synthesis 1.32 <0.001 BCG_2968c pks1 Rv2946c Putative polyketide synthase 1.34 <0.001 BCG_2994c Rv2972c Putative membrane or exported protein 1.36 <0.001 BCG_2974 Rv2953 Hypothetical protein 1.38 <0.001 BCG_2979c Rv2958c PGL/p-HBAD biosynthesis glycosyltransferase 1.38 <0.001 BCG_2989c Rv2968c Putative integral membrane protein 1.42 <0.001 BCG_2973 Rv2952...”
• Differential gene expression between Mycobacterium bovis and Mycobacterium tuberculosis
  Rehren, Tuberculosis (Edinburgh, Scotland) 2007
  • “...Rv2955c Mb2979c 4.5 0.00568 Conserved hypothetical protein Rv2972c Mb2997c 3.8 0.0172 Possible conserved membrane or exported protein Rv2973c Mb2998c recG 7.3...”
• Differential gene expression between Mycobacterium bovis and Mycobacterium tuberculosis
  Rehren, Tuberculosis (Edinburgh, Scotland) 2007
  • “...Mb2979c 4.5 0.00568 Conserved hypothetical protein Rv2972c Mb2997c 3.8 0.0172 Possible conserved membrane or exported protein Rv2973c Mb2998c recG 7.3 0.0166...”

CMM_1065 hypothetical protein from Clavibacter michiganensis subsp. michiganensis NCPPB 382
Aligns to 136:275 / 281 (49.8%), covers 89.9% of PF07510, 53.2 bits

• Comparative genome analysis of pathogenic and non-pathogenic Clavibacter strains reveals adaptations to their lifestyle
  Załuga, BMC genomics 2014
  • “...that these sequences from the non-pathogenic Clavibacter genome are more similar to the chromosomally encoded CMM_1065 and CMM_2443, respectively. Interestingly, the latter gene encodes CelB, which is a putative secreted cellulase that contains a cellulose-binding domain (endo-1,4-beta-glucanase). Chromosomally encoded c elB misses one of three protein...”

AO090012000695 No description from Aspergillus oryzae RIB40
Aligns to 367:515 / 519 (28.7%), covers 63.8% of PF07510, 53.1 bits

• A genomic survey of proteases in Aspergilli
  Budak, BMC genomics 2014
  • “...AO090120000474 ATEG_06182 AFL2G_08462 NFIA_073740 WS Afu5g13300 WS Aspartic P [ 42 ] OG-14 AN6796 210782 AO090012000695 W ATEG_09753 AFL2G_03570 NFIA_040680 Afu5g01430 Cysteine E OG-15 AN7962 WS - AO090001000135 ATEG_04941 WS AFL2G_07373 NFIA_102630 WS Afu4g13750 WS Metallo E d [ 43 , 44 ] OG-16 - 46803...”

CJJ81176_0034 hypothetical protein from Campylobacter jejuni subsp. jejuni 81-176
Aligns to 417:559 / 573 (25.0%), covers 95.7% of PF07510, 51.4 bits

• The role of cydB gene in the biofilm formation by Campylobacter jejuni
  Korkus, Scientific reports 2024
  • “...CJJ81176_1185 Conserved hypothetical protein 15K CJJ81176_0128 Hypothetical protein C64 CJJ81176_1245 Sodium/hydrogen exchanger family protein E13 CJJ81176_0034 Hypothetical protein E17 CJJ81176_1363 Hypothetical protein E24 CJJ81176_1495 Bifunctional putA protein, putative E37 CJJ81176_0728 Conserved hypothetical protein TIGR00486 E40 CJJ81176_1309 Deoxycytidine triphosphate deaminase, putative E48 CJJ81176_1340 Motility accessory factor Effect...”

UU527 conserved hypothetical from Ureaplasma parvum serovar 3 str. ATCC 700970
Aligns to 769:958 / 971 (19.6%), covers 96.4% of PF07510, 48.4 bits

• Comparative genome analysis of Ureaplasma parvum clinical isolates
  Momynaliev, Research in microbiology 2007 (PubMed)
  • “...function prediction only (UU480), function unknown (UU033, UU527) and defense mechanisms (UU446, UU447) was low (2.36.6%). Hence, the genetic variability of...”

A4619_ARTBC / D4AK18 Uncharacterized secreted protein ARB_06907 from Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371) (Trichophyton mentagrophytes) (see 2 papers)
Aligns to 72:200 / 204 (63.2%), covers 63.0% of PF07510, 45.2 bits

CDQ83_18880 DUF262 domain-containing protein from Clostridium thermosuccinogenes
Aligns to 406:595 / 611 (31.1%), covers 79.7% of PF07510, 44.5 bits

• Breaking the Restriction Barriers and Applying CRISPRi as a Gene Silencing Tool in Pseudoclostridium thermosuccinogenes
  Ganguly, Microorganisms 2022
  • “...the gene cluster CDQ83_16045, CDQ83_16050, and CDQ83_16055. Scaffold 3 harbors the gene cluster CDQ83_18870, CDQ83_18875, CDQ83_18880, and CDQ83_18885. The ORFs from each Type I RM systems cloned in E. coli are highlighted in bold. Figure 3 Strategies to enhance transformation efficiency by breaking the restriction barriers....”

SCHCODRAFT_16019 uncharacterized protein from Schizophyllum commune H4-8
Aligns to 65:207 / 211 (67.8%), covers 81.2% of PF07510, 43.1 bits

• Comparative transcriptomics of the model mushroom Coprinopsis cinerea reveals tissue-specific armories and a conserved circuitry for sexual development
  Plaza, BMC genomics 2014
  • “...SCHCODRAFT_86141 LACBIDRAFT_184665 Glutathione S-transferase CC1G_04060 SCHCODRAFT_13677 LACBIDRAFT_180892 Hydrophobin-251 CC1G_10471 SCHCODRAFT_232646 LACBIDRAFT_295571 Aromatic peroxygenase precursor CC1G_.12330 SCHCODRAFT_16019 LACBIDRAFT_256021 S-layer domain-containing protein 2 (PC: 0.99) CC1G_00069 SCHCODRAFT_48115 LACBIDRAFT_312065 C factor cell-cell signaling protein CC1G_00217 SCHCODRAFT_46102 LACBIDRAFT_323571 Non-Catalytic module family EXPN protein CC1G_03515 SCHCODRAFT_82058 LACBIDRAFT_328112 Hydrophobin-like protein CC1G_04659 SCHCODRAFT_110821...”

BCIN_12g00380 hypothetical protein from Botrytis cinerea B05.10
Aligns to 67:200 / 204 (65.7%), covers 63.8% of PF07510, 42.3 bits

• Transcriptome analysis and functional validation reveal a novel gene, BcCGF1, that enhances fungal virulence by promoting infection-related development and host penetration
  Zhang, Molecular plant pathology 2020
  • “...No BCIN_02g01260 BCIN_02g01260 134.0 Pisatin demethylase No BCIN_03g05820 BCIN_03g05820 106.0 Pectate lyase B precursor Yes BCIN_12g00380 BCIN_12g00380 97.2 Hypothetical protein Yes BCIN_15g02380 Bcacp1 95.0 Acidic protease Yes BCIN_03g01520 BCIN_03g01520 78.0 NADPdependent alcohol dehydrogenase No BCIN_12g02040 Bcap8 76.3 Polyporopepsin/Bcap8 Yes BCIN_02g08100 BCIN_02g08100 76.0 Hypothetical protein No BCIN_15g03320...”

PADG_07830 uncharacterized protein from Paracoccidioides brasiliensis Pb18
Aligns to 86:208 / 212 (58.0%), covers 63.8% of PF07510, 41.1 bits

• Genome Diversity, Recombination, and Virulence across the Major Lineages of Paracoccidioides
  Muñoz, mSphere 2016
  • “...PADG_02569 Secreted protein + + PADG_00954 Secreted protein immunoreactive protein; secreted + + + + PADG_07830 Secreted protein; B.dermatitidis ortholog induced during in vivo infection + PADG_05055 Secreted protein; B.dermatitidis ortholog induced during macrophage interaction + + + + PADG_03277 Secreted protein; vesicles; B.dermatitidis ortholog induced...”

NCU09525 secreted protein from Neurospora crassa OR74A
Aligns to 78:227 / 231 (64.9%), covers 63.0% of PF07510, 40.9 bits

• Aspects of the Neurospora crassa Sulfur Starvation Response Are Revealed by Transcriptional Profiling and DNA Affinity Purification Sequencing
  Huberman, mSphere 2021
  • “...nucleic acid uptake and utilization, including nuclease gene nuc-14 (NCU09788) and predicted extracellular DNase gene NCU09525, as well as 5-nucleotidase gene nut-1 (NCU09659), uracil-5-carboxylate decarboxylase gene uc-7 (NCU06417), uracil phosphoribosyltransferase gene uc-8 (NCU06261), and guanine deaminase gene gua-5 (NCU07309) ( Data Set S1 ). Genes related...”
• Gene expression differences among three Neurospora species reveal genes required for sexual reproduction in Neurospora crassa
  Lehr, PloS one 2014
  • “...ELQ39075.1 NCU02089 hypothetical protein SMAC_04986 1276 1276 99% 0.0 88% [ Sordaria macrospora ], XP_003352871.1 NCU09525 Bacterial-type extracellular 284 284 85% 2e93 69% deoxyribonuclease [N. haematococc a ], XP_003051650.1 The expression patterns of the genes whose knockouts showed an impact on fruiting body formation were monitored...”
  • “...line) and NCU05609 (dashed line), up-regulated during intermediate stages of perithecial development. C. Expression of NCU09525 (solid line) and NCU00427 (dashed line), both changing significantly in late perithecial development. D. Dynamic changes in expression of NCU02089 (solid line) and NCU06874 (dashed line) across perithecial development. Error...”
• A comparative systems analysis of polysaccharide-elicited responses in Neurospora crassa reveals carbon source-specific cellular adaptations
  Benz, Molecular microbiology 2014
  • “...three proteases/peptidases (SPR-7/NCU07159, NCU00263 and NCU06720), the -glucuronidase GH79-1, the hypothetical proteins NCU08432 and (particularly) NCU09525, as well as the circadian rhythm controlled protein CCG-14/NCU07787 grew significantly better on pectin. Identification of transcription factors in the clusters The coordinate expression of genes is often mediated by...”
  • “...on pectin, five showed either a defect or increased fitness on pectin, with one ( NCU09525 ) showing markedly increased fitness and one ( NCU07923 ) showing markedly decreased fitness. Both the phenotypic data and the expression profiling data strongly suggest that these proteins play a...”

ACG06_19220 DUF262 domain-containing protein from Pseudomonas aeruginosa
Aligns to 418:559 / 564 (25.2%), covers 94.2% of PF07510, 40.7 bits

• Comparative genome and transcriptome analysis reveals distinctive surface characteristics and unique physiological potentials of Pseudomonas aeruginosa ATCC 27853
  Cao, BMC genomics 2017
  • “...unique C-terminal domain including a metal-binding cysteine cluster COG1223 ACG06_23485 Predicted ATPase (AAA+ superfamily) COG1479 ACG06_19220 Uncharacterized conserved protein COG1541 ACG06_14110 Coenzyme F390 synthetase COG1783 ACG06_12260 Phage terminase large subunit COG2189 ACG06_23500 Adenine specific DNA methylase Mod COG2253 ACG06_23380 Uncharacterized conserved protein COG2372 ACG06_12630 Uncharacterized protein,...”

SCO2348 secreted protein from Streptomyces coelicolor A3(2)
Aligns to 78:209 / 214 (61.7%), covers 66.7% of PF07510, 39.5 bits

• OsdR of Streptomyces coelicolor and the Dormancy Regulator DevR of Mycobacterium tuberculosis Control Overlapping Regulons
  Urem, mSystems 2016
  • “...66 SCO5251 Puromycin N -acetyltransferase AGGGCCGTACGGCACC 243 10.31 SCO2347 Integral membrane protein AGGGCCGAAAGTCCCG 295 10.3 SCO2348 Secreted protein 221 SCO0214 Pyridoxamine 5-phosphate oxidase GGGGCCATCCGGCCCT 50 10.18 SCO0213c Nitrate-nitrite transporter protein 252 SCO0212c Hemerythrin cation binding domain-containing protein (oxygen transporting protein) SCO0179c Zinc-containing dehydrogenase TGGGCCGGTCGGCCCC 152 9.46...”
• Genome-wide transcriptome analysis reveals that a pleiotropic antibiotic regulator, AfsS, modulates nutritional stress response in Streptomyces coelicolor A3(2)
  Lian, BMC genomics 2008
  • “...Putative secreted alkaline phosphatase 0.28 SCO2286 Putative Tat-dependent secreted alkaline phosphatase ( phoA ) 0.43 SCO2348 Putative secreted protein 0.56 SCO2349 Hypothetical protein, similar to phosphodiesterase ( phoD ) 0.15 SCO2532 PhoH-like protein ( phoH ) 0.18 SCO2764 Putative lipoprotein. 0.15 SCO2878 Hypothetical protein 0.32 SCO3789...”

FGSG_06993 hypothetical protein from Fusarium graminearum PH-1
Aligns to 63:196 / 200 (67.0%), covers 76.1% of PF07510, 39.5 bits

• Characterization of Three Fusarium graminearum Effectors and Their Roles During Fusarium Head Blight
  Hao, Frontiers in plant science 2020
  • “...6 Hypothetical protein Cytoplasm (0.5) Y FGSG_06712 146 17 16 Hypothetical protein Cytoplasm (0.7) Y FGSG_06993 200 16 4 Hypothetical protein-HXXP Peroxisome/cytoplasm (0.5) Y FGSG_08210 155 22 10 Hypothetical protein Cytoplasm (0.6) N FGSG_09570 170 19 8 Hypothetical protein Cytoplasm (0.5) N FGSG_10206 162 16 8...”
  • “...induced at the immediate-early stage ( Figure 1 , Table 1 ). The expression of FGSG_06993 was detected at 3 hpi, increased 14-fold at 12 hpi, and decreased after 24 hpi. Contrastingly, the expression of FGSG_11318 displayed the highest level at 36 hpi (60-fold) but had...”

LACBIDRAFT_256021 uncharacterized protein from Laccaria bicolor S238N-H82
Aligns to 67:200 / 204 (65.7%), covers 63.0% of PF07510, 35.4 bits

• Comparative transcriptomics of the model mushroom Coprinopsis cinerea reveals tissue-specific armories and a conserved circuitry for sexual development
  Plaza, BMC genomics 2014
  • “...LACBIDRAFT_184665 Glutathione S-transferase CC1G_04060 SCHCODRAFT_13677 LACBIDRAFT_180892 Hydrophobin-251 CC1G_10471 SCHCODRAFT_232646 LACBIDRAFT_295571 Aromatic peroxygenase precursor CC1G_.12330 SCHCODRAFT_16019 LACBIDRAFT_256021 S-layer domain-containing protein 2 (PC: 0.99) CC1G_00069 SCHCODRAFT_48115 LACBIDRAFT_312065 C factor cell-cell signaling protein CC1G_00217 SCHCODRAFT_46102 LACBIDRAFT_323571 Non-Catalytic module family EXPN protein CC1G_03515 SCHCODRAFT_82058 LACBIDRAFT_328112 Hydrophobin-like protein CC1G_04659 SCHCODRAFT_110821 LACBIDRAFT_298314...”

SCP1.323c putative secreted protein from Streptomyces coelicolor A3(2)
Aligns to 84:204 / 219 (55.3%), covers 64.5% of PF07510, 31.8 bits

• Intraspecific variability of the terminal inverted repeats of the linear chromosome of Streptomyces ambofaciens
  Choulet, Journal of bacteriology 2006
  • “...93 100 100 94 95 95 SAP1_86 SCP1.323c SCP1.261c SCP1.262 SAV7571 ShewDRAFT_1466 SAP1 SCP1 SCP1 SCP1 Streptomyces avermitilis Streptomyces coelicolor...”

jhp0872 putative from Helicobacter pylori J99
Aligns to 115:268 / 274 (56.2%), covers 49.3% of PF07510, 31.3 bits

• Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
  Romo-González, Infection and immunity 2009
  • “...N/A, HP0492, JHP0444 N/A, HP0522, JHP0471 N/A, HP0937, JHP0872 N/A, HP0993, N/A N/A, HP0523, JHP0472 N/A, HP1144, JHP1072 virB11_1, HP0525, JHP0474 cag7, orf13...”
• The orphan response regulator HP1021 of Helicobacter pylori regulates transcription of a gene cluster presumably involved in acetone metabolism
  Pflock, Journal of bacteriology 2007
  • “...HP1555 VOL. 189, 2007 2343 JHP0881 JHP0887 JHP0938 JHP0872 JHP0873 JHP0882 JHP0880 JHP0089 JHP0227 a Genes listed are those whose transcription, according to...”

HP0937 hypothetical protein from Helicobacter pylori 26695
Aligns to 111:260 / 264 (56.8%), covers 35.5% of PF07510, 29.7 bits

• AI-2 Induces Urease Expression Through Downregulation of Orphan Response Regulator HP1021 in Helicobacter pylori
  Yang, Frontiers in medicine 2022
  • “...1.4482 HP0757 N-carbamoylputrescine amidase 1.4625 HPt26 tRNA-Pro 1.471 HP0758 Sodium:proton antiporter 1.4774 HP0434 Pseudogene 1.4937 HP0937 Pseudogene 1.4976 HP1556 Cell division protein FtsI 1.5018 HP0754 5-formyltetrahydrofolate cyclo-ligase 1.5228 HP0073 Urease subunit alpha 1.5257 HP1082 Multidrug ABC transporter ATP-binding protein/permease 1.5375 HP1582 Pyridoxine 5'-phosphate synthase 1.546 HP1583...”
• Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
  Romo-González, Infection and immunity 2009
  • “...N/A N/A, HP0492, JHP0444 N/A, HP0522, JHP0471 N/A, HP0937, JHP0872 N/A, HP0993, N/A N/A, HP0523, JHP0472 N/A, HP1144, JHP1072 virB11_1, HP0525, JHP0474 cag7,...”
• The orphan response regulator HP1021 of Helicobacter pylori regulates transcription of a gene cluster presumably involved in acetone metabolism
  Pflock, Journal of bacteriology 2007
  • “...2.41 JHP1163 JHP0900/JHP0901 Hypothetical HP1242 HP0966 HP1334 HP0937 HP0938 HP0948 HP0946 HP0097 HP0242 HP0945 HP0947 HP0953 HP0990 HP0992 Genome organizationd...”
• Acid-adaptive genes of Helicobacter pylori
  Wen, Infection and immunity 2003
  • “...HP0681 HP0697 HP0704 HP0711 HP0780 HP0868 HP0874 HP0895 HP0937 HP0948 HP0953 HP0990 HP1187 HP1188 HP1207 HP1236 HP1288 HP1289 HP1326 HP1327 HP1391 HP1397 HP1412...”

YPO3437 conserved hypothetical protein from Yersinia pestis CO92
Aligns to 469:589 / 636 (19.0%), covers 44.9% of PF07510, 28.9 bits

• Redefining the differences in gene content between Yersinia pestis and Yersinia pseudotuberculosis using large-scale comparative genomics
  Califf, Microbial genomics 2015
  • “...YOP2083 Y. pestis Hypothetical protein YPO0387 Y. pestis Hypothetical protein YPO0388 Y. pestis Hypothetical protein YPO3437 Y. pestis XRE family transcriptional regulator WP_002214362 Y. pestis Transcriptional regulator YPO4031 Y. pestis Transposase WP_002214360 Y. pestis Outer membrane receptor YPO3910 Y. pestis Hypothetical protein YPO3948 Y. pestis Hypothetical...”

EF62_1081 DUF262 domain-containing protein from Enterococcus faecalis 62
Aligns to 439:580 / 583 (24.4%), covers 42.0% of PF07510, 26.8 bits

• An ABC transporter is required for secretion of peptide sex pheromones in Enterococcus faecalis
  Varahan, mBio 2014
  • “...predicted CHAP domain-containing amidase, a cation transporter (EF_2556), and two predicted hypothetical proteins (EF_2470 and EF62_1081). Our attention was focused on insertions that were confined to a predicted ABC transporter, as independent transposon insertions localized to either the putative ATP-binding cassette (EF_0688) or the predicted permease...”

YfjM / b2629 CP4-57 prophage; protein YfjM from Escherichia coli K-12 substr. MG1655
b2629 CP4-57 prophage; predicted protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 3:74 / 87 (82.8%), covers 36.2% of PF07510, 26.6 bits

• Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate
  Pomposiello, Journal of bacteriology 2001
  • “...b4139 b0218 b0271 b0938 b1029 b1567 b1903 b2102 b2355 b2629 b2768 b0032 b0620 b1575 b2369 b2323 b1925 b2025 b3580 b0923 b1224 b3480 b0929 b4245 b0945 b4387...”
  • “...b4394 argR aspA b0218 b0271 b0938 b1029 b1567 b1903 b2102 b2355 b2629 b2768 carA criR dicB evgA fabB fliS hisF lyxK mukE narG nikE ompF pyrB pyrD smp sodB sodC...”

Or search for genetic data about PF07510 in the Fitness Browser