Family Search for PF07556 (DUF1538)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF07556 hits 6 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
CBO2972 membrane protein from Clostridium botulinum A str. ATCC 3502
2 alignments in 18:482 / 504 (84.1%), covering up to 100.0% of PF07556, 462.3 bits
T259_1133 DUF1538 domain-containing protein from Clostridium botulinum CDC_1436
2 alignments in 18:482 / 504 (84.1%), covering up to 100.0% of PF07556, 460.5 bits
- Differentiating Botulinum Neurotoxin-Producing Clostridia with a Simple, Multiplex PCR Assay
Williamson, Applied and environmental microbiology 2017 - “...= 15) Groups IIIVI b ( n = 55) Other clostridia ( n = 102) T259_1133 Hypothetical protein 0.97 0.00 0.00 0.00 0.00 0.00 T258_3337 Transglutaminase-like superfamily protein 0.03 0.98 0.00 0.00 0.00 0.00 CLH_2632 ATP phosphoribosyltransferase regulatory subunit 0.00 0.01 0.99 0.00 0.01 0.01 CLL_A2124...”
- “...Forward primer (53) Reverse primer (53) Final concn in PCR (uM) Approximate amplicon size (bp) T259_1133 C. botulinum group I TGGTGCGATGACAGTTCCATTT TCATTGGTCCAGATGCAACTCC 0.75 775 T258_3337 C. sporogenes ATTGGAGTGGACATGCCTGGA CCCTTTAACCACCGCTTGTTGT 0.5 310 CLH_2632 Group II E AGGGACGCGGGATCTTGTTTTA TCCCATCACTCCCCACTAACTCA 0.4 375 CLL_A2124 Group II BEF GCTTGGACAACATTCAGTGAGGA GAATGCCTTCTGTTGGCCTCAT 1.5...”
VP0810 putative PTS system mannose-specific, factor IIC from Vibrio parahaemolyticus RIMD 2210633
Aligns to 21:242 / 244 (91.0%), covers 99.5% of PF07556, 239.0 bits
UMPB_HALZH / A0A1X9QDU5 Na(+), Li(+), K(+)/H(+) antiporter subunit B; Na(+) (Li(+)/K(+))/H(+) antiporter subunit B from Halomonas zhaodongensis (see paper)
Aligns to 17:241 / 271 (83.0%), covers 99.5% of PF07556, 219.9 bits
- function: Part of a two-component antiporter that catalyzes the efflux of Na(+), Li(+) and K(+) in exchange for external protons. Shows a preference for Na(+), followed by K(+) and Li(+).
subunit: Heterodimer composed of UmpA and UmpB.
UMPA_HALZH / A0A1X9QDU4 Na(+), Li(+), K(+)/H(+) antiporter subunit A; Na(+) (Li(+)/K(+))/H(+) antiporter subunit A from Halomonas zhaodongensis (see paper)
Aligns to 21:245 / 254 (88.6%), covers 100.0% of PF07556, 218.7 bits
- function: Part of a two-component antiporter that catalyzes the efflux of Na(+), Li(+) and K(+) in exchange for external protons. Shows a preference for Na(+), followed by K(+) and Li(+).
subunit: Heterodimer composed of UmpA and UmpB.
P700755_00120 hypothetical protein from Psychroflexus torquis ATCC 700755
Aligns to 23:245 / 259 (86.1%), covers 99.1% of PF07556, 177.5 bits
- Extensive gene acquisition in the extremely psychrophilic bacterial species Psychroflexus torquis and the link to sea-ice ecosystem specialism
Feng, Genome biology and evolution 2014 - “...organic peroxides. The array of defences includes genes for two catalases (P700755_00288, _02059), seven peroxidases (P700755_00120, _0196, _01102, _01308, _03056, _03338, _03478), and three superoxide dismutases (P700755_00728, _00729, 01787). Some of these have homologs in ACAM 44 T that likely also experiences photooxidative stress in its...”
Or search for genetic data about PF07556 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory