Family Search for PF07896 (DUF1674)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF07896 hits 10 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
8dyeB / Q5VUM1 Crystal structure of human sdha-sdhaf4 assembly intermediate (see paper)
Aligns to 1:43 / 43 (100.0%), covers 84.0% of PF07896, 79.4 bits
- Ligand: flavin-adenine dinucleotide (8dyeB)
SDHF4_HUMAN / Q5VUM1 Succinate dehydrogenase assembly factor 4, mitochondrial; SDH assembly factor 4; SDHAF4 from Homo sapiens (Human) (see paper)
NP_660310 succinate dehydrogenase assembly factor 4, mitochondrial precursor from Homo sapiens
Aligns to 59:108 / 108 (46.3%), covers 96.0% of PF07896, 78.7 bits
SDHF4_MOUSE / Q8BTE0 Succinate dehydrogenase assembly factor 4, mitochondrial; SDH assembly factor 4; SDHAF4 from Mus musculus (Mouse) (see paper)
NP_080779 succinate dehydrogenase assembly factor 4, mitochondrial precursor from Mus musculus
Aligns to 55:104 / 104 (48.1%), covers 94.0% of PF07896, 78.7 bits
- function: Plays an essential role in the assembly of succinate dehydrogenase (SDH), an enzyme complex (also referred to as respiratory complex II) that is a component of both the tricarboxylic acid (TCA) cycle and the mitochondrial electron transport chain, and which couples the oxidation of succinate to fumarate with the reduction of ubiquinone (coenzyme Q) to ubiquinol (PubMed:24954416). Binds to the flavoprotein subunit Sdha in its FAD-bound form, blocking the generation of excess reactive oxygen species (ROS) and facilitating its assembly with the iron-sulfur protein subunit Sdhb into the SDH catalytic dimer (By similarity).
subunit: Interacts with Sdha in its FAD-bound form. - Cardiac disruption of SDHAF4-mediated mitochondrial complex II assembly promotes dilated cardiomyopathy.
Wang, Nature communications 2022 - GeneRIF: Cardiac disruption of SDHAF4-mediated mitochondrial complex II assembly promotes dilated cardiomyopathy.
SDHF4_DROME / Q9VLU6 Succinate dehydrogenase assembly factor 4, mitochondrial; SDH assembly factor 4; SDHAF4; Starvation-upregulated protein from Drosophila melanogaster (Fruit fly) (see paper)
Aligns to 69:118 / 118 (42.4%), covers 92.0% of PF07896, 75.5 bits
- function: Plays an essential role in the assembly of succinate dehydrogenase (SDH), an enzyme complex (also referred to as respiratory complex II) that is a component of both the tricarboxylic acid (TCA) cycle and the mitochondrial electron transport chain, and which couples the oxidation of succinate to fumarate with the reduction of ubiquinone (coenzyme Q) to ubiquinol (PubMed:24954416). Binds to the flavoprotein subunit SdhA in its FAD-bound form, blocking the generation of excess reactive oxygen species (ROS) and facilitating its assembly with the iron-sulfur protein subunit SdhB into the SDH catalytic dimer (By similarity).
subunit: Interacts with SdhA in its FAD-bound form.
CG15283 uncharacterized protein from Drosophila melanogaster
Aligns to 77:126 / 126 (39.7%), covers 92.0% of PF07896, 73.1 bits
- Enhancer modeling uncovers transcriptional signatures of individual cardiac cell states in Drosophila
Busser, Nucleic acids research 2015 - “...well as genomic regions spanning the transcriptional start sites of Aur ( K ) and CG15283 ( P ) and the intergenic sequence between tsh and CG11629 (L) are shown. A complete annotation of tested genomic coordinates and enhancer activities is shown in Supplementary Table S3....”
- Novel regulators of planar cell polarity: a genetic analysis in Drosophila
Weber, Genetics 2012 - “...al. Interestingly, CG31687, an APC8 paralog, and CG15283 encode proteins potentially involved in protein modification and/or degradation, possibly affecting...”
- “...CG13400 Su (chir)b Enh (rota) Su (rota + chir)b CG15283, CG4491, noc, CG15284, CG3474 Enh (rota) Nob CG31683, CG31687, CG18858 Pk Pk CG7004 Enh (rota) Enh (rota...”
- Loss of the starvation-induced gene Rack1 leads to glycogen deficiency and impaired autophagic responses in Drosophila
Erdi, Autophagy 2012 - “...i on-up r eg u lated p rotein). Interestingly, expression of Sirup and its paralog CG15283 was also induced during developmental autophagy of the fat body. 15 Of the 20 genes showing the strongest downregulation, only two were found in all three genotypes: CG15615 encoding an...”
- Gene expression profiling identifies FKBP39 as an inhibitor of autophagy in larval Drosophila fat body
Juhász, Cell death and differentiation 2007 - “...represented on our chip, including Tor, CG12334/ Atg8b, and CG15283, which encodes a ubiquitin-like protein highly similar to CG7224. As shown in Table 3, these...”
- “...genes during developmental autophagy Gene Microarray QRT-PCR Atg8a CG15283 CG7224 Atg8b CathD Tor CG8286/dIPK FKBP39 Baldspot 1.86 Not on chip 2.73 Not on chip...”
SDHF4_YEAST / P38345 Succinate dehydrogenase assembly factor 4, mitochondrial; SDH assembly factor 4; SDHAF4; Found in mitochondrial proteome protein 21 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 3 papers)
YBR269C Fmp21p from Saccharomyces cerevisiae
Aligns to 94:138 / 138 (32.6%), covers 74.0% of PF07896, 62.5 bits
- function: Plays an essential role in the assembly of succinate dehydrogenase (SDH), an enzyme complex (also referred to as respiratory complex II) that is a component of both the tricarboxylic acid (TCA) cycle and the mitochondrial electron transport chain, and which couples the oxidation of succinate to fumarate with the reduction of ubiquinone (coenzyme Q) to ubiquinol. Binds to the flavoprotein subunit SDH1 in its FAD-bound form, blocking the generation of excess reactive oxygen species (ROS) and facilitating its assembly with the iron-sulfur protein subunit SDH2 into the SDH catalytic dimer.
subunit: Interacts with SDH1 in its FAD-bound form. - Insight into the Antioxidant Effect of Fermented and Non-Fermented Spirulina Water and Ethanol Extracts at the Proteome Level Using a Yeast Cell Model
Masten, Antioxidants (Basel, Switzerland) 2021 - “...Pyridoxal phosphate homeostasis protein (Ybl036c) Homeostatic regulation of the active form of vitamin B6 SDH8 P38345 Succinate dehydrogenase assembly factor 4, Mitochondrial (Sdh8) Response to reactive oxygen species RPL13B P40212 60S ribosomal protein L13-B (Rpl13b) Autophagy RPL14A P36105 60S ribosomal protein L14-A (Rpl14a) Autophagy CUE5 Q08412...”
- A role for the budding yeast separase, Esp1, in Ty1 element retrotransposition
Ho, PLoS genetics 2015 - “...YFL001W DEG1 k SL Promote YDL160C DHH1 a , d , k SDL Promote Promote YBR269C FMP21 k SL Inhibit YOR202W HIS3 a SL Promote YGL194C HOS2 e SL Promote YDL115C IWR1 c SL Promote YPL125W KAP120 k SL Promote YOR123C LEO1 b SL Inhibit YPL055C...”
- Identification of a gene, FMP21, whose expression levels are involved in thermotolerance in Saccharomyces cerevisiae
Nakamura, AMB Express 2014 - “...GCAATTTTTGCGGGTTTCCTTA PRM5 ( YIL117C ) prm5-R TCGTCGCTCGATAACGGTA PRM5 ( YIL117C ) YBR269C-F TCGCAAGAGGCAATAGATCAG FMP21 ( YBR269C ) YBR269C-R TCGAATTCAGGTATGGTCTTGG FMP21 ( YBR269C ) Act1-F AGCCTTCTACGTTTCCATCC ACT1 Act1-R CTTTCAGCAGTGGTGGAGAA ACT1 Construction of the FMP21 -overexpressing strain URA3-F CAGGGTCCATAAAGCTTT URA3-R TTTATAAAGGCCATGAAGCT TDH3 pro-F GGAAAGAAAAAGCTTCATGGCCTTTATAAAAACACGCTTTTTCAGTTC TDH3 pro-R TTTGTTTGTTTATGTGTGTT FMP21-A...”
- “...strains (Table 2 ). The fold-change values of YER034W , YIL117C ( PRM5 ) and YBR269C ( FMP21 ) were more clearly correlated with the rank order of thermotolerance. We thus chose YER034W , PRM5 and FMP21 as candidate thermotolerance-related genes. Table 2 Selected genes and...”
- Identification of the yeast cytidine deaminase CDD1 as an orphan C-->U RNA editase
Dance, Nucleic acids research 2001 - “...TI/TT 19. IRA1 4843 cattaaggCataaGATCAGTATA HY 20. YBR269C 191 gcaagaggCaataGATCAGTATA AV 21. FKH2 2564 cggatggtgCaaaGATCAGTATt AV 22. IAH1 78...”
RSP_1104 hypothetical protein from Rhodobacter sphaeroides 2.4.1
Aligns to 14:62 / 62 (79.0%), covers 90.0% of PF07896, 60.0 bits
- Convergence of the transcriptional responses to heat shock and singlet oxygen stresses
Dufour, PLoS genetics 2012 - “...element functions Transposon functions RSP_3007 Unknown function Unknown function RSP_0126, RSP_0362, RSP_0363, RSP_0408, RSP_0719, RSP_0999, RSP_1104, RSP_1193, RSP_1204, RSP_1238, RSP_1241, RSP_1360, RSP_1406, RSP_1549, RSP_1563, RSP_1573, RSP_1581, RSP_1615, RSP_1671, RSP_1684, RSP_1743, RSP_1852, RSP_2121, RSP_2125, RSP_2214, RSP_2219, RSP_2387, RSP_2638, RSP_2640, RSP_2641, RSP_2739, RSP_2763, RSP_2764, RSP_2816, RSP_2952, RSP_2953, RSP_3067,...”
AT5G67490 hypothetical protein from Arabidopsis thaliana
NP_569049 succinate dehydrogenase assembly factor from Arabidopsis thaliana
Aligns to 35:108 / 108 (68.5%), covers 62.0% of PF07896, 59.1 bits
- The mitochondrial LYR protein SDHAF1 is required for succinate dehydrogenase activity in Arabidopsis
Li, The Plant journal : for cell and molecular biology 2022 - “...Only SDHAF1, SDHAF2, and SDHAF4 have direct orthologs in plants and SDHAF2 (At5g51040) and SDHAF4 (At5g67490) have been characterized previously (Belt etal., 2018 ; Huang etal., 2013 ). SDHAF2 was shown to be involved in the insertion of the FAD cofactor within SDH1 (Huang etal., 2013...”
- “...ACCESSION NUMBERS SDHAF1 (At2g39725), SDH1.1 (AT5g66760), SDH1.2 (AT2g18450) SDH2.1 (AT3g27380), SDH2.2 (AT5g40650), SDHAF2 (AT5g51040), SDHAF4 (AT5g67490), SDH3.1 (At4g42210), SDH3.2 (At5g09600), SDH4 (At2g46505), SDH5 (At1g47420), SDH6 (At1g08480), SDH7.1 (AT3g47833), SDH7.2 (At5g62575), SDH8 (AT2g46390), ISU1 (At4g22220), HSCB (At5g06410). AUTHOR CONTRIBUTIONS SH and MWM conceived the study and designed...”
- An Assembly Factor Promotes Assembly of Flavinated SDH1 into the Succinate Dehydrogenase Complex
Belt, Plant physiology 2018 (PubMed)- “...we report the identification of Arabidopsis (Arabidopsis thaliana) At5g67490 as a second SDH assembly factor. Knockout of At5g67490 (sdhaf4) did not cause any...”
- “...Based on sequence homology, a gene in Arabidopsis (At5g67490, herein named SDHAF4) with 1440 a yet unknown function was identified. To investigate the role...”
- Novel disease susceptibility factors for fungal necrotrophic pathogens in Arabidopsis
Dobón, PLoS pathogens 2015 - “...At5g62380, At1g12260, At2g44745, At4g39410, At1g74660, At5g18090, At5g03460, At4g33960, At4g05070, At3g13845, At2g32210, At1g67865, At1g67860, At1g65490, At1g16515, At5g67490, At2g15050, At1g25275, At4g21620, At5g56100, At2g05520, At3g13520, At1g55330, At5g40730, At5g58650, At3g44735, At1g67265, At2g24040, At3g49780, At5g65870, At3g16570, At3g23805, At4g14010, At4g15800, At3g25717, At1g07490, At4g13395, At5g24105, At3g61640, At2g46330, At3g13520 Supporting Information S1 Fig Coexpression...”
- “...at 28 days after sowing. (TIF) Click here for additional data file. S9 Fig provir7 (At5g67490), provir9 (At2g15050), provir12-1 (At2g32210), provir2-2 (At2g32210) and grp (At2g05520) T-DNA insertion mutants. The provir7 mutant (strain GK-857H02) carries a T-DNA insertion internal to the unique exon and therefore disrupts the...”
- Conserved features of germination and polarized cell growth: a few insights from a pollen-fern spore comparison
Bushart, Annals of botany 2007 - “...AT2G29040, AT2G32910, AT4G10440, AT1G64980, AT2G28370, AT4G22310, AT4G28050, AT4G31420, AT4G39230, AT5G67490 No. of Ceratopteris ESTs* 4 3 3 2 2 2 2 2 2 1 1 1 1...”
- An Assembly Factor Promotes Assembly of Flavinated SDH1 into the Succinate Dehydrogenase Complex.
Belt, Plant physiology 2018 - GeneRIF: At5g67490 (SDHAF4) acts on FAD-SDH1 and promotes its assembly with SDH2, thereby stabilizing SDH2 and enabling its full assembly with SDH3/SDH4 to form the SDH complex.
RC0209 unknown from Rickettsia conorii str. Malish 7
Aligns to 51:93 / 93 (46.2%), covers 68.0% of PF07896, 49.1 bits
RP167 unknown from Rickettsia prowazekii str. Madrid E
Aligns to 34:78 / 78 (57.7%), covers 60.0% of PF07896, 46.9 bits
- Genome-wide screen for temperature-regulated genes of the obligate intracellular bacterium, Rickettsia typhi
Dreher-Lesnick, BMC microbiology 2008 - “...1.8, 1.5) RT0551 rickettsial conserved hypothetical protein [Rickettsia typhi str. Wilmington] 1.7 (1.4, 1.8, 1.6) RP167 no corresponding annotation for R. typhi 1.9 (2.9, 1.7, 1.4) RT0160 rickettsial conserved hypothetical protein [Rickettsia typhi str. Wilmington] 2.0 (2.4, 1.3, 2.1) RT0222 hypothetical protein RT0222 [Rickettsia typhi str....”
- Complete genome sequence of Rickettsia typhi and comparison with sequences of other rickettsiae
McLeod, Journal of bacteriology 2004 - “...None RC0160 RC0139 None None RC0076 RC0049 RC0042 RC0033 RP167 RP191 None None None RP257 RP304 None RP331 RP346 RC0209 RC0240 RC0276 None RC0295 RC0343 RC0408...”
Or search for genetic data about PF07896 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory