Family Search for PF08550 (DUF1752)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF08550 hits 46 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
SS1G_05040 hypothetical protein from Sclerotinia sclerotiorum 1980 UF-70
Aligns to 137:164 / 901 (3.1%), covers 100.0% of PF08550, 52.0 bits
- Proteomics Analysis of SsNsd1-Mediated Compound Appressoria Formation in Sclerotinia sclerotiorum
Li, International journal of molecular sciences 2018 - “..., nine proteins are predicted to containing GATA-type DNA domains: SS1G_1036, SS1G_11953, SS1G_12238, SS1G_03252, SS1G_08523, SS1G_05040, SS1G_09784, SS1G_03775, and SS1G_01151 [ 4 , 42 ]. The BLASTX program at NCBI ( http://www.ncbi.nlm.nih.gov/ ) was employed to search for the homologs of the sequence of the SsNsd1...”
UMAG_10417 uncharacterized protein from Ustilago maydis 521
Aligns to 504:531 / 1374 (2.0%), covers 100.0% of PF08550, 51.3 bits
- Identifying Genes Devoted to the Cell Death Process in the Gene Regulatory Network of Ustilago maydis
Soberanes-Gutiérrez, Frontiers in microbiology 2021 - “...UMAG_02449 (BHLH domain-containing protein), UMAG_03536 (hypothetical protein), UMAG_06256 (Zn(2)-C6 fungal-type domain-containing protein), UMAG_02835 (hypothetical protein), UMAG_10417 (hypothetical protein), UMAG_03280 (hypothetical protein), UMAG_10426 (pH-response TF pacC), UMAG_10368 (hypothetical protein), UMAG_01597 (Uncharacterized protein), and UMAG_15042 (Cell pattern formation-associated protein ust1). From the 219 TFs in the GRN of...”
- “...the highest number of additional TFs (158, 106, and 100 regulated TFs, respectively). UMAG_02357, UMAG_02835, UMAG_10417, and UMAG_05773 were the TFs most regulated by other TFs, with 21, 20, 20, and 20 regulatory TFs, respectively ( Table 3 ). TABLE 3 General properties of the regulatory...”
- Investigating the Smuts: Common Cues, Signaling Pathways, and the Role of MAT in Dimorphic Switching and Pathogenesis
Kijpornyongpan, Journal of fungi (Basel, Switzerland) 2020 - “...Hos2 UMAG_11828 Khd4 UMAG_03837 Kin1 UMAG_04218 Kin3 UMAG_06251 Mcs1 UMAG_03204 Med1 UMAG_03588 Myo5 UMAG_04555 Nit2 UMAG_10417 Pac2 UMAG_15096 Prf1 UMAG_02713 Rac1 UMAG_00774 Rak1 UMAG_10146 Rbf1 UMAG_03167 Rop1 UMAG_12033 Ros1 UMAG_05853 Rrm4 UMAG_03494 Sep3 UMAG_03449 Tea1 UMAG_15019 Tea4 UMAG_01012 Tup1 UMAG_03280 Yup1 UMAG_05406...”
MAC_00939 nitrogen response regulator from Metarhizium acridum CQMa 102
Aligns to 109:136 / 961 (2.9%), covers 96.4% of PF08550, 51.1 bits
- The C2H2 Zinc Finger Protein MaNCP1 Contributes to Conidiation through Governing the Nitrate Assimilation Pathway in the Entomopathogenic Fungus Metarhizium acridum
Li, Journal of fungi (Basel, Switzerland) 2022 - “...site of MaNCP1 ( Figure 4 A). In addition, the transcription level of MaAreA ( MAC_00939 ) in MaNCP1 background was significantly down-regulated under both SYA and SYA+N conditions ( Figure 4 B), indicating that MaAreA was a MaNCP1 -dependent expression gene. Furthermore, the Y187 (pHIS2-...”
- MaNCP1, a C2H2 Zinc Finger Protein, Governs the Conidiation Pattern Shift through Regulating the Reductive Pathway for Nitric Oxide Synthesis in the Filamentous Fungus Metarhizium acridum
Li, Microbiology spectrum 2022 - “...MaNCP1. Subsequently, three core genes of the NCR pathway of M. acridum , MaAreA ( MAC_00939 ) (Fig.S8A and B), MaAreB ( MAC_07065 ) ( 37 ) and MaNmrA ( MAC_00749 ) ( 38 ) were selected for further analyses. A qRT-PCR analysis of the expression...”
K9G1P2 GATA transcriptional activator AreA from Penicillium digitatum (strain PHI26 / CECT 20796)
Aligns to 91:118 / 873 (3.2%), covers 100.0% of PF08550, 50.2 bits
- Regulation of Morphology, Aflatoxin Production, and Virulence of Aspergillus flavus by the Major Nitrogen Regulatory Gene areA
Fasoyin, Toxins 2019 - “...(A1CMX8), A. niger (O13412), A. nomius (A0A0L1IRC7), A. terreus (Q0CGC8), Neosartorya fischeri (A1DL08), Penicillium digitatum (K9G1P2), Talaromyces marneffei (A0A093VHJ1), and Acremonium chrysogenum (S5YAT5) were obtained from UniProt ( www.uniprot.org ). The phylogenetic tree was constructed with the downloaded sequences, using MEGA 5.1 software [ 61 ]....”
Pc22g24480 uncharacterized protein from Penicillium rubens
Aligns to 84:111 / 865 (3.2%), covers 100.0% of PF08550, 50.2 bits
CCM_03599 Nitrogen regulatory protein areA from Cordyceps militaris CM01
Aligns to 98:125 / 857 (3.3%), covers 96.4% of PF08550, 50.0 bits
- Construction of Light-Responsive Gene Regulatory Network for Growth, Development and Secondary Metabolite Production in Cordyceps militaris
In-On, Biology 2022 - “...177 1 0.33 up CCM_09124 bZIP TF (AtfA) (putative) 159 2 6 0 0.15 down CCM_03599 Nitrogen regulatory protein AreA 152 0 11 0 0.27 up CCM_02994 Nitrogen assimilation TF NirA 70 20 52 1 0.49 up CCM_04650 Start control protein Cdc10 72 0 55 3...”
- Hydrophobin CmHYD1 Is Involved in Conidiation, Infection and Primordium Formation, and Regulated by GATA Transcription Factor CmAreA in Edible Fungus, Cordyceps militaris
Li, Journal of fungi (Basel, Switzerland) 2021 - “...transcript factor in fungi ( Figure S4B ). The transcript levels of Cmhyd1 and Cmarea (CCM_03599) were spatially and temporally coincident during all developmental stages of C. militaris , including mycelium (MY), sclerotium (ST), young primordium (YPR), primordium (PR), young fruiting body (YF), down part of...”
CNA01820 transcriptional activator from Cryptococcus neoformans var. neoformans JEC21
Aligns to 587:614 / 1290 (2.2%), covers 96.4% of PF08550, 49.5 bits
CNAG_00193 GATA type zinc finger protein asd-4 from Cryptococcus neoformans var. grubii H99
Aligns to 584:611 / 1277 (2.2%), covers 96.4% of PF08550, 49.4 bits
ATEG_07264 nitrogen regulatory protein areA from Aspergillus terreus NIH2624
Q0CGC8 Nitrogen regulatory protein areA from Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Aligns to 58:85 / 817 (3.4%), covers 100.0% of PF08550, 49.1 bits
- Phytotoxin production in Aspergillus terreus is regulated by independent environmental signals
Gressler, eLife 2015 - “...cross pathway control of amino acid synthesis, and stress response. The global nitrogen regulator AreA (ATEG_07264) ( Arst and Cove, 1973 ; Hynes, 1975 ; Davis et al., 2005 ), the cross pathway control regulator CpcA (ATEG_03131) ( Hoffmann et al., 2001 ; Krappmann et al.,...”
- “...the rhbA locus (ATEG_09480) in SBUG844 akuB. ( F ) Deletion of the areA locus (ATEG_07264) in SBUG844 akuB and complementation with FGSC A1156 areA . ( G ) PCR and Pst I digest of PCR products from the areA upstream fragments amplified from genomic DNA...”
- Regulation of Morphology, Aflatoxin Production, and Virulence of Aspergillus flavus by the Major Nitrogen Regulatory Gene areA
Fasoyin, Toxins 2019 - “...(A0A0J5PGE9), A. parasiticus (Q9Y7E8), A. clavatus (A1CMX8), A. niger (O13412), A. nomius (A0A0L1IRC7), A. terreus (Q0CGC8), Neosartorya fischeri (A1DL08), Penicillium digitatum (K9G1P2), Talaromyces marneffei (A0A093VHJ1), and Acremonium chrysogenum (S5YAT5) were obtained from UniProt ( www.uniprot.org ). The phylogenetic tree was constructed with the downloaded sequences, using...”
A1CMX8 GATA transcriptional activator AreA from Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Aligns to 100:127 / 879 (3.2%), covers 100.0% of PF08550, 49.1 bits
- Regulation of Morphology, Aflatoxin Production, and Virulence of Aspergillus flavus by the Major Nitrogen Regulatory Gene areA
Fasoyin, Toxins 2019 - “...and A. oryzae (O13415), A. nidulans (P17429), A. fumigatus (A0A0J5PGE9), A. parasiticus (Q9Y7E8), A. clavatus (A1CMX8), A. niger (O13412), A. nomius (A0A0L1IRC7), A. terreus (Q0CGC8), Neosartorya fischeri (A1DL08), Penicillium digitatum (K9G1P2), Talaromyces marneffei (A0A093VHJ1), and Acremonium chrysogenum (S5YAT5) were obtained from UniProt ( www.uniprot.org ). The...”
A1DL08 GATA transcriptional activator AreA from Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Aligns to 101:128 / 882 (3.2%), covers 100.0% of PF08550, 49.1 bits
- Regulation of Morphology, Aflatoxin Production, and Virulence of Aspergillus flavus by the Major Nitrogen Regulatory Gene areA
Fasoyin, Toxins 2019 - “...(Q9Y7E8), A. clavatus (A1CMX8), A. niger (O13412), A. nomius (A0A0L1IRC7), A. terreus (Q0CGC8), Neosartorya fischeri (A1DL08), Penicillium digitatum (K9G1P2), Talaromyces marneffei (A0A093VHJ1), and Acremonium chrysogenum (S5YAT5) were obtained from UniProt ( www.uniprot.org ). The phylogenetic tree was constructed with the downloaded sequences, using MEGA 5.1 software...”
AFUA_6G01970, Afu6g01970 GATA transcriptional activator AreA from Aspergillus fumigatus Af293
Aligns to 101:128 / 881 (3.2%), covers 100.0% of PF08550, 49.1 bits
- The New GPI-Anchored Protein, SwgA, Is Involved in Nitrogen Metabolism in the Pathogenic Filamentous Fungus Aspergillus fumigatus
Samalova, Journal of fungi (Basel, Switzerland) 2023 - “...USA) following the instructions of the manufacturer. The gene expression levels of swgA and areA (AFUA_6G01970) were quantified by PCR using the same amount of cDNA obtained in the different liquid media MM-NH 4+ , RPMI-1640+Gln (containing L-glutamine), RPMI-1640 (RPMI without L-glutamine) and MM, without ammonium...”
- “...3.4. swgA Is Involved in Nitrogen Metabolism and Is Regulated by the Transcription Factor AreA (AFUA_6G01970) To investigate the putative function of SwgA in nutritional metabolism, the growth of the mutants was compared in several different liquid media at 37 C after 27 h or 30...”
- Distinct Cohorts of Aspergillus fumigatus Transcription Factors Are Required for Epithelial Damage Occurring via Contact- or Soluble Effector-Mediated Mechanisms
Rahman, Frontiers in cellular and infection microbiology 2022 - “...( pacC ) pH response, epithelial invasion Bertuzzi etal., 2014 AFUB_031000 AFUA_2G15340 1H8 Unknown AFUB_096370 AFUA_6G01970 7G8 ( areA ) Nitrogen utilization Krappmann and Braus, 2005 AFUB_033930 AFUA_3G15290 2A3 (BGC12) Secondary metabolite production Bignell et al. 2016 AFUB_089440 AFUA_7G03910 5H5 ( nsdC ) Early stage of...”
- Determining Aspergillus fumigatus transcription factor expression and function during invasion of the mammalian lung
Liu, PLoS pathogens 2021 - “...Nitrogen uptake Afu1g17470 nrtB Putative high-affinity nitrate transporter 461.99 16.95 32.20 13 6162 226 429 Afu6g01970 areA Putative GATA-like transcription factor; required for growth on numerous nitrogen sources 0.00 1.71 2.08 1891 0 3234 3934 Afu5g00710 GABA permease 9.63 45.45 39.14 168 1616 7633 6572 Stress...”
- Nitrogen, Iron and Zinc Acquisition: Key Nutrients to Aspergillus fumigatus Virulence
Perez-Cuesta, Journal of fungi (Basel, Switzerland) 2021 - “...Afu6g08000 amdS Unknown Unknown Putative glutamate dehydrogenase Afu4g06620 gdhA Unknown Unknown Nitrogen GATA-like transcription factor Afu6g01970 areA Decreased utilization of nitrogen sources Decreased [ 24 ] Putative nitrogen metabolite repression regulator Afu5g02920 nmrA Unknown Unknown Putative co-activator of areA Afu3g08050 tamA Unknown Unknown Putative nitrogen GATA-like...”
- Aspergillus fumigatus virulence through the lens of transcription factors
Bultman, Medical mycology 2017 - “...AreA CpcA CrzA Afu3g11250 Afu2g05830 Afu2g12330 Afu6g01970 Afu4g12470 Afu1g06900 Conidial formation, cell wall architecture Gluconeogenesis, iron acquisition...”
- Transcriptomic analysis of the exit from dormancy of Aspergillus fumigatus conidia
Lamarre, BMC genomics 2008 - “...[ 28 ]. Among the genes putatively associated with TOR we can cite the GATA (Afu6g01970) and forkhead transcription factors (Afu3g10030) or genes of the leucine biosynthesis (Afu1g15000, Afu2g11260, Afu1g15780). The need for intracellular detoxification was also suggested by the up-regulation of MFS (Afu1g03200) and ABC...”
AREA_ASPOR / O13415 Nitrogen regulatory protein areA from Aspergillus oryzae (strain ATCC 42149 / RIB 40) (Yellow koji mold) (see paper)
Aligns to 99:126 / 866 (3.2%), covers 100.0% of PF08550, 49.0 bits
- function: Major nitrogen regulatory protein. Positively acting regulatory gene of nitrogen metabolite repression.
- Regulation of Morphology, Aflatoxin Production, and Virulence of Aspergillus flavus by the Major Nitrogen Regulatory Gene areA
Fasoyin, Toxins 2019 - “...The AreA protein sequences of A. flavus (AFLA_049870) were obtained from FungiDB, and A. oryzae (O13415), A. nidulans (P17429), A. fumigatus (A0A0J5PGE9), A. parasiticus (Q9Y7E8), A. clavatus (A1CMX8), A. niger (O13412), A. nomius (A0A0L1IRC7), A. terreus (Q0CGC8), Neosartorya fischeri (A1DL08), Penicillium digitatum (K9G1P2), Talaromyces marneffei (A0A093VHJ1),...”
AREA_EMENI / P17429 Nitrogen regulatory protein areA from Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) (Aspergillus nidulans) (see 6 papers)
areA / GB|CAA36731.1 nitrogen regulatory protein areA from Emericella nidulans (see 14 papers)
XP_681936 nitrogen-responsive transcriptional regulator areA from Aspergillus nidulans FGSC A4
Aligns to 105:132 / 876 (3.2%), covers 96.4% of PF08550, 49.0 bits
- function: Transcription activator that binds the consensus DNA element 5'-CGATAG-3' and mediates nitrogen metabolite repression. Activates the transcription of uapA.
subunit: Interacts with nmrA. - CharProtDB Description: GATA-type transcription factor that mediates nitrogen metabolite repression; transcript induced by nitrogen starvation and is degraded in response to ammonium or glutamine; AreA accumulates in the nucleus in response to nitrogen starvation; Source:AspGD
- Multiple nuclear localization signals mediate nuclear localization of the GATA transcription factor AreA.
Hunter, Eukaryotic cell 2014 - GeneRIF: Multiple nuclear localization signals mediate nuclear localization of the GATA transcription factor AreA.
- The GATA factors AREA and AREB together with the co-repressor NMRA, negatively regulate arginine catabolism in Aspergillus nidulans in response to nitrogen and carbon source.
Macios, Fungal genetics and biology : FG & B 2012 (PubMed)- GeneRIF: AREA and AREB together with the co-repressor NMRA negatively regulate arginine catabolism in response to nitrogen and carbon source.
- Dissecting individual steps of nitrogen transcription factor cooperation in the Aspergillus nidulans nitrate cluster.
Berger, Molecular microbiology 2008 (PubMed)- GeneRIF: AreA mediates chromatin remodelling by increasing histone H3 acetylation, a process triggered by transcriptional activation and, independently of transcription, by nitrogen starvation.
- The GATA transcription factor GNC plays an important role in photosynthesis and growth in poplar.
An, Journal of experimental botany 2020 - “...proteins and nucleotide sequences were obtained from different resources: chicken GATA1 (AAA49055), Aspergillus nidulans AreA (P17429), Neurospora crassa WC1 (Q01371), and all 30 documented GATA family genes of Arabidopsis ( Reyes et al. , 2004 ). A keyword search was performed in Phytozome (http:// www.phytozome.net )...”
- Regulation of Morphology, Aflatoxin Production, and Virulence of Aspergillus flavus by the Major Nitrogen Regulatory Gene areA.
Fasoyin, Toxins 2019 - “...sequences of A. flavus (AFLA_049870) were obtained from FungiDB, and A. oryzae (O13415), A. nidulans (P17429), A. fumigatus (A0A0J5PGE9), A. parasiticus (Q9Y7E8), A. clavatus (A1CMX8), A. niger (O13412), A. nomius (A0A0L1IRC7), A. terreus (Q0CGC8), Neosartorya fischeri (A1DL08), Penicillium digitatum (K9G1P2), Talaromyces marneffei (A0A093VHJ1), and Acremonium chrysogenum...”
- Comprehensive Analysis of Aspergillus nidulans PKA Phosphorylome Identifies a Novel Mode of CreA Regulation.
Ribeiro, mBio 2019 - “...Transcription factors equally transcribed and phosphorylated only in the WT Phosphopeptide Uniprot Gene Protein TSSTPNTAQLLR P17429 areA AN8667 Nitrogen regulatory protein AreA SIDTQASRPPTMQPASQTSGDNTSTDSR Q5AU19 AN8211.2 ANIA_08211 PHD transcription factor (Rum1) AASESMDLSSDDKESGER Q00202 pacC AN2855 pH response transcription factor PacC/RIM101 AESPEASTEAEPFEER Q5BCK1 AN1729.2 ANIA_01729 PrnA protein ALLDPTEIIQSPSSAKK...”
- Genome-wide survey of the soybean GATA transcription factor gene family and expression analysis under low nitrogen stress.
Zhang, PloS one 2015 - “...sequence of four GATA factors from different origins [ Arabidopsis AtGATA1 (CAA73999), Aspergillus nidulans AreA (P17429), N . crassa WC1 (Q01371), and chicken GATA1 (AAA49055)] as queries as previously described [ 6 ]. All sequences with an E -value below 1.0 were collected. A keyword search...”
- Genomic and secretomic analyses reveal unique features of the lignocellulolytic enzyme system of Penicillium decumbens.
Liu, PloS one 2013 - “...( Aspergillus aculeatus ) BAM36047 + [90] PDE_04311 Not found AreA ( A. nidulans ) P17429 + [91] PDE_03334 76817 CREI ( T. reesei ) CAA64655 [92] PDE_03168 120117 ACEI ( T. reesei ) AAF35286 [93] PDE_01988 75418 PacC ( A. nidulans ) Q00202 Gene-dependent [94]...”
O13412 Nitrogen regulatory protein areA from Aspergillus niger
Aligns to 109:136 / 882 (3.2%), covers 100.0% of PF08550, 48.9 bits
- Regulation of Morphology, Aflatoxin Production, and Virulence of Aspergillus flavus by the Major Nitrogen Regulatory Gene areA
Fasoyin, Toxins 2019 - “...(O13415), A. nidulans (P17429), A. fumigatus (A0A0J5PGE9), A. parasiticus (Q9Y7E8), A. clavatus (A1CMX8), A. niger (O13412), A. nomius (A0A0L1IRC7), A. terreus (Q0CGC8), Neosartorya fischeri (A1DL08), Penicillium digitatum (K9G1P2), Talaromyces marneffei (A0A093VHJ1), and Acremonium chrysogenum (S5YAT5) were obtained from UniProt ( www.uniprot.org ). The phylogenetic tree was...”
An12g08960 regulator of nitrogen metabolite repression areA-Aspergillus niger [putative sequencing error] from Aspergillus niger
Aligns to 109:136 / 879 (3.2%), covers 100.0% of PF08550, 48.9 bits
- Comparative transcriptome analysis reveals different strategies for degradation of steam-exploded sugarcane bagasse by Aspergillus niger and Trichoderma reesei
Borin, BMC genomics 2017 - “...pH transcription regulator, also involved in cellulose gene expression [ 140 , 141 ] areA An12g08960 140814 - - A global nitrogen metabolism regulator, with influence on cellulase production [ 142 ] We also found that the transcriptional activator rhaR, involved in pectin degradation, was induced...”
- Spatial differentiation of gene expression in Aspergillus niger colony grown for sugar beet pulp utilization
Benoit, Scientific reports 2015 - “...genes did not show differential expression, one transcription factor, the global nitrogen transcription activator AreA (An12g08960) 17 , showed higher expression at the colony centre. Nitrate is the most abundant nitrogen source in sugar beet pulp media. In A. niger , nitrate is thought to be...”
- Trancriptional landscape of Aspergillus niger at breaking of conidial dormancy revealed by RNA-sequencing
Novodvorska, BMC genomics 2013 - “...9.34 n/a An11g06140 proline utilisation protein ( A. nidulans prnC ) 3.67 1.68 70.97 42.24 An12g08960 areA , transcription factor no change 2 23.9 12.21 1.95 An11g00450 nitrate transport protein 79.28 8.41 909.98 108.20 An08g05610 niaD , nitrate reductase 5.51 2.19 22.31 10.18 An08g05640 niiA ,...”
- “...induction is strictly dependent on the synergistic action of transcription factors NirA (An18g02330) and AreA (An12g08960) [ 43 ]. The RNA-seq data showed that transcript levels for both of these genes were higher in dormant conidia. The gdhA gene (An04g00990) encoding NADPH-dependent glutamate dehydrogenase exhibited an...”
- Identification of a mitotic recombination hotspot on chromosome III of the asexual fungus Aspergillus niger and its possible correlation with [corrected] elevated basal transcription
van, Current genetics 2007 - “...of mutation No complementation of mutations Position of the ORF (kb) End of An12 2562 An12g08960 areA areAd 2131 An12g07690 lysA or lysE lysA7 1845 An12g03570 pyrA pyrA6 907 An12g01280 argD or argL argD6 L25 354 An12g01110 cysA cysA2 319 An12g00320 adeB E or G adeB2...”
Afu2g04170 conserved hypothetical protein from Aspergillus fumigatus Af293
Aligns to 31:58 / 587 (4.8%), covers 100.0% of PF08550, 48.2 bits
UV8b_04482 uncharacterized protein from Ustilaginoidea virens
Aligns to 85:112 / 952 (2.9%), covers 96.4% of PF08550, 47.9 bits
SPAC1420.01c DUF1752 family protein from Schizosaccharomyces pombe
Aligns to 33:60 / 580 (4.8%), covers 100.0% of PF08550, 47.9 bits
- Rapamycin-sensitive mechanisms confine the growth of fission yeast below the temperatures detrimental to cell physiology
Morozumi, iScience 2023 - “...involved in the expression of RTG target genes. 41 In fission yeast, open reading frame SPAC1420.01c encodes a protein with limited homology to budding yeast Mks1 with a conserved short stretch in the N-terminal region ( FigureS1 ). This Mks1-like protein in fission yeast has not...”
- “...39C. Not surprisingly, the screen re-isolated the sck1 mutant, along with the null mutants of SPAC1420.01c, dri1 + , SPBC17D1.05, and mtq2 + ( Figure3 A). Because the protein encoded by SPAC1420.01c has some homology to budding yeast Mks1 ( FigureS1 and introduction ), it is...”
NIT2_NEUCR / P19212 Nitrogen catabolic enzyme regulatory protein; Nitrogen regulatory protein 2; NIT2 from Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) (see paper)
NCU09068, XP_963796 nitrogen catabolic enzyme regulatory protein from Neurospora crassa OR74A
Aligns to 169:196 / 1036 (2.7%), covers 100.0% of PF08550, 47.8 bits
- function: Major nitrogen regulatory protein. During conditions of nitrogen limitation it turns on the expression of genes for enzymes which are required for the use of a variety of secondary nitrogen sources, including nitrates, purines, amino acids, and proteins.
subunit: Interacts with nmr. - Distribution, evolution and expression of GATA-TFs provide new insights into their functions in light response and fruiting body development of Tolypocladium guangdongense
Zhang, PeerJ 2020 - “...ANQ80444 ; BcWC-1, XP_024547291 ; CmWC-1, EGX96523 ; Ffcsm1, CCT68588 ; NcADS4, AAG45180 ; NcNIT2, P19212 ; NcSREA, EAA32742 ; NcSub-1, ESA42507 ; NcWC-1, Q01371 ; NcWC-2, EAA34583 ; OsWC-1, EQK98623 ; Ssams2, SS1G_03252; Sssfh1, SS1G_01151; SsNsd1, ANQ80447 . In order to confirm the photoreceptor roles...”
- Multiple nuclear localization signals mediate nuclear localization of the GATA transcription factor AreA
Hunter, Eukaryotic cell 2014 - “...oryzae NUT1 (AAB03415) (58), N. crassa NIT2 (P19212) (59), Penicillium chrysogenum Nre (AAA83400) (60), Penicillium roqueforti NmC (CAA04815) (61), S....”
- The Ustilago maydis Nit2 homolog regulates nitrogen utilization and is required for efficient induction of filamentous growth
Horst, Eukaryotic cell 2012 - “...carboxin. Sequence analysis. The N. crassa Nit2 protein sequence (P19212) was used in a BLASTP search (1) to identify Um10417 as a sequence homolog. Domains...”
- DNA affinity purification sequencing and transcriptional profiling reveal new aspects of nitrogen regulation in a filamentous fungus
Huberman, Proceedings of the National Academy of Sciences of the United States of America 2021 (secret) - ECHO: an application for detection and analysis of oscillators identifies metabolic regulation on genome-wide circadian output
De, Bioinformatics (Oxford, England) 2020 - “...be bound by two different transcription factors, nit-2 (NCU09068) and asd-4 (NCU15829), and their orthologs have been shown to co-regulate genes in response to...”
- Broad Substrate-Specific Phosphorylation Events Are Associated With the Initial Stage of Plant Cell Wall Recognition in Neurospora crassa
Horta, Frontiers in microbiology 2019 - “...Number of identified phospho-peptides Function Gene ID Protein name Number of identified phospho-peptides Transcription factors NCU09068 NIT-2 84 Two-component regulatory systems- HHs NCU00939 DCC-1 16 NCU10346 ADA-13 43 NCU01823 pc 16 NCU09315 NCU-1 23 NCU01833 NIK-2 3 NCU01345 ASL-1 20 NCU02057 pc 3 NCU03725 VIB-1 20...”
- “...from one up to several dozens of modified residues per TF. Thus, for example, NIT-2 (NCU09068) exhibited a total of 84 different phospho-peptides, which represents a total of 18 in vivo unambiguously modified S and T (with Ascore > 13: meaning a p -value for phosphosite...”
- Cold Shock as a Screen for Genes Involved in Cold Acclimatization in Neurospora crassa
Watters, G3 (Bethesda, Md.) 2018 - “...Component Organization or Biogenisis/ Cellular Process/Metabolic Process NCU09033 11390 zinc finger transcription factor-46 Transc Factors NCU09068 11392 nitrogen catabolic enzyme regulatory protein nit-2 Transc Factors NCU09071 12000 AGC/NDR protein kinase dbf2 Morph/Hyph Catalytic Activity Biological Regulation/Cellular Compoonent Organization or Biogenisis/Response to Stimulus/ Cellular Process/Metabolic Process NCU09123...”
- A fungal transcription factor essential for starch degradation affects integration of carbon and nitrogen metabolism
Xiong, PLoS genetics 2017 - “.... Three were annotated to be hypothetical, and the other three were vib-1 (NCU03725), nit-2 (NCU09068), and cpc-1 (NCU04050) ( Fig 3E ). VIB-1 ( v egetative i ncompatibility b lock-1) is required for extracellular protease secretion in response to both carbon and nitrogen starvation [...”
- Nuclear transport of the Neurospora crassa NIT-2 transcription factor is mediated by importin-α.
Bernardes, The Biochemical journal 2017 (PubMed)- GeneRIF: The crystal structure of the NIT-2/importin-alpha complex was solved and revealed that NIT-2 binds to importin-alpha, playing a major role in regulation.
- Multi-omics analysis reveals regulators of the response to nitrogen limitation in Yarrowia lipolytica
Pomraning, BMC genomics 2016 (no snippet) - Conserved and essential transcription factors for cellulase gene expression in ascomycete fungi
Coradetti, Proceedings of the National Academy of Sciences of the United States of America 2012 - “...on cellulase production were identified, including nit-2 (NCU09068, a homolog to the nitrogen regulator areA) (25), pacC Author contributions: S.T.C., J.P.C.,...”
- More
AFUA_8G02720 protein phosphatase type 1 complex subunit Hex2/Reg1, putative from Aspergillus fumigatus Af293
Aligns to 169:196 / 550 (5.1%), covers 100.0% of PF08550, 46.4 bits
- RNA-seq reveals the pan-transcriptomic impact of attenuating the gliotoxin self-protection mechanism in Aspergillus fumigatus
O'Keeffe, BMC genomics 2014 - “...0.987 2.166 0.010 AFUA_8G01150 - 0.037 0.997 3.345 0.001 AFUA_8G01940 - 1.248 0.221 1.846 0.027 AFUA_8G02720 - 0.032 0.997 1.848 0.001 AFUA_8G04130 farB1 0.496 0.798 1.898 0.001 AFUA_8G06460 - 0.005 0.998 1.741 0.009 AFUA_6G11740 - 0.919 0.475 7.145 0.004 AFUA_2G05180 - 0.361 0.891 3.819 0.001 AFUA_1G16600...”
- Conservation of nucleosome positions in duplicated and orthologous gene pairs
Nishida, TheScientificWorldJournal 2012 - “...AFUA_1G10880 0.706118907 YLR307W AFUA_6G10430 0.701428537 YOR056C AFUA_5G04000 0.693624039 YJR049C AFUA_5G12870 0.6873278 YOR132W AFUA_5G07150 0.684358232 YDR028C AFUA_8G02720 0.681519128 YKL059C AFUA_2G06220 0.677236775 YDR019C AFUA_1G10780 0.673590566 YDR262W AFUA_8G05360 0.668577442 YJR160C AFUA_3G01700 0.655149877 YBL087C AFUA_2G03380 0.654275917 YDR120C AFUA_3G04200 0.653965099 YMR110C AFUA_4G13500 0.649573592 YDR479C AFUA_2G01510 0.649340576 YLR307W AFUA_4G09940 0.641152119 YLL050C AFUA_5G10570...”
gaf1 / RF|NP_588278.2 transcription factor Gaf1 from Schizosaccharomyces pombe (see paper)
NP_588278 transcription factor Gaf1 from Schizosaccharomyces pombe
Q10280 Transcription factor gaf1 from Schizosaccharomyces pombe (strain 972 / ATCC 24843)
SPCC1902.01 transcription factor Gaf1 (PMID 9714831) from Schizosaccharomyces pombe
Aligns to 41:68 / 855 (3.3%), covers 96.4% of PF08550, 44.7 bits
CC1G_14145 transcription factor ScGATA-6 from Coprinopsis cinerea okayama7#130
Aligns to 361:388 / 1080 (2.6%), covers 100.0% of PF08550, 44.7 bits
- Molecular Mechanism by Which the GATA Transcription Factor CcNsdD2 Regulates the Developmental Fate of Coprinopsis cinerea under Dark or Light Conditions
Liu, mBio 2021 - “...-1,3-endoglucanase eglC in A. nidulans ( 33 , 34 ) as a query revealed CC1G_12230, CC1G_14145, CC1G_14734, CC1G_01569, and CC1G_01461 from the C. cinerea okayama7#130 genome as putative homologs in addition to previously reported homologs CC1G_06265 and CC1G_06391 (25). Of these, CC1G_06265 (named CcNsdD1) and CC1G_12230...”
- “...protein sequences in NCBI: C. cinerea NsdD1, CC1G_06265; C. cinerea NsdD2, CC1G_12230; C. cinerea NsdD3, CC1G_14145; C. cinerea NsdD4, CC1G_14734; C. cinerea NsdD5, CC1G_01569; C. cinerea NsdD6, CC1G_01461; C. cinerea NsdD7, CC1G_06391; Laccaria bicolor L297200, XP_001880936.1 (D. F. Plaza, et al., BMC Genomics 15:492, 2014 [10.1186/1471-2164-15-492]...”
CTRG_03831 hypothetical protein from Candida tropicalis MYA-3404
Aligns to 66:93 / 589 (4.8%), covers 96.4% of PF08550, 44.5 bits
- Transcriptional Control of Drug Resistance, Virulence and Immune System Evasion in Pathogenic Fungi: A Cross-Species Comparison
Pais, Frontiers in cellular and infection microbiology 2016 - “...Gat1. Subsequent BLASTp search showed the existence of a C. tropicalis homolog encoded by ORF CTRG_03831 . Nevertheless, the presence of Gat1 proteins is markedly conserved among fungal pathogens, which is specially reinforced by the conservation of the GATA DNA binding domain present in these proteins....”
- “...( A. fumigatus ) Virulence (nitrogen use) Gat1 ( C. albicans ) N.A. N.A. Gat1; CTRG_03831 * AreA ( A. fumigatus ) Virulence (pH and weak acid response) Rim101 ( C. albicans ) N.A. N.A. CPAR2_700450 PacC ( A. fumigatus ) Rim101 ( C. tropicalis )...”
CC1G_01569 GATA-binding factor 6-B from Coprinopsis cinerea okayama7#130
Aligns to 31:57 / 877 (3.1%), covers 92.9% of PF08550, 44.4 bits
- Molecular Mechanism by Which the GATA Transcription Factor CcNsdD2 Regulates the Developmental Fate of Coprinopsis cinerea under Dark or Light Conditions
Liu, mBio 2021 - “...in A. nidulans ( 33 , 34 ) as a query revealed CC1G_12230, CC1G_14145, CC1G_14734, CC1G_01569, and CC1G_01461 from the C. cinerea okayama7#130 genome as putative homologs in addition to previously reported homologs CC1G_06265 and CC1G_06391 (25). Of these, CC1G_06265 (named CcNsdD1) and CC1G_12230 (named CcNsdD2)...”
- “...C. cinerea NsdD2, CC1G_12230; C. cinerea NsdD3, CC1G_14145; C. cinerea NsdD4, CC1G_14734; C. cinerea NsdD5, CC1G_01569; C. cinerea NsdD6, CC1G_01461; C. cinerea NsdD7, CC1G_06391; Laccaria bicolor L297200, XP_001880936.1 (D. F. Plaza, et al., BMC Genomics 15:492, 2014 [10.1186/1471-2164-15-492] [24942908]); Schizophyllum commune S108660, XP_003032012.1 (D. F. Plaza,...”
FGSG_08634 nitrogen regulatory protein areA from Fusarium graminearum PH-1
Aligns to 114:141 / 964 (2.9%), covers 96.4% of PF08550, 44.3 bits
- Screening of Deoxynivalenol Producing Strains and Elucidation of Possible Toxigenic Molecular Mechanism
Zheng, Toxins 2017 - “...It also regulates DON synthesis and F. graminearum pathogenicity by regulating downstream transcription factor FgAreA (FGSG_08634) [ 26 ]. FgAtf1 is a transcription factor that plays a negative regulatory effect on DON synthesis [ 28 ]. The molecular mechanism underlying DON biosynthesis in F. graminearum has...”
- Fungal Innate Immunity Induced by Bacterial Microbe-Associated Molecular Patterns (MAMPs)
Ipcho, G3 (Bethesda, Md.) 2016 - “...matched the promoter sequence for GLN3 in yeast. The F. graminearum transcription factors FGSG_09565 , FGSG_08634 , and FGSG_16452 (formerly FGSG_05073) have similarities to GLN3. LOS, lipo-oligosaccharides; MAMPs, microbe-associated molecular patterns; PGN, peptidoglycans. Out of the 68 common MAMP genes, 26 genes had a GATA binding...”
- “...probable siderophore regulator (57% identity); FGSG_16452 (formerly FGSG_05073), an ASD4 related protein (60% identity); and/or FGSG_08634 (FgAreA) a global nitrogen regulator (77% identity) ( Table S14 ). Of the 57 genes commonly induced by both LOS and PGN, 16 genes had promoter sequences that had a...”
- Transcription factor ART1 mediates starch hydrolysis and mycotoxin production in Fusarium graminearum and F. verticillioides
Oh, Molecular plant pathology 2016 - “...et al., 2009). Furthermore, the expression of AREA (FGSG_08634), which is a global regulator of nitrogen metabolism, is responsible for the repression of...”
- The AreA transcription factor mediates the regulation of deoxynivalenol (DON) synthesis by ammonium and cyclic adenosine monophosphate (cAMP) signalling in Fusarium graminearum
Hou, Molecular plant pathology 2015 (secret) - Genomic clustering and co-regulation of transcriptional networks in the pathogenic fungus Fusarium graminearum
Lawler, BMC systems biology 2013 - “...# Enriched co-expression groups Enriched co-expression groups FGSG_04220 APSES 1 FG2.11 FGSG_10384 APSES 1 FG2.11 FGSG_08634 GATA 1 FG2.01 FGSG_00750 HLH 2 FG1, FG2.11 FGSG_01307 HLH 2 FG1, FG6 FGSG_02814 HLH 4 FG1, FG2.11, FG6, FG6 FGSG_05567 HLH 4 FG1, FG2.11, FG6, FG6 FGSG_09043 Homeobox/zf-C2H2 1...”
YIDF_SCHPO / Q9UTC4 Uncharacterized protein C227.15 from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see paper)
Aligns to 314:341 / 873 (3.2%), covers 100.0% of PF08550, 44.1 bits
P78688 Nitrogen regulatory protein areA from Gibberella fujikuroi
Aligns to 114:141 / 971 (2.9%), covers 96.4% of PF08550, 43.7 bits
S5YAT5 AreA-AC from Hapsidospora chrysogena
Aligns to 90:117 / 960 (2.9%), covers 96.4% of PF08550, 43.5 bits
Q9Y7E8 Major nitrogen regulatory protein from Aspergillus parasiticus
Aligns to 99:126 / 866 (3.2%), covers 100.0% of PF08550, 42.5 bits
- Regulation of Morphology, Aflatoxin Production, and Virulence of Aspergillus flavus by the Major Nitrogen Regulatory Gene areA
Fasoyin, Toxins 2019 - “...obtained from FungiDB, and A. oryzae (O13415), A. nidulans (P17429), A. fumigatus (A0A0J5PGE9), A. parasiticus (Q9Y7E8), A. clavatus (A1CMX8), A. niger (O13412), A. nomius (A0A0L1IRC7), A. terreus (Q0CGC8), Neosartorya fischeri (A1DL08), Penicillium digitatum (K9G1P2), Talaromyces marneffei (A0A093VHJ1), and Acremonium chrysogenum (S5YAT5) were obtained from UniProt (...”
FFUJ_06143 probable nitrogen catabolic enzyme regulatory protein NIT-2 from Fusarium fujikuroi IMI 58289
Aligns to 99:126 / 953 (2.9%), covers 96.4% of PF08550, 42.5 bits
SS1G_01711 hypothetical protein from Sclerotinia sclerotiorum 1980 UF-70
Aligns to 181:208 / 572 (4.9%), covers 100.0% of PF08550, 42.4 bits
An03g06820 uncharacterized protein from Aspergillus niger
Aligns to 164:191 / 568 (4.9%), covers 100.0% of PF08550, 41.6 bits
- Genome-wide transcription landscape of citric acid producing Aspergillus niger in response to glucose gradient
Zheng, Frontiers in bioengineering and biotechnology 2023 - “...7.75 An16g03740 cAMP/PKA pkaR 3 64.03 2.32 102.79 4.1 85.37 2.59 94.01 0.33 113.27 7.36 An03g06820 MAPK regA 4 52.28 1.62 24.66 0.58 22.57 0.03 20.2 0.10 21.44 0.89 An08g10670 MAPK mpkB 4 164.81 3.69 90.51 2.37 88.75 1.61 82.94 2.04 76.83 1.67 An07g03980 MAPK hogA...”
- “...(HP, An11g03170), and calmodulin CaM (An04g07010) were upregulated by the glucose increase. In contrast, RegA (An03g06820) and MpkB (An08g10670) in the nutrient-sensing MAPK signaling, and HogA (An07g03980) in the High Osmolarity Glycerol pathway (HOG) were significantly activated by the glucose depletion. Meanwhile, MpkC (An08g05850) in the...”
REG1_YEAST / Q00816 Resistance to glucose repression protein 1; Protein HEX2; Second-site suppressor of the rna1-1 mutation 1 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 3 papers)
YDR028C Reg1p from Saccharomyces cerevisiae
NP_010311 protein phosphatase regulator REG1 from Saccharomyces cerevisiae S288C
Aligns to 173:204 / 1014 (3.2%), covers 100.0% of PF08550, 40.7 bits
- function: Involved in RNA processing and negative regulation of glucose repression. Regulates the level of two antigens, P43 and P70. Binds to protein phosphatase type 1. Functions with REG2 and SNF1 protein kinase to regulate growth. Might regulate SNF1 directly or indirectly.
subunit: Interacts with SAK1. - Investigation the global effect of rare earth gadolinium on the budding Saccharomyces cerevisiae by genome-scale screening
Cao, Frontiers in microbiology 2022 - “...biosynthesis, degradation and salvage cytoplasm YAL013W DEP1 Component of the Rpd3L histone deacetylase complex nucleus YDR028C REG1 Regulatory subunit of type 1 protein phosphatase Glc7p cytoplasm Cell cycle and DNA processing(1) YDR004W RAD57 Protein that stimulates strand exchange nucleus Protein synthesis, folding, modification and destination(3) YGL076C...”
- Metabolic Engineering Strategies for Improved Lipid Production and Cellular Physiological Responses in Yeast Saccharomyces cerevisiae
Jiang, Journal of fungi (Basel, Switzerland) 2022 - “...79 ] HMG2 (YLR450W); DGA1 (YOR245C); ERG4 (YGL012W); ERG5 (YMR015C); ARE (YNR019W); SIT4 (YDL047W); REG1 (YDR028C); SAP190 (YKR028W) LD content [ 79 ] PAH1 63% LDs number, total lipids stable [ 91 ] WS2, ACB1, GAPN 7.7, 48 mg/L FAEE [ 119 ] Combination of lipid...”
- A functional genomic screen in Saccharomyces cerevisiae reveals divergent mechanisms of resistance to different alkylphosphocholine chemotherapeutic agents
Garcia, G3 (Bethesda, Md.) 2021 - “...YDL019C OSH2 No Oxysterol-binding protein homolog family member YDR027C VPS54 No Golgi-associated retrograde protein complex YDR028C REG1 No Subunit of type 1 protein phosphatase Glc7p YDR093W DNF2 Yes Aminophospholipid translocase (flippase) YDR095C No Dubious ORF overlapping DNF2 YDR097C MSH6 No Required for mismatch repair in mitosis...”
- Identification of the Genetic Requirements for Zinc Tolerance and Toxicity in Saccharomyces cerevisiae
Zhao, G3 (Bethesda, Md.) 2020 - “...SRB8 YFL001W DEG1 YHR178W STB5 YLR182W SWI6 YDL160C DHH1 YFL049W SWP82 YIL154C IMP2 YNR052C POP2 YDR028C REG1 YGL071W AFT1 YJL124C LSM1 YPL254W HFI1 YDR310C SUM1 YGR092W DBF2 YKL139W CTK1 Protein fate (synthesis, folding, modification, destination) (17) YBR131W CCZ1 YDR283C GCN2 YJL004C SYS1 YNL069C RPL16B YCL001W RER1...”
- Regulatory and evolutionary adaptation of yeast to acute lethal ethanol stress
Yang, PloS one 2020 - “...ribosomal large subunit VPS24 YKL041W 3.81 vacuolar protein sorting CTR1 YPR124W 3.74 copper transporter REG1 YDR028C 3.49 protein phosphatase regulator GAT2 YMR136W 3.34 transcription factor DEPLETED Gene Name Systematic Name Score Description VPS69 YPR087W -12.4 vacuolar protein sorting SIW14 YNL032W -6.92 tyrosine phosphatase NGG1 YDR176W -6.81...”
- Widespread Cumulative Influence of Small Effect Size Mutations on Yeast Quantitative Traits
Hua, Cell systems 2018 - “...genes are: GAL4 (YPL248C), GCN4 (YEL009C), GAL80 (YML051W), GAL1 (YBR020W), SNF3 (YDL194W), STI1 (YOR027W), REG1 (YDR028C), GAL3 (YDR009W), SNF2 (YOR290C), HSC82 (YMR186W) . This is important when calculating the explained heritability for top N genes (see main text). One of our main arguments is that the...”
- Pex35 is a regulator of peroxisome abundance
Yofe, Journal of cell science 2017 - “...0.31 0.63 17 YMR142C Rpl13b 0.49 0.32 0.65 18 YPR099C Ypr099c 0.30 0.20 0.66 19 YDR028C Reg1 0.37 0.24 0.66 20 YCL058C Fyv5 0.67 0.44 0.66 21 YJL088W Arg3 0.37 0.25 0.68 22 YDR448W Ada2 0.36 0.24 0.68 23 YOL108C Ino4 0.47 0.32 0.69 24 YOL095C...”
- Identification of Genes in Saccharomyces cerevisiae that Are Haploinsufficient for Overcoming Amino Acid Starvation
Bae, G3 (Bethesda, Md.) 2017 - “...phosphatase catalytic subunit; cleavage and polyadenylation factor (CPF) component M + , E, C, i YDR028C REG1 Regulatory subunit of type 1 protein phosphatase Glc7p M + , v YAR018C KIN3 Nonessential serine/threonine protein kinase; possible role in DNA damage response M , C, v YBL046W...”
- More
- The multiple effects of REG1 deletion and SNF1 overexpression improved the production of S-adenosyl-L-methionine in Saccharomyces cerevisiae.
Chen, Microbial cell factories 2022 - GeneRIF: The multiple effects of REG1 deletion and SNF1 overexpression improved the production of S-adenosyl-L-methionine in Saccharomyces cerevisiae.
- Reg1 and Snf1 regulate stress-induced relocalization of protein phosphatase-1 to cytoplasmic granules.
Schnell, The FEBS journal 2021 - GeneRIF: Reg1 and Snf1 regulate stress-induced relocalization of protein phosphatase-1 to cytoplasmic granules.
- The Hsp70 homolog Ssb and the 14-3-3 protein Bmh1 jointly regulate transcription of glucose repressed genes in Saccharomyces cerevisiae.
Hübscher, Nucleic acids research 2016 - GeneRIF: Here we show that the defect in glucose-repression in the absence of Ssb is due to the ability of the chaperone to bridge between the SNF1 and Glc7 complexes. Ssb performs this post-translational function in concert with the 14-3-3 protein Bmh, to which Ssb binds via its very C-terminus. Raising the intracellular concentration of Ssb or Bmh enabled Glc7 to dephosphorylate SNF1 even in the absence of Reg1
- Heterotrimer-independent regulation of activation-loop phosphorylation of Snf1 protein kinase involves two protein phosphatases.
Ruiz, Proceedings of the National Academy of Sciences of the United States of America 2012 - GeneRIF: Data show that the Reg1-Glc7 protein phosphatase 1 and Sit4 type 2A-like phosphatase are largely responsible for dephosphorylation of Thr-210 of Snf1(1-309).
- Roles of two protein phosphatases, Reg1-Glc7 and Sit4, and glycogen synthesis in regulation of SNF1 protein kinase.
Ruiz, Proceedings of the National Academy of Sciences of the United States of America 2011 - GeneRIF: Roles of two protein phosphatases, Reg1-Glc7 and Sit4, and glycogen synthesis in regulation of SNF1 protein kinase.
- Reg1 protein regulates phosphorylation of all three Snf1 isoforms but preferentially associates with the Gal83 isoform.
Zhang, Eukaryotic cell 2011 - GeneRIF: the ability of Reg1 to promote the dephosphorylation of Snf1 is not directly related to the strength of its association with the Snf1 complex
- PP1 phosphatase-binding motif in Reg1 protein of Saccharomyces cerevisiae is required for interaction with both the PP1 phosphatase Glc7 and the Snf1 protein kinase.
Tabba, Cellular signalling 2010 - GeneRIF: data suggest that the regulation of Snf1 dephosphorylation is imparted through a dynamic competition between the Glc7 phosphatase and the Snf1 kinase for binding to the PP1 regulatory subunit Reg1.
- Glc7-Reg1 phosphatase signals to Yck1,2 casein kinase 1 to regulate transport activity and glucose-induced inactivation of Saccharomyces maltose permease.
Gadura, Genetics 2006 - GeneRIF: Yck1,2 kinases act with Glc7-Reg1 phosphatase in a novel glucose-signaling pathway that modulates kinase activity in response to carbon source availability.
- More
nrr1 / CAA07052.1 nitrogen response regulator from Metarhizium anisopliae (see paper)
Aligns to 92:119 / 944 (3.0%), covers 96.4% of PF08550, 40.4 bits
PTRG_06770, XP_001937103 uncharacterized protein from Pyrenophora tritici-repentis Pt-1C-BFP
Aligns to 31:58 / 533 (5.3%), covers 100.0% of PF08550, 40.3 bits
- The cross-pathway control system regulates production of the secondary metabolite toxin, sirodesmin PL, in the ascomycete, Leptosphaeria maculans
Elliott, BMC microbiology 2011 - “...bp downstream Fungal specific DUF1752 hypothetical protein PTT_0874 Pyrenophora teres f. teres 0-1 EFQ94295.1 0 PTRG_06770 XP_001937103 0 Pyrenophora tritici-repentis Pt-1C-BFP GTA7; dsp2 (cpcA); GU332623 210 bp downstream Basic region leucine zipper hypothetical protein PTT_10495 P. teres f. teres 0-1 EFQ92415.1 4e -72 cross-pathway control protein...”
- “...downstream Fungal specific DUF1752 hypothetical protein PTT_0874 Pyrenophora teres f. teres 0-1 EFQ94295.1 0 PTRG_06770 XP_001937103 0 Pyrenophora tritici-repentis Pt-1C-BFP GTA7; dsp2 (cpcA); GU332623 210 bp downstream Basic region leucine zipper hypothetical protein PTT_10495 P. teres f. teres 0-1 EFQ92415.1 4e -72 cross-pathway control protein 1...”
MAA_03820 area from Metarhizium robertsii ARSEF 23
Aligns to 213:240 / 1065 (2.6%), covers 96.4% of PF08550, 40.2 bits
CNB03300 hypothetical protein from Cryptococcus neoformans var. neoformans JEC21
Aligns to 52:79 / 861 (3.3%), covers 100.0% of PF08550, 39.4 bits
CNAG_03841 hypothetical protein from Cryptococcus neoformans var. grubii H99
Aligns to 52:79 / 861 (3.3%), covers 100.0% of PF08550, 39.4 bits
MBR_08301 nitrogen response regulator from Metarhizium brunneum ARSEF 3297
Aligns to 92:119 / 942 (3.0%), covers 96.4% of PF08550, 37.6 bits
GAT1_YEAST / P43574 Transcriptional regulatory protein GAT1 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see paper)
NP_116632 Gat1p from Saccharomyces cerevisiae S288C
YFL021W Gat1p from Saccharomyces cerevisiae
Aligns to 58:85 / 510 (5.5%), covers 100.0% of PF08550, 34.4 bits
- function: Positive regulator of multiple nitrogen catabolic genes
- The modification of Gat1p in nitrogen catabolite repression to enhance non-preferred nitrogen utilization in Saccharomyces cerevisiae.
Zhao, Scientific reports 2016 - GeneRIF: Based on these results, the genetic engineering on Gat1p has a great potential in enhancing non-preferred nitrogen metabolism in S. cerevisiae.
- Premature termination of GAT1 transcription explains paradoxical negative correlation between nitrogen-responsive mRNA, but constitutive low-level protein production.
Georis, RNA biology 2015 - GeneRIF: Data show that the GAT1 gene, encoding a transcriptional activator of nitrogen-responsive catabolic genes, produces a variety of mRNAs differing in their 5' and 3' termini.
- Constitutive and nitrogen catabolite repression-sensitive production of Gat1 isoforms.
Rai, The Journal of biological chemistry 2014 - GeneRIF: We demonstrate that wild type Gat1 isoforms (IsoA and IsoB) are initiated at Gat1 methionines 40, 95, and/or 102, but not at methionine 1 regardless of nitrogen conditions.
- Alterations in the Ure2 αCap domain elicit different GATA factor responses to rapamycin treatment and nitrogen limitation.
Feller, The Journal of biological chemistry 2013 - GeneRIF: Gln3, Gat1, and Ure2 respond to TorC1 and nitrogen availability via distinct regulatory pathways.
- Interplay of Aro80 and GATA activators in regulation of genes for catabolism of aromatic amino acids in Saccharomyces cerevisiae.
Lee, Molecular microbiology 2013 (PubMed)- GeneRIF: Rapamycin-dependent Gat1 and Gln3 binding to the Aro80 target promoters is not affected by tryptophan availability, suggesting that transactivation activity of Aro80 is not necessary for the recruitment of GATA factors.
- Controlling lipid fluxes at glycerol-3-phosphate acyltransferase step in yeast: unique contribution of Gat1p to oleic acid-induced lipid particle formation.
Marr, The Journal of biological chemistry 2012 - GeneRIF: Controlling lipid fluxes at glycerol-3-phosphate acyltransferase step in yeast: unique contribution of Gat1p to oleic acid-induced lipid particle formation.
- Nitrogen-responsive regulation of GATA protein family activators Gln3 and Gat1 occurs by two distinct pathways, one inhibited by rapamycin and the other by methionine sulfoximine.
Georis, The Journal of biological chemistry 2011 - GeneRIF: Nitrogen-responsive regulation of GATA protein family activators Gln3 and Gat1 occurs by two distinct pathways, one inhibited by rapamycin and the other by methionine sulfoximine.
- Distinct phosphatase requirements and GATA factor responses to nitrogen catabolite repression and rapamycin treatment in Saccharomyces cerevisiae.
Tate, The Journal of biological chemistry 2010 - GeneRIF: Gln3 and Gat1 localizations are controlled by two different regulatory pathways
- More
- An incoherent feedforward loop facilitates adaptive tuning of gene expression
Hong, eLife 2018 - “...structural analysis of the GAT1 DNA binding domain The ModBase model of yeast GAT1 (UniProt P43574) from an NMR structure (PDB 4GAT) complexed with Zn and DNA, with a nearly identical fold to a high-resolution crystal structure (PDB 2VUS), is the best model available. The 3D...”
- Multiple nuclear localization signals mediate nuclear localization of the GATA transcription factor AreA
Hunter, Eukaryotic cell 2014 - “...Penicillium roqueforti NmC (CAA04815) (61), S. cerevisiae Gat1p (P43574) (62), S. cerevisiae Gln3p (P18494) (63), S. cerevisiae Dal80p (SGD no. YKR034W) (64),...”
- CREEPY: CRISPR-mediated editing of synthetic episomes in yeast
Zhao, Nucleic acids research 2023 - “...and episomal editing, we integrated the mSox2 CTCF8 site (40 bp) into chromosome VI (between YFL021W and YFL020C ) with a LEU2 marker. This was achieved by assembling the CTCF8 site, which was made up of two annealed oligos, into an entry vector (pAV10, Addgene #63213)...”
- “...( G ) Editing strategy of a genome-integrated mSox2 CTCF8 site inserted between YFL021C and YFL021W . ( H ) Editing efficiency of a genome-integrated mSox2 CTCF8. Error bars represent mean SD of three replicates ( n = 32 for each group). ( I ) Survival...”
- Toxicological response of the model fungus Saccharomyces cerevisiae to different concentrations of commercial graphene nanoplatelets
Suarez-Diez, Scientific reports 2020 - “...1 of GN, two of the main regulators of the nitrogen catabolite repression (NCR) pathway, YFL021W ( GAT1 ) and YER040W ( GLN3 ) appear overexpressed as well as two of the main regulators associated to sugar catabolite repression (YGL035C) MIG1 and (YGL035C) GAL80 . The...”
- Development of a Tightly Controlled Off Switch for Saccharomyces cerevisiae Regulated by Camphor, a Low-Cost Natural Product
Ikushima, G3 (Bethesda, Md.) 2015 - “...study ykl162c ::pSIB619 ( KlURA3 , cam-TA) a TargetChVI: an intergenic region between GAT1 / YFL021W and PAU5 / YFL020C . b TargetChII: the intergenic region between TKL2/YBR117C and the open reading frame of LYS2/YBR115C. Flow cytometry Cellular fluorescence from GFP was determined using the LSRII...”
- Combined cell-surface display- and secretion-based strategies for production of cellulosic ethanol with Saccharomyces cerevisiae
Liu, Biotechnology for biofuels 2015 - “...The cell-surface display cassette, which includes the I2 region (the 3 non-coding region between gene YFL021W and YFL020C , used for integration), LEU2 , SED1 promoter, SED1 anchoring region, and SAG1 terminator was amplified from plasmid pIL2GA-SS using primers P-EG2 and EG2-A. Two DNA fragments were...”
- A large-scale analysis of autophagy-related gene expression identifies new regulators of autophagy
Bernard, Autophagy 2015 - “...MBP1 YDL056W GCN4 YEL009C GLN3 GAT1 YER040W YFL021W SWI5 YDR146C Increased expression in growing conditions Decreased induction upon glucose starvation...”
- Development of a GIN11/FRT-based multiple-gene integration technique affording inhibitor-tolerant, hemicellulolytic, xylose-utilizing abilities to industrial Saccharomyces cerevisiae strains for ethanol production from undetoxified lignocellulosic hemicelluloses
Hasunuma, Microbial cell factories 2014 - “...site of MCS linker 2. The I2, I6, I7S, and I10 regions are located between YFL021W and YFL020C, YGR249W and YGR250C, YKL219W and YKL218C, and YPL257W and YPL256C, respectively. The inter-ORF regions are situated downstream of both adjacent ORFs. Linker 1 consisting of P19 and P20...”
- The switch from fermentation to respiration in Saccharomyces cerevisiae is regulated by the Ert1 transcriptional activator/repressor
Gasmi, Genetics 2014 - “...name PCK1 YKR097W MAE1 YKL029C PDC1 YLR044C GAT1 YFL021W AQR1 ICY1 YNL065W YMR195W LSC2 VID24 YGR244C YBR105C PET9 YBL30C OPI1 FBP1 YHL020C YLR377C FMP48...”
- “...name PCK1 YKR097W MAE1 YKL029C PDC1 YLR044C GAT1 YFL021W AQR1 YNL065W ICY1 YMR195W LSC2 YGR244C VID24 YBR105C PET9 YBL30C OPI1 YHL020C FBP1 YLR377C PRP28...”
- Origin and consequences of the relationship between protein mean and variance
Vallania, PloS one 2014 - “...to YPD using genome-wide nucleosome occupancy data [33] (YAL054C, YBL015W, YBL075C, YBR139W, YBR145W, YDL097C, YER081W, YFL021W, YGL040C, YGL197W, YLR042C, YMR315W, YNL241C, YOL143C, YOR084W, YPR127W). We constructed a second set (control set) of 15 genes either stable nucleosome-bound or nucleosome-free promoters (YBR066C, YBR092C, YER056C-A, YJL200C, YKL071W, YLR177W,...”
- More
PITG_06259 calcium/calmodulin-dependent protein kinase, putative from Phytophthora infestans T30-4
Aligns to 15:42 / 866 (3.2%), covers 96.4% of PF08550, 33.3 bits
GAT1_CANAL / Q5A432 Transcriptional regulatory protein GAT1 from Candida albicans (strain SC5314 / ATCC MYA-2876) (Yeast) (see 7 papers)
GAT1 zinc finger transcriptional regulator of nitrogen utilization from Candida albicans (see paper)
Aligns to 1:25 / 688 (3.6%), covers 85.7% of PF08550, 33.1 bits
- function: Transcriptional regulator of nitrogen utilization required for nitrogen catabolite repression and utilization of isoleucine, tyrosine and tryptophan as nitrogen sources. Controls expression of the MEP2 ammonium permease, the DUR1,2 urea amidolyase, and the transcription factor STP1, which in turn mediates SAP2 expression, a long-known virulence attribute of C.albicans. Influences the filamentation process depending upon the nitrogen sources available. Required for virulence in a mouse systemic infection model.
- CharProtDB CGD description: Zinc finger transcriptional regulator of nitrogen utilization; required for nitrogen catabolite repression and utilization of isoleucine, tyrosine and tryptophan N sources; required for virulence in a mouse systemic infection model
GRA3_GIBZE / I1S490 Gramillins biosynthetic cluster protein FGSG_11657 from Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1) (Wheat head blight fungus) (Fusarium graminearum) (see paper)
FGSG_11657 hypothetical protein from Fusarium graminearum PH-1
Aligns to 482:508 / 740 (3.6%), covers 89.3% of PF08550, 30.8 bits
- function: Part of the gene cluster that mediates the biosynthesis of gramillins A and B, bicyclic lipopeptides that induce cell death in maize leaves but not in wheat leaves (PubMed:30395461). The nonribosomal peptide synthetase GRA1 incorporates respectively a glutamic adic (Glu), a leucine (Leu), a serine (Ser), a hydroxyglutamine (HOGln), a 2-amino decanoic acid, and 2 cysteins (CysB and CysA) (Probable). The biosynthesis of 2-amino decanoic acid incorporated in gramillins could be initiated by a fatty acid synthase composed of the alpha and beta subunits FGSG_00036 and FGSG_11656 (Probable). The cytochrome P450 monooxygenase FGSG_15680 could hydroxylate the fatty acid chain (Probable). Subsequent oxidation to the ketone by the oxidoreductase FGSG_00048 and transamination by aminotransferase FGSG_00049 could form 2-amino-decanoic acid (Probable). On the other hand, FGSG_15680 could also be responsible for the HO-modified glutamine at the gamma-position (Probable). Whether hydroxylation occurs on the fully assembled product or on the Gln residue prior to assembly into the gramillins requires further proof (Probable). The thioredoxin FGSG_00043 could also be required for the disulfide-bond formation between CysA and CysB (Probable). The specific involvement of the remaining proteins from the cluster is more difficult to discern, but could have broader regulatory (FGSG_00040 and FGSG_11657) or enzymatic functions (FGSG_00044 and FGSG_00045) (Probable). The final C-domain of GRA1 does not possess the expected sequence of a termination CT domain, often implicated in macrocyclization and release of a cyclopeptidein fungal NRPs; and the thioesterase FGSG_00047 may act in concert with the terminal C-domain of GRA1 to catalyze the formation of the macrocyclic anhydride and release of the products (Probable).
- The Fusarium graminearum genome reveals more secondary metabolite gene clusters and hints of horizontal gene transfer
Sieber, PloS one 2014 - “...FGSG_00038 hypothetical protein GTGGtgCCAC 6 FGSG_00039 conserved hypothetical protein 7 FGSG_00040 conserved hypothetical protein 8 FGSG_11657 conserved hypothetical protein 9 FGSG_11658 hypothetical protein 10 FGSG_00043 conserved hypothetical protein 11 FGSG_00044 conserved hypothetical protein GTGGtgCCAC 12 FGSG_00045 conserved hypothetical protein GTGGtgCCAC 13 FGSG_00046 related to multidrug resistance...”
NP_014323 Mks1p from Saccharomyces cerevisiae S288C
YNL076W Mks1p from Saccharomyces cerevisiae
Aligns to 37:64 / 584 (4.8%), covers 85.7% of PF08550, 28.3 bits
- Interaction between Rtg2p and Mks1p in the regulation of the RTG pathway of Saccharomyces cerevisiae.
Ferreira, Gene 2005 (PubMed)- GeneRIF: Data suggest that dynamic association between Mks1p and Rtg2p in high molecular weight complexes provides a means to regulate the RTG pathway.
- A novel degron-mediated degradation of the RTG pathway regulator, Mks1p, by SCFGrr1.
Liu, Molecular biology of the cell 2005 - GeneRIF: Mks1p is a central player of retrograde signaling (RS) and is acted upon by multiple regulators of the pathway.
- Tor signaling and nutrient-based signals converge on Mks1p phosphorylation to regulate expression of Rtg1.Rtg3p-dependent target genes.
Dilova, The Journal of biological chemistry 2004 (PubMed)- GeneRIF: Tor signaling and Mks1p phosphorylation regulate expression of Rtg1.Rtg3p-dependent target genes
- Yeast Assimilable Nitrogen Concentrations Influence Yeast Gene Expression and Hydrogen Sulfide Production During Cider Fermentation
Song, Frontiers in microbiology 2020 - “...a cider fermentation. Systematic name Gene Name Base sequence YNR058W BIO3 BIO3F TGTTTCCCTTGGTACCCTTATTCGT BIO3R AAGATCTGTGCTGTGATTTTGGAGC YNL076W MKS1 MKS1F TTTTAACTCGGCCAATGACATCACC MKS1R AATTGTCTGTTTGGAGCAACGTCAT YNL183C NPR1 NPR1F TTTCTGCCAATTCCAATGGTCCTTC NPR1R ATAGGAACCAGTTGGCTGTCTTGAT YJL110C GZF3 GZF3F AACGGAGTCTAAGGAAAGAAGCGAT GZF3R GGGCAGTTTAGGCTTTAAGTTTGGT YFR030W MET10 MET10F CAACGTCAGAGTGCCATTACCTTTT MET10R GAAAGAAGGCGAAGAACCATCCAAA YBR294W SUL1 SUL1F CTACCCTTTGTTTGCTTTGTGGGAT SUL1R GAAGCCAGCAACAGCATTTAGAGAA YGR155W...”
- Changes in cell morphology are coordinated with cell growth through the TORC1 pathway
Goranov, Current biology : CB 2013 - “...down down S241 YMR216C Sky1 down down and up down S360, S453 ; up T66 YNL076W Mks1 down <1.5-fold YPL180W Tco89 down down and up down S104 , S267, S288, S575 ; up S255 YPR185W Atg13 down down S454, S461, S652, S656 YDR345C Hxt3 down up...”
- Rif2 promotes a telomere fold-back structure through Rpd3L recruitment in budding yeast
Poschke, PLoS genetics 2012 - “...++ SKI3 YPR189W + E PIH1 YHR034C ++ MEP1 YGR121C ++ MSN4 YKL062W + MKS1 YNL076W ++ SPE3 YPR069C ++ A MHR1 YDR296W + YME1 YPR024W ++ E PTC6 YCR079W ++ unknown YIL055C + MSB3 YNL293W ++ OCA1 YNL099C ++ A,E COS10 YNR075W + RCO1 YMR075W...”
- Increased respiration in the sch9Delta mutant is required for increasing chronological life span but not replicative life span
Lavoie, Eukaryotic cell 2008 - “...ACO1 1.44 1.52 4.89E-03 3.80E-03 Retrograde signaling YNL076W MKS1 1.36 2.24E-05 CCAAT-binding complex (GO:0016602) YGL237C YBL021C YKL109W YOR358W YLR256W HAP2...”
- Protein networks, pleiotropy and the evolution of senescence
Promislow, Proceedings. Biological sciences 2004 - “...YMR043W YMR072W YMR142C YMR186W YMR273C YMR308C YNL061W YNL076W YNL126W YNL141W YNL233W YOR063W YOR212W YOR232W YOR326W YPL020C YPL078C YPL127C YPL145C YPL203W...”
- Mks1p is a regulator of nitrogen catabolism upstream of Ure2p in Saccharomyces cerevisiae
Edskes, Genetics 1999 - “...the HindIII-BamHI sites of B54 removed 1656-bp encompassing YNL076w (MKS1) and the 59 region of YNL075w, resulting in clone pH64. YNL075w was subcloned as...”
- “...649 39 of the ATG start codon of YNL076w (MKS1, multicopy compensator of A-kinase suppression) and ends in YNL073w (MSK1, mitochondrial lysine-tRNA synthetase)....”
- Large scale identification of genes involved in cell surface biosynthesis and architecture in Saccharomyces cerevisiae
Lussier, Genetics 1997 - “...the high osmolarity signal transduction pathway MKS1 YNL076w HS XIV CDS Negative regulator of RAScAMP pathway; involved carbohydrate utilization regulation SlVF...”
REG2_YEAST / P38232 Protein REG2 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see paper)
YBR050C Reg2p from Saccharomyces cerevisiae
NP_009606 protein phosphatase regulator REG2 from Saccharomyces cerevisiae S288C
Aligns to 131:153 / 338 (6.8%), covers 75.0% of PF08550, 26.4 bits
- function: Regulatory subunit, binds to type-1 protein phosphatase. Functions with HEX2/REG1 and SNF1 protein kinase to regulate growth. Might regulate SNF1 directly or indirectly.
- SCRaMbLE: A Study of Its Robustness and Challenges through Enhancement of Hygromycin B Resistance in a Semi-Synthetic Yeast
Ong, Bioengineering (Basel, Switzerland) 2021 - “...of the duplicated segments. Furthermore, we found a 13 kb inversion containing seven genes ( YBR050C , YBR051W , YBR052C , YBR053C , YBR054W , YBR055C , YBR056W ) (INV-10), a deletion of 14 kb (DEL-11) which was not detected by PCRTag analysis, and a 7...”
- Examining the process of de novo gene birth: an educational primer on "integration of new genes into cellular networks, and their structural maturation"
Frietze, Genetics 2014 - “...S. cerevisiae Proto-genes Bona fide genes YFR035C YBR050C YPR053C YGL188C-A YER186C YLR310C YGR119C YBR170C YIR033W YLR113W Literature Cited Abdulrehman, D., P....”
- Mutational analysis of the C-terminal FATC domain of Saccharomyces cerevisiae Tra1
Hoke, Current genetics 2010 - “...receptor YDL098C SNU23 2.8 Component of U4/U6.U5 snRNP YKL120W OAC1 2.7 Mitochondrial inner membrane transporter YBR050C REG2 2.7 Phosphatase regulatory subunit YNL155W 2.7 Unknown YHR081W LRP1 2.6 Exosome-associated nucleic acid binding protein YGL009C LEU1 2.6 Leucine biosynthesis YLR297W 2.4 Unknown YLR346C 2.4 Unknown YNR050C LYS9 2.4...”
- A new fluorescence-based method identifies protein phosphatases regulating lipid droplet metabolism
Bozaquel-Morais, PloS one 2010 - “...0.091 PSY2 YNL201C Regulatory subunit of type 2A protein phosphatase Pph3 1.09 0.13 0.098 REG2 YBR050C Regulatory subunit of type 1 protein phosphatase Glc7p 1.09 0.05 0.086 PTP2 YOR208W Phosphotyrosine-specific protein phosphatase 1.12 0.22 0.057 OCA1 YNL099C Putative protein tyrosine phosphatase 1.12 0.25 0.058 PAM1 YDR251W...”
- ISC1-dependent metabolic adaptation reveals an indispensable role for mitochondria in induction of nuclear genes during the diauxic shift in Saccharomyces cerevisiae
Kitagaki, The Journal of biological chemistry 2009 - “...YGR243w YAR035w YMR206w YIL160c YPR150w YLR174w YLR126c YBR050c YEL008w YPR006c YHL032c YHR139c YPR151c YLR267w YNR002c YNL009w YNL013c YER179w FBP1 JEN1 SPG1...”
- Positional analyses of BRCA1-dependent expression in Saccharomyces cerevisiae
Skibbens, Cell cycle (Georgetown, Tex.) 2008 - “...Up 3.4175785 Up YGL158W RCK1 3.5144181 Up 2.9104614 Up YCR106W RDS1 4.28649 Up 5.964159 Up YBR050C REG2 2.9678848 Up 2.7935257 Up YBR256C RIB5 2.1734767 Up 2.2412622 Up YGL224C SDT1 2.8915923 Up 4.9005575 Up YAL067C SEO1 2.2840748 Up 4.980292 Up YJL089W SIP4 8.228353 Up 6.9054456 Up YMR095C...”
- The Yeast Gene Order Browser: combining curated homology and syntenic context reveals gene fate in polyploid species
Byrne, Genome research 2005 - “...(YBR148W) YEL025C RIF2 (YLR453C) HBT1 (YDL223C) REG2 (YBR050C) YOL131W GRE1 (YPL223C) YOR214C YOL024W YLR346C YJR115W PEX27 (YOR193W) YAP7 (YOL028C) ASI3...”
- The Saccharomyces cerevisiae 14-3-3 protein Bmh2 is required for regulation of the phosphorylation status of Fin1, a novel intermediate filament protein
Mayordomo, The Biochemical journal 2002 - “...(YDR099w) GIC2 (YDR099w) MSB3 (YNL293w) MBF1 (YOR298c) GCR2 (YNL199c) REG2 (YBR050c) PPT1 (YGR123c) LRE1 (YCL051w) RPS0A (YGR214w) YLR177w - 26 7 1 2 2 1 1 1 1...”
- Springing into Action: Reg2 Negatively Regulates Snf1 Protein Kinase and Facilitates Recovery from Prolonged Glucose Starvation in Saccharomyces cerevisiae.
Maziarz, Applied and environmental microbiology 2016 - GeneRIF: Here, the authors present evidence that Reg2 contributes to Snf1 Thr210 dephosphorylation.
Or search for genetic data about PF08550 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory