Family Search for PF08925 (DUF1907)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF08925 hits 9 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
Q5U2Q3 Ester hydrolase C11orf54 homolog from Rattus norvegicus
Aligns to 20:303 / 315 (90.2%), covers 100.0% of PF08925, 426.0 bits
Q91V76 Ester hydrolase C11orf54 homolog from Mus musculus
Aligns to 20:303 / 315 (90.2%), covers 100.0% of PF08925, 423.1 bits
- Integrin CD11c regulates B cell homeostasis.
Hou, Frontiers in immunology 2024 - Effects of Three-Month Administration of High-Saturated Fat Diet and High-Polyunsaturated Fat Diets with Different Linoleic Acid (LA, C18:2n-6) to α-Linolenic Acid (ALA, C18:3n-3) Ratio on the Mouse Liver Proteome.
Liput, Nutrients 2021 - “...(SSP 1201), GPD1 (SSP 8106), HMGCS2 (SSP7407), KHK (SSP 3103), TKFC (SSP 6606) and UniProtKB: Q91V76 (SSP 4102). The differences in the expression of 11 protein between the 14:1 and SFA diets were identified, involving higher levels of the following five proteins: APOA1 (SSP 1002), GLO1...”
- Comparative Proteomic Analysis of tPVAT during Ang II Infusion.
Liang, Biomedicines 2021 - “...1 P97452 BOP1 Ribosome biogenesis protein BOP1 Q8VE11 MTMR6 Myotubularin-related protein 6 O08528 HK2 Hexokinase-2 Q91V76 C11orf54 Ester hydrolase C11orf54 homolog Q9Z1T1 Ap3B1 AP-3 complex subunit beta-1 Q64008 Rab34 Ras-related protein Rab-34 Q920A5 SCPEP1 Retinoid-inducible serine carboxypeptidase P30993 C5aR1 C5a anaphylatoxin chemotactic receptor 1 Q91VU0 FAM3C...”
- Proteome and microbiota analysis highlight Lactobacillus plantarum TWK10 supplementation improves energy metabolism and exercise performance in mice.
Chen, Food science & nutrition 2020 - “...2.8 UPF0585 protein C16orf13 homolog Q9DCS2 CP013 3.6561.047 1.4171.061 .024 2.6 Ester hydrolase C11orf54 homolog Q91V76 CK054 3.661.392 1.4871.087 .049 2.5 ADP/ATP translocase 2 P51881 ADT2 9.3753.086 3.8871.831 .022 2.4 Regucalcin Q64374 RGN 43.5716.309 18.6425.031 .001 2.3 Cytochrome c oxidase subunit 4 isoform 1, mitochondrial P19783...”
- MS/MS in silico subtraction-based proteomic profiling as an approach to facilitate disease gene discovery: application to lens development and cataract.
Aryal, Human genetics 2020 - “...several uncharacterized proteins. These proteins (as denoted by their uniport accession) include Q8C3W1, Q5EBG8, Q9D727, Q91V76, Q9D7E4 and Q9D1K7, all of which are also identified independently by Zhao and colleagues ( Zhao et al. 2019 ). Thus, these lens-expressed proteins represent novel candidates for further studies...”
- Quantitative Proteomics Reveal an Altered Pattern of Protein Expression in Brain Tissue from Mice Lacking GPR37 and GPR37L1.
Nguyen, Journal of proteome research 2020 - “...3 Q8CIM3 D2hgdh 501% 5.85E-05 5.4% 5 0 Q91XF0 Pnpo 56% 1.05E-04 6.6% 4 3 Q91V76 4931406C07Rik 40% 1.53E-04 6.6% 8 8 P28665 Mug1 279% 2.42E-04 9.2% 16 7 Q00623 Apoa1 77% 7.39E-04 18.2% 14 14 Q65CL1 Ctnna3 46% 1.02E-03 18.2% 4 3 Q00897 Serpina1d 55%...”
- Thymic Microenvironment Is Modified by Malnutrition and Leishmania infantum Infection
Losada-Barragán, Frontiers in cellular and infection microbiology 2019 - “...mitochondrial Uqcrfs1 Up Q91XL1 37389.49 1 7 0.458 1.6 0.024 Leucine-rich HEV glycoprotein Lrg1 Up Q91V76 34955.33 1 8 0.641 1.9 0.010 Ester hydrolase C11orf54 homolog C11orf54 Up P99028 10409.97 1 8 0.836 2.3 0.010 Cytochrome b-c1 complex subunit 6, mitochondrial Uqcrh Up Q9WTP6 26433.69 1...”
- Quantitative analysis of the murine lipid droplet-associated proteome during diet-induced hepatic steatosis
Khan, Journal of lipid research 2015 - “...Q53YP5 B2KG58 D6RI61 Q9CWS0 P07759 O08677-2 Q5M9K1 Q91XF0 Q91V76 Q3U7Z6 P17563 Q9D2R0 P06745 Q546G4 Q3TQP6 A2AC15 Q8R0Y6 Q8VDC3 P23953 B1AXW7 Q8R1G2 Q61171...”
- More
1xcrA / Q9H0W9 Crystal structure of longer splice variant of ptd012 from homo sapiens reveals a novel zinc-containing fold (see paper)
Aligns to 18:301 / 313 (90.7%), covers 100.0% of PF08925, 421.2 bits
CK054_HUMAN / Q9H0W9 Ester hydrolase C11orf54; EC 3.1.-.- from Homo sapiens (Human) (see paper)
XP_047282788 ester hydrolase C11orf54 isoform X1 from Homo sapiens
Aligns to 20:303 / 315 (90.2%), covers 100.0% of PF08925, 421.2 bits
- function: Exhibits ester hydrolase activity on the substrate p- nitrophenyl acetate.
subunit: Monomer. - Ectopic pregnancy: search for biomarker in salivary proteome
Priya, Scientific reports 2023 - “...1 1 98. Q9BYZ2 L-lactate dehydrogenase A-like 6B LDHAL6B 381 41,943 8.88 1 1 99. Q9H0W9 Ester hydrolase C11orf54 C11orf54 315 35,117 6.23 1 1 100. Q9UBR2 Cathepsin Z CTSZ 303 33,868 6.7 1 1 101. Q9UJ42 Probable G-protein coupled receptor 160 GPR160 338 39,787 8.84...”
- Proteome analysis of urinary biomarkers in a cigarette smoke-induced COPD rat model.
Qin, Respiratory research 2022 - “...2 0.02 Q03403 Q5FVH2 5-3 exonuclease PLD3 0.58 Q8IV08 Q5U2Q3 Ester hydrolase C11orf54 homolog 0.31 Q9H0W9 Q62839 Golgin subfamily A member 2 2.73 Q08379 Q63678 Zinc-alpha-2-glycoprotein 2.68 None Q6AYR9 Tetraspanin-1 3.48 O60635 Q6AYS7 Aminoacylase-1A 0.44 Q03154 Q6IRK9 Carboxypeptidase Q 0.62 Q9Y646 Q6TUD4 Protein YIPF3 0.60 Q9GZM5...”
- Dynamic Changes of Urine Proteome in Rat Models Inoculated with Two Different Hepatoma Cell Lines.
Zhang, Journal of oncology 2021 - “...Q5T2W1 Na(+)/H(+) exchange regulatory cofactor NHE-RF3 2.09 Q16348 Solute carrier family 15 member 2 2.09 Q9H0W9 Ester hydrolase C11orf54 homolog 2.08 Renal cell carcinoma P60709 Actin, cytoplasmic 1 2.08 Tissue P09467 Fructose-1,6-bisphosphatase 1 2.08 Tissue P46721 Solute carrier organic anion transporter family member 1A1 2.07 P05062...”
- Changes in the urinary proteome in rats with regular swimming exercise.
Meng, PeerJ 2021 - “...Multifunctional procollagen lysine hydroxylase and glycosyltransferase LH3 O60568 0.020139 0.586 Q5U2Q3 Ester hydrolase C11orf54 homolog Q9H0W9 0.045189 0.584 P35704 Peroxiredoxin-2 P32119 0.000841 0.581 P46413 Glutathione synthetase P48637 0.021466 0.573 Q4FZV0 Beta-mannosidase O00462 0.000078 0.571 Q99MA2 Xaa-Pro aminopeptidase 2 O43895 0.005837 0.569 Q63530 Phosphotriesterase-related protein Q96BW5 0.026074...”
- Melanoma proteomics suggests functional differences related to mutational status
Trilla-Fuertes, Scientific reports 2019 - “...P63027 (vesicle-associated membrane protein 2, VAMP2), P16402 (histone cluster 1H1 family member d, HIST1H1D) and Q9H0W9 (chromosome 11 open reading frame 54, C11orf54) were not previously related with melanoma or other cancers. Differential analyses did not show differences between NRAS-mutant and NRAS-wild type tumors, which are...”
- Differential epithelial and stromal protein profiles in cone and non-cone regions of keratoconus corneas.
Yam, Scientific reports 2019 - “...0.31 0.98 0.088 3 Q9NTK5 OLA1 Obg like ATPase 1 0.32 0.28 0.88 0.053 4 Q9H0W9 C11orf54 Chromosome 11 open reading frame 54 0.34 0.32 0.93 0.092 5 Q6UXI7 VIT Vitrin 0.35 0.09 0.55 0.047* 6 P11166 SLC2A1 Solute carrier family 2 member 1 0.39 0.42...”
- Secretory High-Mobility Group Box 1 Protein Affects Regulatory T Cell Differentiation in Neuroblastoma Microenvironment In Vitro
Vanichapol, Journal of oncology 2018 - “...17 4 8.92 35.90 0.894 0.033 0.217 0.031 4.11 4.07E-07 123 C11orf54 Ester hydrolase C11orf54 Q9H0W9 36 2 1 6.23 35.60 0.146 0.014 0.044 0.006 3.31 1.96E-04 134 GOT2 Aspartate aminotransferase, mitochondrial P00505 149 6 2 9.14 47.88 0.282 0.016 0.074 0.019 3.82 3.36E-05 135 SET...”
- Identification of proteasome subunit alpha type-1 as a novel biomarker in HBV-associated hepatocellular carcinoma tissue interstitial fluid by proteomic analysis.
Qin, International journal of clinical and experimental pathology 2017 - More
- C11orf54 promotes DNA repair via blocking CMA-mediated degradation of HIF1A.
Tan, Communications biology 2023 - GeneRIF: C11orf54 promotes DNA repair via blocking CMA-mediated degradation of HIF1A.
R0K8X5 Ester hydrolase C11orf54 (Fragment) from Anas platyrhynchos
Aligns to 2:285 / 297 (95.6%), covers 100.0% of PF08925, 420.1 bits
Q6GME2 Ester hydrolase C11orf54 homolog from Xenopus laevis
Aligns to 21:304 / 316 (89.9%), covers 100.0% of PF08925, 415.2 bits
Q9W0J9 GH07301p from Drosophila melanogaster
CG9119 uncharacterized protein from Drosophila melanogaster
Aligns to 30:310 / 322 (87.3%), covers 99.6% of PF08925, 396.0 bits
- Crystal structure of Homo sapiens PTD012 reveals a zinc-containing hydrolase fold
Manjasetty, Protein science : a publication of the Protein Society 2006 - “...Brachydanio rerio (Q6PHI5, 318, 62%), Drosophila melanogaster (Q9W0J9, 322, 47%; Q8IRI0, 361, 44%; Q8SXQ8, 322, 44%), Anopheles gambiae str. PEST (Q7QI91,...”
- “...sapiens); Q91V76 (Mus musculus); Q6PHI5 (Brachydanio rerio); Q9W0J9, Q8IRI0, Q8SXQ8 (Drosophila melanogaster); Q7QI91 (Anopheles gambiae str. PEST), and Q18131...”
- Hematopoietic plasticity mapped in Drosophila and other insects
Hultmark, eLife 2022 - “...in the PPO6 low cluster ( Figure 5 ). Besides the phenoloxidase genes, homologs of CG9119 , meep , Fkbp59, and CG17109 were all more than 1000-fold enriched in the PPO6 high population ( Severo et al., 2018 ). Homologs of CG17065 , Ctr1A , CG10467,...”
- Vitamin A deficiency affects gene expression in the Drosophila melanogaster head
Dewett, G3 (Bethesda, Md.) 2021 - “...0.0031575 0.576574957 1.491304598 dnr1 0.000297318 0.573883401 1.488524947 CG8034 0.000349475 0.571992133 1.486574878 cindr 0.000219643 0.569835607 1.484354421 CG9119 0.017844111 0.559528648 1.473787628 GluProRS 0.013104209 0.510704209 1.424745473 inaC 0.02107398 0.506688693 1.420785431 Table 3 Differentially expressed genes that are downregulated by vitamin A deprivation Gene Adjusted P -value Abs log2 fold...”
- “...10 CG14907 2.548464539 Up 0.7 0.2 3 1 CG16826 2.193737286 Up 0.7 0.2 309 79 CG9119 1.473787628 Up 0.7 0.3 7.7 2.9 CG5535 3.20639022 Up 0.6 0.1 11 2.5 CG9305 2.176182166 Up 0.6 0.6 1.7 1.7 AOX1 1.767840408 Up 0.6 2 13 4 CG17108 1.621831761 Down...”
- Identification of a micropeptide and multiple secondary cell genes that modulate Drosophila male reproductive success.
Immarigeon, Proceedings of the National Academy of Sciences of the United States of America 2021 - “...wild-type cells ( SI Appendix , Fig. S3 ), with only six genes significantly misexpressed (CG9119, ppk20, CG13360, CG33080, nSyb, and CG7582, see Dataset S4 and Materials and Methods for statistical analysis). None of these genes point to an obvious explanation for the phenotype we observed,...”
- Temporal specificity and heterogeneity of Drosophila immune cells
Cattenoz, The EMBO journal 2020 (secret) - Do the genes of the innate immune response contribute to neuroprotection in Drosophila?
Cantera, Journal of innate immunity 2015 - “...elav-GAL4 152 11 (7.2) AttA, CG11413, CG13325, CG42351, CG5493, CG9119, CG9837, CG9935, Idgf3, IM2, Mtk Vanden Broeck et al. [26], 2013 Loss of function and...”
- Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus
Zhu, Virology journal 2013 - “...CG6357, CG6498, CG6767, CG7056, CG7251, CG7510, CG7720, CG7778, CG7794, CG7816, CG7841, CG7888, CG8008, CG8046, CG8177, CG9119, CG9222, CG9238, CG9312, CG9626, CG9641, CG9663, CG9812, CG9932, cher, chn, chrb, Cortactin, Cpr67Fa1, Csk, Cyp4g1, DAAM, dally, Dhap-at, drl, Ets21C, ewg, fra, Gadd45, GlcAT-S, Gli, Gp150, Gr94a, gsb, h, Hip1,...”
- Differential gene expression related to Nora virus infection of Drosophila melanogaster
Cordes, Virus research 2013 - “...spindle organization; centriole replication; centrosome duplication 1.526 CG6830 41408 Unknown 1.533 CG17906 34224 Unknown 1.534 CG9119 38124 Hydrolase activity; acting on ester bonds; zinc ion binding 1.536 CG10621 35152 Selenocysteine methyltransferase activity 1.568 Muc11A 32174 Chitin binding 1.569 CG7059 42626 Glycolysis; phosphoglycerate mutase activity 1.578 CG7206...”
- Nodal points and complexity of Notch-Ras signal integration
Hurlbut, Proceedings of the National Academy of Sciences of the United States of America 2009 - “...Confirmation by RT-PCR of differential expression for CG1942, CG9119, and knot in Ras1V12 (R), Notchact (N), dual Notchact-Ras1V12 (NR), and nontransgenic GAL4...”
- “...and tcgaaaatgtccacctctcc, 225 base pairs; CG9119, cactggcgaacagaacttca and ccagttgctgaaggagaagg, 289 base pairs; and Rp49, atgctaagctgtcgcacaaa and...”
- More
Q8SXQ8 Meep from Drosophila melanogaster
Aligns to 30:310 / 322 (87.3%), covers 99.6% of PF08925, 386.0 bits
- Proteomic changes in response to crystal formation in Drosophila Malpighian tubules
Chung, Fly 2016 - “...FBgn0263598 0.041 0.042 0.427 0.328 Q9VLI1 Q0E9G4 Q8SXQ8 A8QI34 7(6) 1(1) 1(1) 2(1) CG9465 Drat CG32335 Jyalpha FBgn0032067 FBgn0033188 FBgn0063667 FBgn0267363...”
- “...infinity 1.254 Q9W141-2 3(2) CG4692 FBgn0035032 Q9VNF8 Q8SXQ8 Q9VKM3 5(5) 1(1) 3(3) sec23 CG32335 ATPsynG FBgn0262125 FBgn0063667 FBgn0010612 Q7JYV3 Q9VLI0...”
- Crystal structure of Homo sapiens PTD012 reveals a zinc-containing hydrolase fold
Manjasetty, Protein science : a publication of the Protein Society 2006 - “...melanogaster (Q9W0J9, 322, 47%; Q8IRI0, 361, 44%; Q8SXQ8, 322, 44%), Anopheles gambiae str. PEST (Q7QI91, 360, 41%), and Caenorhabditis elegans (Q18131,...”
- “...musculus); Q6PHI5 (Brachydanio rerio); Q9W0J9, Q8IRI0, Q8SXQ8 (Drosophila melanogaster); Q7QI91 (Anopheles gambiae str. PEST), and Q18131 (Caenorhabditis...”
E9PR95 Chromosome 11 open reading frame 54 (Fragment) from Homo sapiens
Aligns to 20:76 / 76 (75.0%), covers 20.0% of PF08925, 77.6 bits
Or search for genetic data about PF08925 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory