Family Search for PF09348 (DUF1990)

PF09348 hits 7 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

MAP2721 hypothetical protein from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 12:165 / 166 (92.8%), covers 100.0% of PF09348, 206.3 bits

• Genomic variations associated with attenuation in Mycobacterium avium subsp. paratuberculosis vaccine strains
  Bull, BMC microbiology 2013
  • “...MAP2718c N-alpha-acyl-glutamine aminoacylase Amino acid biosynthesis MAP2719c Acyl-CoA thioesterase Amino acid biosynthesis MAP2720c Aldo-keto reductase MAP2721 Unknown MAP2722c 2-Nitropropane dioxygenase MAP2723c Unknown MAP2724c Unknown MAP2725c Transcriptional regulator MAP2726c fdxA Ferredoxin Fe scavenging MAP2727 S-adenosylmethionine-dependent methyltransferase MAP2728 Transcriptional regulator MAP2929c pcaB Lyase I like Benzoate metabolism MAP2730c...”

Rv2616 hypothetical protein from Mycobacterium tuberculosis H37Rv
Aligns to 12:165 / 166 (92.8%), covers 100.0% of PF09348, 196.5 bits

• Mycobacterium tuberculosis modulates its cell surface via an oligopeptide permease (Opp) transport system
  Flores-Valdez, FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2009
  • “...0.6 1.3 1.6 1.2 0.6 0.4 0.9 1.6 1.4 0.5 1.1 1.4 Rv2616 1.1 0.6 1.0 Rv2724c Rv2784c Rv2821c Rv2840c 0.5 1.1 1.1 1.1 1.3 1.6 0.6 1.6 1.4 1.2 0.9 1.5 Rv2846c...”
• Implications of high level pseudogene transcription in Mycobacterium leprae
  Williams, BMC genomics 2009
  • “...GTTAAG accttgtttaggagtt GAAGAT cg-----gtttaa C ML0459 -89 6.8 11 ACCTTC aggtcgccaccgagcg TGAACG ct-----ccggat G ND Rv2616 ACGGTC aggtcgccgccgaggg TCAACG tt-----ccggat G ML1335c -56 6.7 10.2 TACACT tcggtttctaatctgtg-ga ATCCAT-- ggcagtc A ND Rv2090 TAAACC tcggcgtcgaatcggcgaga ACCCAT-- gtcagccA ML1503c -105 9.8 9 AGTGCC gcgtctacttgctcatc AGTTAG cac----agcca T ND...”

TC 1.B.77.1.1 / G7LAA5 The chloroplast outer membrane ion channel-forming porin of 207 aas and 9 predcted transmembrane β-strands, Oep23. A member of the DUF1990 Superfamily; found in chloroplast outer membranes from simple algae to higher plants from Medicago truncatula
Aligns to 32:197 / 207 (80.2%), covers 93.0% of PF09348, 142.2 bits

• substrates: ions

AT2G17695 hypothetical protein from Arabidopsis thaliana
Aligns to 39:197 / 205 (77.6%), covers 91.1% of PF09348, 142.1 bits

• Probing the physiological role of the plastid outer-envelope membrane using the oemiR plasmid collection
  Schwenkert, G3 (Bethesda, Md.) 2023
  • “...; Pudelski et al. 2012 ) Philippar et al. (2007) -helical 8 OEP23 Solute/ion channel At2g17695 TAAGACGTTATCTCATACCAA Goetze et al. (2015) Trentmann et al. (2020) Other 9 WBC7 ABC transporter At2g01320 TTCAAATTTAGCGTACAGCGA Sanchez-Fernandez et al. (2001) Simm et al. (2013) -helical 10 JASSY-1 OPDA exporter At1g70480...”
• New Insights into the Chloroplast Outer Membrane Proteome and Associated Targeting Pathways
  Fish, International journal of molecular sciences 2022
  • “...OEP24-2 Other Proteins At1g02560 ClpP5 At1g07930 E-Tu At1g09340 CRB At1g70480 DUF220 At2g16640 TOC132 At2g17390 AKR2B At2g17695 OEP23 At2g20890 THF1/PSB29 At2g24440 - At2g27490 ATCOAE At2g32290 * Beta-Amylase 6 At2g32650 PTAC18-Like At3g01500 Beta CA1 At3g06510 SFR2/GGGT At3g06960 TGD4 At3g11670 DGD1 At3g12580 Hsc70-4 At3g16620 TOC120 At3g16950 PDC E3 At3g19720...”
• Emerging knowledge of the organelle outer membranes - research snapshots and an updated list of the chloroplast outer envelope proteins
  Inoue, Frontiers in plant science 2015
  • “...At1g20816 OEP21-1 (i)(ii)(iii) YES At1g45170 OEP24-1 (i)(ii)(iii)(iv) At1g76405 OEP21-2 (i)(ii)(iv) YES At2g01320 WBC7 (ii)(iii)(iv) YES At2g17695 OEP23/DUF1990 (vii) YES At2g28900 OEP16-1 (i)(ii)(iii)(iv) YES At2g43950 OEP37 (i)(ii)(iii)(iv) YES At3g51870 PAPST1 homolog (viii) YES At3g62880 OEP16-4 (i)(ii) At4g16160 OEP16-2 (i)(ii) At5g42960 OEP24-2 (i)(ii) YES PROTEIN IMPORT COMPONENTS AND...”
• Oep23 forms an ion channel in the chloroplast outer envelope
  Goetze, BMC plant biology 2015
  • “...contigs [ 25 ], which in combination with the identified sequence of the Arabidopsis homolog (At2g17695) could be used for the isolation and sequencing of a complete cDNA sequence from pea (GenBank accession No KJ939359, Additional file 1 : Figure S2). PsOep23 has a calculated molecular...”
  • “...all tissues indicating a general involvement in chloroplast metabolism ( www.genevestigator.com/gv/plant.jsp ). The Arabidopsis homolog At2g17695 is not represented on the complete genome cDNA microarray and can therefore not be assessed by publically available databanks. However, the protein has been detected in cotyledons, flowers, leaves and...”
• Unraveling the iron deficiency responsive proteome in Arabidopsis shoot by iTRAQ-OFFGEL approach
  Zargar, Plant signaling & behavior 2013
  • “...0.849 0.125 AT3G23810 S-adenosyl-l-homocysteine (SAH) hydrolase 2 1.3 0.2 0.301 0.044 0.505 0.071 0.966 0.196 AT2G17695 Unknown protein 2.3 0.1 0.311 0.271 N.D. N.D. AT1G30120 pyruvate dehydrogenase E1 beta 2.7 0.1 0.314 0.033 0.492 0.043 0.793 0.316 AT1G01620 plasma membrane intrinsic protein 1C 4.0 0.2 0.316...”

cg1745 hypothetical protein from Corynebacterium glutamicum ATCC 13032
Aligns to 10:155 / 158 (92.4%), covers 92.4% of PF09348, 125.1 bits

• Overexpression of the primary sigma factor gene sigA improved carotenoid production by Corynebacterium glutamicum: Application to production of β-carotene and the non-native linear C50 carotenoid bisanhydrobacterioruberin
  Taniguchi, Metabolic engineering communications 2017
  • “...under the control of P tuf promoter integrated into the cgp 2 cured region between cg1745 and cg1753 ( Henke et al., 2016 ) LYC5 sigB sigB deletion mutant of LYC5 this study BETA3 LYC5 derivatives with insertion of crtY from P. ananatis under the control...”
• Optimization of the IPP Precursor Supply for the Production of Lycopene, Decaprenoxanthin and Astaxanthin by Corynebacterium glutamicum
  Heider, Frontiers in bioengineering and biotechnology 2014
  • “...(cg1039) under control of the P tuf promoter integrated into the cgp2 cured region between cg1745 and cg1753 This work LYC3-Op2 LYC3 derivative with dxr (cg2208), ispG (cg2206), and ispH (cg1164) under control of the P tuf promoter integrated into the cgp1 cured region between cg1506...”
  • “...(cg1039) under control of the P tuf promoter integrated into the cgp2 cured region between cg1745 and cg1753 This work LYC3-MEP LYC3-Op1Op2 derivative with with dxs (cg2083) under control of the P tuf promoter integrated into the intergenic region of cg2083 and cg2084 This work OTHER...”

SACE_4249 hypothetical protein from Saccharopolyspora erythraea NRRL 2338
Aligns to 90:208 / 234 (50.9%), covers 62.4% of PF09348, 39.8 bits

• Comparative genomics and transcriptional profiles of Saccharopolyspora erythraea NRRL 2338 and a classically improved erythromycin over-producing strain
  Peano, Microbial cell factories 2012
  • “...function SACE_3850 261 Frameshift (-G 388) Unknown function SACE_3925 188 Frameshift (+A 437/438) Unknown function SACE_4249 234 Frameshift (-G 640) Unknown function SACE_4310 480 Frameshift (-C 1146) Unknown function SACE_4451 291 In frame insertion (-102D,-103A, -104N,-105E, -106Q) Unknown function SACE_4989 38 Insertion between SACE_5103 and SACE_5105...”

DRA0230 hypothetical protein from Deinococcus radiodurans R1
DR_A0230 DUF1990 family protein from Deinococcus radiodurans R1 = ATCC 13939 = DSM 20539
Aligns to 43:174 / 199 (66.3%), covers 53.5% of PF09348, 27.0 bits

• A novel OxyR sensor and regulator of hydrogen peroxide stress with one cysteine residue in Deinococcus radiodurans
  Chen, PloS one 2008
  • “...0.008664458 DRA0333 Zn-finger+FHA domain containing protein 4.284262 0.000166068 DRB0036 Oxidoreductase, authentic point mutation 4.163247 0.015962058 DRA0230 Predicted protein 4.049166 0.000261909 DRA0331 VWFA Mg-binding domain protein 3.974087 0.000165997 DR0995 Protein of uncharacterized conserved family 3.861446 0.008895311 DR2182 Predicted protein 3.851292 0.003993378 DR2180 Uncharacterized small family of predominantly...”
• Proteomic Response of Deinococcus radiodurans to Short-Term Real Microgravity during Parabolic Flight Reveals Altered Abundance of Proteins Involved in Stress Response and Cell Envelope Functions
  Moors, Life (Basel, Switzerland) 2021
  • “...0.63 Lipopolysaccharide biosynthesis protein, putative DR_0444 -0.39 GHL10 domain-containing protein DR_A0207 0.53 DUF1990 domain-containing protein DR_A0230 0.38 Uncharacterized protein DR_1773 0.40 zf-RING_7 domain-containing protein DR_0291 0.36 Uncharacterized protein DR_A0190 0.37 Site-determining protein DR_0752 0.34 Propionyl-CoA carboxylase, beta subunit, putative DR_1542 0.36 DUF11 domain-containing protein DR_0685 0.33...”

Or search for genetic data about PF09348 in the Fitness Browser