Family Search for PF09831 (DUF2058)

PF09831 hits 9 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

PA0937 hypothetical protein from Pseudomonas aeruginosa PAO1
CIA_00836 DUF2058 family protein from Pseudomonas aeruginosa PA14
Aligns to 4:179 / 179 (98.3%), covers 100.0% of PF09831, 211.2 bits

• Pseudomonas aeruginosa two-component system CprRS regulates HigBA expression and bacterial cytotoxicity in response to LL-37 stress
  Song, PLoS pathogens 2024
  • “...0.026204 PA4371 CIA_00447 Cytochrome c domain-containing protein -1.65775 0.016008 PA0863 CIA_00757 Probable oxidoreductase -1.56208 0.033593 PA0937 CIA_00836 hypothetical protein -1.00677 0.000234 PA1015 CIA_00916 IclR family transcriptional regulator -1.51766 0.038518 PA1137 CIA_01043 Probable oxidoreductase -2.06519 0.003396 PA1513 CIA_01430 Recombination protein RecR -2.69237 0.013884 PA1648 CIA_01568 Probable oxidoreductase...”
• The novel two-component regulatory system BfiSR regulates biofilm development by controlling the small RNA rsmZ through CafA
  Petrova, Journal of bacteriology 2010
  • “...sites were three located upstream of hypothetical genes (PA0937, PA1393, and PA2224), as well as three upstream of genes encoding proteins involved in...”
• Lipopolysaccharide O-antigen chain length regulation in Pseudomonas aeruginosa serogroup O11 strain PA103
  Kintz, Journal of bacteriology 2008
  • “...HindIII Wzz2 Ext Rv CATGAATTCGAAGAACTGCGGCAGATAGG EcoRI PA0937 Fd AAGCTGGAAAGCGACGACTA PA0939 Rv CATGCCATCTTCACACCTTG a Creating pEX18-wzz1 Creating pEX18-wzz1...”
  • “...of the area surrounding the proposed wzz2 gene, using primers PA0937 Fd and PA0939 Rv (Table 2), indicated that this gene was in the same region of the genome...”
• Pseudomonas aeruginosa two-component system CprRS regulates HigBA expression and bacterial cytotoxicity in response to LL-37 stress
  Song, PLoS pathogens 2024
  • “...PA4371 CIA_00447 Cytochrome c domain-containing protein -1.65775 0.016008 PA0863 CIA_00757 Probable oxidoreductase -1.56208 0.033593 PA0937 CIA_00836 hypothetical protein -1.00677 0.000234 PA1015 CIA_00916 IclR family transcriptional regulator -1.51766 0.038518 PA1137 CIA_01043 Probable oxidoreductase -2.06519 0.003396 PA1513 CIA_01430 Recombination protein RecR -2.69237 0.013884 PA1648 CIA_01568 Probable oxidoreductase -1.82312...”

PP1658 conserved hypothetical protein from Pseudomonas putida KT2440
Aligns to 4:179 / 179 (98.3%), covers 100.0% of PF09831, 208.1 bits

• UEG Week 2023 Poster Presentations
  , United European gastroenterology journal 2023

A7N8F2 DUF2058 domain-containing protein from Vibrio campbellii (strain ATCC BAA-1116)
Aligns to 5:173 / 173 (97.7%), covers 100.0% of PF09831, 202.3 bits

• Eukaryotic catecholamine hormones influence the chemotactic control of Vibrio campbellii by binding to the coupling protein CheW
  Weigert, Proceedings of the National Academy of Sciences of the United States of America 2022
  • “..., Table S2 ). In the soluble fraction, we found three uncharacterized proteins (A7MXS1, A7N2H7, A7N8F2). In the insoluble fraction, we found the Der GTPase-activating protein YihI (A7MTV7), the 30S ribosomal protein S7 (A7MZ63), the translation initiation factor IF-1 (A7N1L7), and four other uncharacterized proteins (A7MYT1,...”

YaiL / b0354 DUF2058 domain-containing protein YaiL from Escherichia coli K-12 substr. MG1655 (see paper)
UTI89_C0374 hypothetical protein from Escherichia coli UTI89
b0354 nucleoprotein/polynucleotide-associated enzyme from Escherichia coli str. K-12 substr. MG1655
Aligns to 5:179 / 179 (97.8%), covers 100.0% of PF09831, 198.8 bits

• DFI-seq identification of environment-specific gene expression in uropathogenic Escherichia coli
  Madelung, BMC microbiology 2017
  • “...acid-CoA ligase; O-succinylbenzoate synthase; naphthoate synthase 3 1.731787 galS DNA-binding transcriptional regulator GalS 1 1.715122 UTI89_C0374 Hypothetical protein (nucleoprotein/polynucleotide-associated enzyme) 1 1.701595 fadB multifunctional fatty acid oxidation complex subunit alpha 1 1.682517 ampD ; ampE N-acetyl-anhydromuranmyl-L-alanine amidase; regulatory protein AmpE 2 1.671218 narG ; narH; narJ;...”
• The gut microbiota correlate with the disease characteristics and immune status of patients with untreated diffuse large B-cell lymphoma
  Lin, Frontiers in immunology 2023
  • “...cell functions, so 75 proteins were specific to c_Gammaproteobacteria or o_Enterobacteriales , while four including b0354, b1132, b1179, and b3033 were present only in c_Gammaproteobacteria. The functions of these specific proteins may help explain the common physiological or biochemical characteristics of these bacteria and future studies...”
• Transcriptional profile of the Escherichia coli response to the antimicrobial insect peptide cecropin A
  Hong, Antimicrobial agents and chemotherapy 2003
  • “...(L v C) dr dc yacH (b0117) mbhA (b0230) yaiL (b0354) acrB (b0462) ylcD (b0574) entE (b0594) ybfC (b0704) rh1E (b0797) ybiA (b0798) ybiX (b0804) -- (b0817) --...”
• Interfering with different steps of protein synthesis explored by transcriptional profiling of Escherichia coli K-12
  Sabina, Journal of bacteriology 2003
  • “...uhpC b2451 rpsU rpmJ wbbJ rplO b1593 gapC_2 dadA b0354 b3857 b2034 b2003 b1983 b4185 b4202 b3845 b2447 b3298 b1601 b2272 b4200 b3313 b3057 b0580 b3312 b0833...”

Z0454 nucleoprotein/polynucleotide-associated enzyme from Escherichia coli O157:H7 EDL933
Aligns to 5:179 / 179 (97.8%), covers 100.0% of PF09831, 196.3 bits

• Pyelonephritis in slaughter pigs and sows: morphological characterization and aspects of pathogenesis and aetiology
  Isling, Acta veterinaria Scandinavica 2010
  • “...according to the manufacturers' instructions. c A three layer horseradish PAP (peroxidase anti-peroxidase) technique using Z0454 (Dakocytomation, Denmark) (1:200 in TBS, 30 min RT) and P1901 (Sigma-Aldrich A/s, Denmark) (1:100 in TBS, 30 min RT). d Donkey Anti-Sheep/Goat immunoglobulins (peroxidase conjugate) (AP360, The Binding Site Ltd,...”

STM4192 putative cytoplasmic protein from Salmonella typhimurium LT2
Aligns to 5:179 / 179 (97.8%), covers 100.0% of PF09831, 190.1 bits

• The GATC-binding protein SeqA is required for bile resistance and virulence in Salmonella enterica serovar typhimurium
  Prieto, Journal of bacteriology 2007
  • “...STM2609 yeaR ygiN menF STM2743 STM1671 STM4493 chaB yijP STM4192 deoA yidE avrA sbcC ybeU STM4493 glgP STM4015 adi yeeY narJ SeqA mutant/ wild-type expression...”

YPK_2500 hypothetical protein from Yersinia pseudotuberculosis YPIII
Aligns to 5:179 / 179 (97.8%), covers 100.0% of PF09831, 189.5 bits

• The main virulence determinant of Yersinia entomophaga MH96 is a broad-host-range toxin complex active against insects
  Hurst, Journal of bacteriology 2011
  • “...GGDEF domain 91/94//179 (1-179), hypothetical protein YPK_2500 (179) 90/93//232 (1-232), pseudouridylate synthases, 23S RNA-specific COG0564 (232) 97%b...”

XOO3803 hypothetical protein from Xanthomonas oryzae pv. oryzae KACC10331
Aligns to 4:181 / 181 (98.3%), covers 100.0% of PF09831, 187.4 bits

• Identification of phenolic compounds that suppress the virulence of Xanthomonas oryzae on rice via the type III secretion system
  Fan, Molecular plant pathology 2017 (secret)
• Effects on promoter activity of base substitutions in the cis-acting regulatory element of HrpXo regulons in Xanthomonas oryzae pv. oryzae
  Tsuge, Journal of bacteriology 2005
  • “...mutant (Fig. 3). These ORFs corresponded to XOO0804 and XOO3803, respectively, in the genomic database of X. oryzae pv. oryzae (Ochiai et al., unpublished). A...”
  • “...with a BLAST program (2) revealed that XOO0804 and XOO3803 are homologous to XAC1124 (88%) and XAC0601 (91%) in X. axonopodis pv. citri (8), but they have...”

YPO1575 hypothetical protein from Yersinia pestis CO92
Aligns to 1:170 / 170 (100.0%), covers 97.1% of PF09831, 178.7 bits

• Inhibition of Yersinia pestis DNA adenine methyltransferase in vitro by a stibonic acid compound: identification of a potential novel class of antimicrobial agents
  McKelvie, British journal of pharmacology 2013
  • “...1.60 pyrG CTP synthase 3.83E-02 1.07E-03 1.60 YPO1575 Conserved hypothetical protein 4.97E-02 1.84E-03 1.59 ribD Riboflavin biosynthesis protein RibD 2.22E-02...”

Or search for genetic data about PF09831 in the Fitness Browser