Family Search for PF09909 (DUF2138)

Running HMMer for PF09909

PF09909 hits 2 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

PufY / b2230 DUF2138 domain-containing protein YfaA from Escherichia coli K-12 substr. MG1655 (see 2 papers)
b2230 orf, hypothetical protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 14:559 / 562 (97.2%), covers 99.8% of PF09909, 872.8 bits

• Expression plasmids for use in Candida glabrata
  Zordan, G3 (Bethesda, Md.) 2013
  • “...] pGRB2.1 b2451 This work KF040382 45327 pCU-ACO2-GFP ACO2pr-GFP [Ap R , URA3 ] pGRB2.3 b2230 This work KF040383 45328 pCN-ACO2 ACO2pr empty vector [Ap R , NAT R ] pBM16.1 b2457 This work KF040384 45329 pCN-ACO2-GFP ACO2pr-GFP [Ap R , NAT R ] pBM16 b2235...”
• Genomic SELEX for Hfq-binding RNAs identifies genomic aptamers predominantly in antisense transcripts
  Lorenz, Nucleic acids research 2010
  • “...756 yhjE b3523 Antisense Predicted transporter 354 236 2 334 580 2 334 737 yfaA b2230 Antisense Predicted protein 1237 170 2 863 240 2 863 409 ygbN b2740 Antisense Predicted transporter 998 165 1 241 194 1 241 315 cvrA b1191 Sense Predicted cation/proton antiporter...”
• YdgG (TqsA) controls biofilm formation in Escherichia coli K-12 through autoinducer 2 transport
  Herzberg, Journal of bacteriology 2006
  • “...b2373 b2236 4 4 4 4 4 yfaA yadS b0370 b2230 b0157 b0370 4 4 4 ORF, hypothetical protein ORF, hypothetical protein ORF, hypothetical protein; related to phage...”

PA4491 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 27:586 / 589 (95.1%), covers 99.6% of PF09909, 850.1 bits

• Characterization of a hemolytic and antibiotic-resistant Pseudomonas aeruginosa strain S3 pathogenic to fish isolated from Mahananda River in India
  Ghosh, PloS one 2024
  • “...Leader peptidase (Prepilin peptidase) (EC 3.4.23.43) / N-methyltransferase (EC 2.1.1.-) 15599724 P . aeruginosa PAO1 PA4491 Uncharacterized protein YfaA 15599687 P . aeruginosa PA5441 hypothetical protein 15600634 P . aeruginosa PA5437 Transcriptional regulator PA5437, LysR family 15600630 P . aeruginosa PA0073 ABC transporter, ATP-binding protein 15595271...”
• Assembly of an atypical α-macroglobulin complex from Pseudomonas aeruginosa
  Zouhir, Scientific reports 2018
  • “...deletion in PA4492 ( magA ) in PA01 This work PA01 magB Internal deletion in PA4491 ( magB ) in PA01 This work PA01 magC Internal deletion in PA4490 ( magC) in PA01 This work PA01 magD Internal deletion in PA4489 ( magD ) in PA01...”
  • “...pBAD, Tc R Baynham et al . 30 pSW196- magB .RBS Plasmid for magB .RBS (PA4491) gene complementation This study pSW196- magD Plasmid for magD (PA4489) gene complementation Robert-Genthon et al . 15 PRIMERS SEQUENCE 5-3 CHARACTERISTIC F. D magA 5 GTGGATTTCGCACATTCCGCC Verification magA deletion R....”
• Proteomic Response of Pseudomonas aeruginosa PAO1 Adhering to Solid Surfaces
  Guilbaud, Frontiers in microbiology 2017
  • “...hypothetical protein PA4322 7.2 4.6 1.6 3.5E-05 hypothetical protein PA4842 6.4 3.0 0.2 6.8E-09 MagB PA4491 magB 5.8 5.0 0.6 2.7E-06 2.8E-05 a PseudoCAP-based functional classes of the proteins (p-adjust < 0.01) significantly differentially abundant showing a maximal variation of three spectra between the replicates of...”
  • “...related to the envelope metabolism, i.e., PA2540 is a putative phospholipase, and PA1791, PA4842, and PA4491 are putative membrane proteins. Proteome response of P. aeruginosa adhering to PS compared to G (PS/G) Based on PseudoCAP analysis, most of the dysregulated proteins belonged to six functional classes...”
• Unique features of a Pseudomonas aeruginosa α2-macroglobulin homolog
  Robert-Genthon, mBio 2013
  • “...strain ( Table1 ; see also TableS2 in the supplemental material). Notably, MagA (PA4492), MagB (PA4491), and MagF (PA4487), encoded within the same operon as MagD, were among the most enriched binding partners identified and were further investigated ( Table1 ). FIG5 Immunoprecipitation coupled with LC-MS/MS...”
  • “...name Product name Mean SC of PAO1 retS Mean SC of PAO1 retS magD Enrichment PA4491 magB MagB 86.5 2.5 34.6 PA2462 DUF637 (possible hemagglutinin) 63 2 31.5 PA4487 magF MagF 34.5 1.5 23 PA3068 gdhB NAD-dependent glutamate dehydrogenase 30 0.5 60 PA4492 magA MagA 19...”
• Determination of the regulon and identification of novel mRNA targets of Pseudomonas aeruginosa RsmA
  Brencic, Molecular microbiology 2009
  • “...CDP-alcohol phosphatidyltransferase PA4492 operon ** PA4487 3.2 conserved hypothetical protein PA4489 4.4 conserved hypothetical protein PA4491 4.9 conserved hypothetical protein PA4492 5.8 conserved hypothetical protein Type III Secretion Genes PA0044_ exoT -3.3 exoenzyme T PA1689 -3.2 conserved hypothetical protein PA1694_ pscQ -24.6 translocation protein in T3S...”

Or search for genetic data about PF09909 in the Fitness Browser