Family Search for PF10310 (DUF5427)

PF10310 hits 2 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

MTC1_YEAST / P47018 Maintenance of telomere capping protein 1 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 4 papers)
YJL123C Protein of unknown function that may interact with ribosomes; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm and to COPI-coated vesicles (early Golgi); YJL123C is a non-essential gene from Saccharomyces cerevisiae
Aligns to 6:478 / 478 (99.0%), covers 100.0% of PF10310, 404.8 bits

• function: Involved in telomere capping.
  subunit: Interacts with ribosomes.
• Systematic analysis of membrane contact sites in Saccharomyces cerevisiae uncovers modulators of cellular lipid distribution
  Castro, eLife 2022
  • “...Nus1 M/B + YJL028W Yjl028w M/B 0 YBL050W Sec17 M/B + YMR264W Cue1 M/B + YJL123C Mtc1 M/B + YJL061W Nup82 M/B 0 YLR087C Csf1 M/B 0 YNL063W Mtq1 M/B + YJL207C Laa1 M/B + YFR024C-A Lsb3 M/B 0 YLR148W Pep3 M/B 0 YAR050W Flo1 M/B...”
• τ-SGA: synthetic genetic array analysis for systematically screening and quantifying trigenic interactions in yeast
  Kuzmin, Nature protocols 2021
  • “...and represent a gene of interest and YDL227C in the double mutant control screen (e.g. YJL123C, YDL227C for mtc1::natMX4 ho::KlURA3 ) or two genes of interest the triple mutant screen (e.g. YJL123C, YOL111C for mtc1::natMX4 mdy2::KlURA3 ). Under Score results check Score the normalized output. Click...”
• Widespread Cumulative Influence of Small Effect Size Mutations on Yeast Quantitative Traits
  Hua, Cell systems 2018
  • “...YFR041C, YNL323W, YEL042W, YMR123W, YBR015C, YJR075W, YBR162W-A, YCR067C, YJL004C, YCR017C, YAL026C, YOR216C, YIL090W, YAL007C, YNL041C, YJL123C, YIL040W, YBR164C, YCL045C, YNL051W, YIR004W, YPL050C, YPL051W, YGL126W, YCR034W, YMR292W, YDR233C, YNL297C, YGL005C, YDR245W, YBR036C, YDR221W, YPL192C, YLL014W, YDR508C, YEL001C, YER005W, YDR137W, YDL099W, YGL231C, YHR108W, YMR238W, YAL053W, YIL027C, YER072W, YML038C,...”
• Ecological success of a group of Saccharomyces cerevisiae/Saccharomyces kudriavzevii hybrids in the northern european wine-making environment
  Erny, Applied and environmental microbiology 2012
  • “...8 162-258 F R TGCGACACCATCCGCATTTTC ATGGAAAGTGAAGACAGGTGA YJL123c (MTC1) (CTT)11 4 267-285 F R TAGCATGGCGAATGGAGATC ACGAGGCCGACGGCAGCTCCT SKCTT3 YKL201c (MNN4)...”
• Genomewide analysis reveals novel pathways affecting endoplasmic reticulum homeostasis, protein modification and quality control
  Copic, Genetics 2009
  • “...YMR274C YDR334W YDR227W YJL062W YDR517W YBL038W YDR469W YJL123C YOR355W YMR036C YHR004C YDL099W Functional categorya N-linked glyc. ER-Golgi traffic Lipid...”
  • “...SGA YBL038W Mrpl16 cross/SGA PCR YDR469W Sdc1 cross/SGA SGA YJL123C ORF SGA SGA YOR355W Gds1 SGA SGA YMR036C Mih1 cross/SGA SGA YHR004C Nem1 cross/SGA SGA...”
• A genomewide suppressor and enhancer analysis of cdc13-1 reveals varied cellular processes influencing telomere capping in Saccharomyces cerevisiae
  Addinall, Genetics 2008
  • “...defects of cdc13-1 cells Synthetic lethal ORF YJL123C YNL196C YOR058C YGL029W YBR036C YHR059W YEL003W YNL014W YOL108C YNL106C YKL176C YGR078C YNL015W YNL003C...”
• Covert genetic selections to optimize phenotypes
  Wu, PloS one 2007
  • “...WTM2 YOR229W 0.51 6.7 1 YDL211C YDL211C 0.67 6.4 1.5 YER064C YER064C 0.47 6.3 NT YJL123C YJL123C 0.34 6.8 2 YML082W YML082W 0.82 6.2 3.5 In Sopko et al . 1 is the strongest inhibition. 4 is the least. NT: not tested. In a final liquid...”
  • “...YDR188W NAB2 YGL122C MDR1 YGR100W STP2 YHR006W YHR115C YHR115C YHR161C YHR161C YHR177W YHR177W DP1 YIR004W YJL123C YJL123C B PAP1 YKR002W SSK1 YLR006C B PWP1 YLR196W B ADY4 YLR227C SFP1 YLR403W MSC1 YML128C B DSK2 YMR276W PUS4 YNL292W RVB2 YPL235W YPR011C YPR011C The Table lists the cDNAs...”
• Trinucleotide repeats are clustered in regulatory genes in Saccharomyces cerevisiae
  Young, Genetics 2000
  • “...YGL164C YGL081W YGR089W YGR103W YGR245C YJL181W YJL162C YJL123C YKL172W YLR019W YLR051C YLR196W YMR269W YMR295C YNL323W YNL058C YOL144W YOR123C YOR154W YOR308C...”
  • “...YLR206W YLR437C YMR124W YMR135C YNR014W YPL184C YDL146W YJL123C YOR223W YDR153C YDR289C YDR333C YDR365C YER033C YHR131C YIL112W YJL149W YLR114C YML034W YMR204C...”
• More

MTC1_SCHPO / O94548 Maintenance of telomere capping protein 1 from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see paper)
SPCC1322.09 conserved fungal protein from Schizosaccharomyces pombe
Aligns to 15:423 / 455 (89.9%), covers 99.3% of PF10310, 222.1 bits

• function: Involved in telomere capping.
• Active Replication Checkpoint Drives Genome Instability in Fission Yeast mcm4 Mutant
  Kim, Molecular and cellular biology 2020 (secret)
• A novel function of the mitochondrial transcription factor Mtf1 in fission yeast; Mtf1 regulates the nuclear transcription of srk1
  Sun, Nucleic acids research 2011
  • “...1.7 Alp13 chr2.1112.1 4.73 SPBC4F6.12 2.2 0.2 Pxl1 C SPBC4F6.13c 1.3 0.9 BOP1NT chr2.mini.tile82: 4.59 SPCC1322.09 0.6 6.1 conserved chr2.mini.tile87: 5.32 SPCC1322.09 1.8 1.5 conserved fungal protein chr2.mini.tile37: 4.6 SPCC330.05c 0.5 1.3 Ura4 chr2.mini.tile102: 2.99 SPCC1322.11 0.5 1 L23 The analysis of the top 22 intergenic...”
• Rad51 suppresses gross chromosomal rearrangement at centromere in Schizosaccharomyces pombe
  Nakamura, The EMBO journal 2008
  • “...1986). LEU2 replaced ubcp4 and chk1 genes; ura4 replaced spcc1322.09; ade6-M216 at the original locus was converted to ade6 . (B) From the yeast strain...”
  • “...Further, 0.3- and 0.5-kb regions flanking the ORF, spcc1322.09, were amplified using III_1310A and III_1310B ura4AN5 primers and III_1310C ura4AN3 and III_1310D...”

Or search for genetic data about PF10310 in the Fitness Browser