Family Search for PF10310 (DUF5427)

PF10310.9 hits 2 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

MTC1_YEAST / P47018 Maintenance of telomere capping protein 1 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 4 papers)
YJL123C Protein of unknown function that may interact with ribosomes; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm and to COPI-coated vesicles (early Golgi); YJL123C is a non-essential gene (RefSeq) from Saccharomyces cerevisiae
Aligns to 13:478 / 478 (97.5%), covers 100.0% of PF10310, 407.3 bits

• function: Involved in telomere capping.
  subunit: Interacts with ribosomes.
• Widespread Cumulative Influence of Small Effect Size Mutations on Yeast Quantitative Traits
  Hua, Cell systems 2018
  • “...YFR041C, YNL323W, YEL042W, YMR123W, YBR015C, YJR075W, YBR162W-A, YCR067C, YJL004C, YCR017C, YAL026C, YOR216C, YIL090W, YAL007C, YNL041C, YJL123C, YIL040W, YBR164C, YCL045C, YNL051W, YIR004W, YPL050C, YPL051W, YGL126W, YCR034W, YMR292W, YDR233C, YNL297C, YGL005C, YDR245W, YBR036C, YDR221W, YPL192C, YLL014W, YDR508C, YEL001C, YER005W, YDR137W, YDL099W, YGL231C, YHR108W, YMR238W, YAL053W, YIL027C, YER072W, YML038C,...”
• Ecological success of a group of Saccharomyces cerevisiae/Saccharomyces kudriavzevii hybrids in the northern european wine-making environment
  Erny, Applied and environmental microbiology 2012
  • “...8 162-258 F R TGCGACACCATCCGCATTTTC ATGGAAAGTGAAGACAGGTGA YJL123c (MTC1) (CTT)11 4 267-285 F R TAGCATGGCGAATGGAGATC ACGAGGCCGACGGCAGCTCCT SKCTT3 YKL201c (MNN4)...”
• Genomewide analysis reveals novel pathways affecting endoplasmic reticulum homeostasis, protein modification and quality control
  Copic, Genetics 2009
  • “...YMR274C YDR334W YDR227W YJL062W YDR517W YBL038W YDR469W YJL123C YOR355W YMR036C YHR004C YDL099W Functional categorya N-linked glyc. ER-Golgi traffic Lipid...”
  • “...SGA YBL038W Mrpl16 cross/SGA PCR YDR469W Sdc1 cross/SGA SGA YJL123C ORF SGA SGA YOR355W Gds1 SGA SGA YMR036C Mih1 cross/SGA SGA YHR004C Nem1 cross/SGA SGA...”
• A genomewide suppressor and enhancer analysis of cdc13-1 reveals varied cellular processes influencing telomere capping in Saccharomyces cerevisiae
  Addinall, Genetics 2008
  • “...defects of cdc13-1 cells Synthetic lethal ORF YJL123C YNL196C YOR058C YGL029W YBR036C YHR059W YEL003W YNL014W YOL108C YNL106C YKL176C YGR078C YNL015W YNL003C...”
• Covert genetic selections to optimize phenotypes
  Wu, PloS one 2007
  • “...WTM2 YOR229W 0.51 6.7 1 YDL211C YDL211C 0.67 6.4 1.5 YER064C YER064C 0.47 6.3 NT YJL123C YJL123C 0.34 6.8 2 YML082W YML082W 0.82 6.2 3.5 In Sopko et al . 1 is the strongest inhibition. 4 is the least. NT: not tested. In a final liquid...”
  • “...YDR188W NAB2 YGL122C MDR1 YGR100W STP2 YHR006W YHR115C YHR115C YHR161C YHR161C YHR177W YHR177W DP1 YIR004W YJL123C YJL123C B PAP1 YKR002W SSK1 YLR006C B PWP1 YLR196W B ADY4 YLR227C SFP1 YLR403W MSC1 YML128C B DSK2 YMR276W PUS4 YNL292W RVB2 YPL235W YPR011C YPR011C The Table lists the cDNAs...”
• Genome-scale analysis reveals Sst2 as the principal regulator of mating pheromone signaling in the yeast Saccharomyces cerevisiae
  Chasse, Eukaryotic cell 2006
  • “...of TRF5 interferes with the expression of CLA4. For yjl123c, the additional mutation appears to be in SST2, since in this case full rescue Downloaded from...”
  • “...II mutant cla4. Rescue was not observed for yjl123c, eap1, ylr068w, or trf5 (see Table S1 in the supplemental material). Considering that each plasmidborne...”
• Trinucleotide repeats are clustered in regulatory genes in Saccharomyces cerevisiae
  Young, Genetics 2000 (secret)
• Disruption and basic functional analysis of five chromosome X novel ORFs of Saccharomyces cerevisiae reveals YJL125c as an essential gene for vegetative growth
  Jaquet, Yeast (Chichester, England) 1999 (PubMed)
  • “...of the Saccharomyces cerevisiae genome: YJL118w, YJL122w, YJL123c, YJL124c, YJL125c, located on chromosome X. Disruptions have been realized using the...”
  • “...functional analysis; chromosome X; YJL118w; YJL122w; YJL123c; YJL124c; YJL125c INTRODUCTION The sequence of the yeast Saccharomyces cerevisiae genome...”
• More

MTC1_SCHPO / O94548 Maintenance of telomere capping protein 1 from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see paper)
SPCC1322.09 conserved fungal protein (RefSeq) from Schizosaccharomyces pombe
Aligns to 15:423 / 455 (89.9%), covers 99.4% of PF10310, 227.2 bits

• function: Involved in telomere capping.
• Overlapping Roles in Chromosome Segregation for Heterochromatin Protein 1 (Swi6) and DDK in Schizosaccharomyces pombe
  Shen, Genetics 2019 (secret)
• CDK promotes interactions of Sld3 and Drc1 with Cut5 for initiation of DNA replication in fission yeast
  Fukuura, Molecular biology of the cell 2011 (no snippet)
• A novel function of the mitochondrial transcription factor Mtf1 in fission yeast; Mtf1 regulates the nuclear transcription of srk1
  Sun, Nucleic acids research 2011
  • “...1.7 Alp13 chr2.1112.1 4.73 SPBC4F6.12 2.2 0.2 Pxl1 C SPBC4F6.13c 1.3 0.9 BOP1NT chr2.mini.tile82: 4.59 SPCC1322.09 0.6 6.1 conserved chr2.mini.tile87: 5.32 SPCC1322.09 1.8 1.5 conserved fungal protein chr2.mini.tile37: 4.6 SPCC330.05c 0.5 1.3 Ura4 chr2.mini.tile102: 2.99 SPCC1322.11 0.5 1 L23 The analysis of the top 22 intergenic...”
• Rad51 suppresses gross chromosomal rearrangement at centromere in Schizosaccharomyces pombe
  Nakamura, The EMBO journal 2008
  • “...1986). LEU2 replaced ubcp4 and chk1 genes; ura4 replaced spcc1322.09; ade6-M216 at the original locus was converted to ade6 . (B) From the yeast strain...”
  • “...Further, 0.3- and 0.5-kb regions flanking the ORF, spcc1322.09, were amplified using III_1310A and III_1310B ura4AN5 primers and III_1310C ura4AN3 and III_1310D...”

Or search for genetic data about PF10310 in the Fitness Browser