Family Search for PF10615 (DUF2470)
PF10615 hits 30 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
Npun_F4928 hypothetical protein (RefSeq) from Nostoc punctiforme
Aligns to 10:85 / 94 (80.9%), covers 100.0% of PF10615, 87.4 bits
asl4369 hypothetical protein (NCBI ptt file) from Nostoc sp. PCC 7120
Aligns to 10:85 / 94 (80.9%), covers 100.0% of PF10615, 85.6 bits
- Proteomic Insights into Starvation of Nitrogen-Replete Cells of Nostoc sp. PCC 7120 under β-N-Methylamino-L-Alanine (BMAA) Treatment.
Koksharova, Toxins 2020 - “...several interesting candidates for further analysis. They are hypothetical proteins, encoded by genes all1338 , asl4369 and all4580 . These proteins were identified only in the control samples and not in the BMAA-treated samples ( Supplementary Table S2 ). All these and other hypothetical proteins can...”
- “...RecA 3.03 3.7 nodM 2.2 1.43 Alr4505 6.67 3.57 All1411 4.55 2.7 Alr3297 0.67 1.29 Asl4369 Control Control * The fold changes between the BMAA-treated samples and control sample are shown, ( p < 0.1). The word Control indicates that the protein was present only in...”
PFL_4841 Protein of unknown function (DUF319) family (NCBI) from Pseudomonas fluorescens Pf-5
Aligns to 159:229 / 243 (29.2%), covers 93.5% of PF10615, 60.0 bits
PP1358 conserved hypothetical protein (NCBI ptt file) from Pseudomonas putida KT2440
Aligns to 205:275 / 289 (24.6%), covers 94.8% of PF10615, 58.6 bits
6m0aB / Q8LDU1 The heme-bound structure of the chloroplast protein at3g03890 (see paper)
Aligns to 176:250 / 256 (29.3%), covers 97.4% of PF10615, 53.1 bits
- Ligands: protoporphyrin ix containing fe; azide ion (6m0aB)
MSMEG_6519 pyridoxamine 5'-phosphate oxidase family protein (NCBI) from Mycobacterium smegmatis str. MC2 155
Aligns to 184:259 / 266 (28.6%), covers 98.7% of PF10615, 52.8 bits
AT3G03890 FMN binding (RefSeq) from Arabidopsis thaliana
Q8LDU1 AT3G03890 protein from Arabidopsis thaliana
Aligns to 240:314 / 321 (23.4%), covers 97.4% of PF10615, 52.6 bits
- Activation of the VQ Motif-Containing Protein Gene VQ28 Compromised Nonhost Resistance of Arabidopsis thaliana to Phytophthora Pathogens.
Lan, Plants (Basel, Switzerland) 2022 - “...Sequence alignment showed the exact insertion sites revealing at least four T-DNA insertion breakpoints ( AT3G03890 , AT3G03980 , AT4G20010 , and AT4G27390 ) in the mutant ( Figure 1 A). As showed in Figure 1 A, breakpoints 1 and 2 were respectively detected in the...”
- “...1 B). This showed that AT3G03980 in esp1 was completely knocked out. Transcript levels of AT3G03890 , AT4G20010 , and AT4G27390 were slightly lower compared to WT. More interestingly, the expression of VQ28 ( AT4G20000 ) was up-regulated by more than 15-fold whereas expression levels of...”
- Heme oxygenase-independent bilin biosynthesis revealed by a hmox1 suppressor screening in Chlamydomonas reinhardtii
Zhang, Frontiers in microbiology 2022 - “...J. Guo Q. Li X. Wang X. Liu L. ( 2020 ). The Arabidopsis locus AT3G03890 encodes a dimeric beta-barrel protein implicated in heme degradation. Biochem. J. 477 4785 4796 . 10.1042/BCJ20200712 33284325 Wang L. Yamano T. Kajikawa M. Hirono M. Fukuzawa H. ( 2014 )....”
- The Arabidopsis locus AT3G03890 encodes a dimeric β-barrel protein implicated in heme degradation.
Wang, The Biochemical journal 2020 (PubMed)- “...this work, we discovered that the Arabidopsis locus AT3G03890 encodes a dimeric -barrel protein that is structurally related to the putative non-canonical HO...”
- “...user on 17 January 2022 The Arabidopsis locus AT3G03890 encodes a dimeric -barrel protein implicated in heme degradation Biochemical Journal (2020) 477...”
- Ectopic RING zinc finger gene from hot pepper induces totally different genes in lettuce and tobacco
Kesawat, Molecular breeding : new strategies in plant improvement 2018 - “...(ADG1) 0.02 0.26 0.41 2.79 At5g08530 NADH dehydrogenase (ubiquinone) flavoprotein 1(CI51) 0.02 1.22 1.53 3.02 At3g03890 FMN binding protein 1.39 1.59 2.08 3.12 At4g10120 Sucrose-phosphate synthase 0 0 0 2.44 At5g66230 Chalcone-flavanone isomerase family protein 0 0 0 4.34 At1g17420 Lipoxygenase 3 (LOX3) 0 0 0...”
- Partial Activation of SA- and JA-Defensive Pathways in Strawberry upon Colletotrichum acutatum Interaction
Amil-Ruiz, Frontiers in plant science 2016 - “...AT5G17920 Methionine synthase 2.20 3.95E-02 M9F8 gene16275 AT4G39970 Haloacid dehalogenase-like hydrolase 2.02 3.95E-02 M7B2 gene10408 AT3G03890 Flavin mononucleotide binding 1.94 3.95E-02 M14A10 gene29476 AT5G52820 WD-40 repeat CUL4 RING ubiquitin ligase complex 1.94 3.95E-02 M5B7 gene09169 AT1G48380 DNA binding protein ROOT HAIRLESS 1, component of the topoisomerase...”
- Arabidopsis thaliana PGR7 encodes a conserved chloroplast protein that is necessary for efficient photosynthetic electron transport
Jung, PloS one 2010 - “...FMN-binding split barrel (IPR009002) ( Figure 8A ). This FMN-binding domain was previously detected in At3g03890 (UniProt accession Q8LDU1), which is one of three homologs of PGR7 that are encoded in the Arabidopsis genome. The second domain (residues 196 to 285) is a conserved domain of...”
- Full-length messenger RNA sequences greatly improve genome annotation
Haas, Genome biology 2002 - “...Expressed protein Ceres:12996, gi:14596058 At5g61880 Expressed protein Ceres:146274, gi:14517497 At3g14230 RAP2 family protein Ceres:158240, gi:15450917 At3g03890 Expressed protein Ceres:18355, gi:14190432 At1g67700 Expressed protein Ceres:19973, gi:15215605 At3g55630 Tetrahydrofolylpolyglutamate synthase Ceres:230791, gi:15292866 At2g21620 Expressed protein Ceres:31655, gi:15320407 At4g10100 Expressed protein Ceres:35962, gi:6635742 At1g23950 Expressed protein Ceres:41387, gi:15146261 At1g24260...”
- Arabidopsis thaliana PGR7 encodes a conserved chloroplast protein that is necessary for efficient photosynthetic electron transport
Jung, PloS one 2010 - “...(IPR009002) ( Figure 8A ). This FMN-binding domain was previously detected in At3g03890 (UniProt accession Q8LDU1), which is one of three homologs of PGR7 that are encoded in the Arabidopsis genome. The second domain (residues 196 to 285) is a conserved domain of unknown function (PFAM...”
jhp0301 putative (NCBI ptt file) from Helicobacter pylori J99
Aligns to 2:74 / 251 (29.1%), covers 98.7% of PF10615, 49.5 bits
- Complexomics study of two Helicobacter pylori strains of two pathological origins: potential targets for vaccine development and new insight in bacteria metabolism
Bernarde, Molecular & cellular proteomics : MCP 2010 - “...JHP0216 JHP0560 JHP1091 JHP0763 JHP1471 JHP0101 JHP0720 JHP0301 JHP0764 JHP0508 JHP1290 JHP0295 JHP0673 JHP1388 JHP no. NP_223060 NP_222972 NP_222745 NP_224008...”
- Identification of Proteins Related to Nickel Homeostasis in Helicobater pylori by Immobilized Metal Affinity Chromatography and Two-Dimensional Gel Electrophoresis
Sun, Metal-based drugs 2008 - “...(OM jhp1427 and HpaA), iron storage protein (Pfr), and hypothetical proteins (HP0271, HP jhp0216, HP jhp0301, HP0721, HP0614, and HP jhp0118). The implication of these proteins in nickel homeostasis is discussed. 1. INTRODUCTION The human gastric pathogen Helicobacter pylori ( H. pylori ) is a microaerophilic,...”
- “...identification. Interestingly, five of the proteins identified, including UreA, HspB, fumarase, Pfr, and hypothetical protein jhp0301, show more than one spot in the 2-DE map, indicating the presence of posttranslational modifications. Protein isoforms typically present themselves as a series of spots that differ slightly in their...”
- Multiple chromosomal loci for the babA gene in Helicobacter pylori
Hennig, Infection and immunity 2006 - “...5ACCCTAATGGGCATGTGGTA jhp0832 jhp0835 jhp1163 jhp1165 jhp0298 jhp0301 (HP0893); (HP0898); (HP1242); (HP1244); (HP0313); (HP0318); locus locus locus locus locus...”
- Growth phase-dependent response of Helicobacter pylori to iron starvation
Merrell, Infection and immunity 2003 - “...JHP0089 JHP0097 JHP0190 JHP0290 JHP0294 JHP0295 JHP0296 JHP0301 JHP1014 JHP0557 JHP0571 JHP0584 JHP0649 JHP0683 JHP0854 JHP0879 JHP1436 JHP1433 JHP1347 JHP1348...”
- “...HP0773 HP0914 *HP0944 HP1173 HP1182 HP1507 JHP0294 JHP0301 JHP0542 JHP0557 JHP0635 JHP0649 JHP0657 JHP0658 JHP0683 JHP0710 JHP0850 JHP0879 JHP1100 JHP1108...”
- pH-regulated gene expression of the gastric pathogen Helicobacter pylori
Merrell, Infection and immunity 2003 - “...JHP0657 JHP0584 JHP1251 JHP0213 JHP1146 JHP0301 JHP1323 JHP1400 JHP0696 JHP0404 JHP0694 Putative transcriptional regulator...”
HUGZ_HELPY / O25087 Heme oxygenase HugZ; EC 1.14.99.- from Helicobacter pylori (strain ATCC 700392 / 26695) (Campylobacter pylori) (see 3 papers)
HP0318 conserved hypothetical protein (NCBI ptt file) from Helicobacter pylori 26695
Aligns to 2:74 / 251 (29.1%), covers 98.7% of PF10615, 49.3 bits
- function: Involved in heme iron utilization (PubMed:19091096, PubMed:21030596). Catalyzes the degradation of heme to biliverdin, with the release of iron and carbon monoxide (PubMed:19091096, PubMed:21030596). Release of iron from heme may play a crucial role in the pathogenicity of H.pylori (PubMed:19091096).
catalytic activity: 3 AH2 + 3 H(+) + heme b + 3 O2 = 3 A + biliverdin delta + CO + Fe(2+) + 3 H2O (RHEA:52224)
subunit: Homodimer.
disruption phenotype: Deletion mutant cannot utilize heme iron for normal growth. - Helicobacter pylori BabA-SabA Key Roles in the Adherence Phase: The Synergic Mechanism for Successful Colonization and Disease Development.
Doohan, Toxins 2021 - “...strains [ 11 ]. Marker genes, such as s18 , the heme oxygenase gene ( hp0318 ), and hypD were used to determine the chromosomal location of each bab gene [ 12 ]. In the H. pylori 26695 strain, Loci A, B, and C are located...”
- SpoT-mediated NapA upregulation promotes oxidative stress-induced Helicobacter pylori biofilm formation and confers multidrug resistance.
Zhao, Antimicrobial agents and chemotherapy 2021 - “...23 had five or more edges, while only 4 genes ( hp0893 , hp1453 , hp0318 , and hp0108 ) had low edge numbers ( Fig. 4C ). Additionally, the magenta module, with 53 genes, and the light yellow module, with 43 genes, were correlated with...”
- The Role of a Dipeptide Transporter in the Virulence of Human Pathogen, Helicobacter pylori
Xu, Frontiers in microbiology 2021 - “...dppC 2.088 HP0301 dppD 2.4619 HP0302 dppF 2.0374 HP0303 obgE A-3.1174 HP0304 Predicted gene 2.0838 HP0318 Predicted gene 1.2903 HP0364 nrdF 1.1763 HP0377 dsbC 1.3781 HP0378 ycf5 1.1151 HP0390 tagD 2.3061 HP0415 Predicted gene 2.9304 HP0514 rplI 1.1937 HP0515 hslV 1.2219 HP0609 Predicted gene 1.0705 HP0616...”
- High-Salt Conditions Alter Transcription of Helicobacter pylori Genes Encoding Outer Membrane Proteins.
Loh, Infection and immunity 2018 - “...HPB8_1493 HPB8_1511 HPB8_1525 HPB8_1526 HPB8_1551 HPB8_1702 HP0325 HP0318 HP0296 HP0291 HP0256 HP0227 HP0220 HP0189 HP0115 HP0073 HP0072 HP0057 HP1354 HP1355...”
- “...HP0601 HP0630 HP0642 HP0696 HP0731 HP0751 HP0802 HP0809 HP0318 HP0291 HP0229 HP0135 HP0115 HP0072 HP0025 HP1399 HP1400 jhp0828 Gene name or function pspA rplW...”
- Helicobacter pylori BabA in adaptation for gastric colonization
Ansari, World journal of gastroenterology 2017 - “...least 3 different chromosomal loci. The three marker genes hypD, s18 and heme oxygenase gene hp0318 represent the chromosomal location of bab genes. The bab gene found downstream of hypD , s18 and hp0318 is said to be located at locus A, locus B and locus...”
- “...( hp0896 ) and babC ( hp0317 ) are located downstream of s18, hypD and hp0318 (locus B, locus A and locus C) respectively. Similarly, in strain HPAG1, the babA, babB and babC are located downstream of hypD , hp0318 and s18 (locus A, locus C...”
- Helicobacter pylori bab characterization in clinical isolates from Bhutan, Myanmar, Nepal and Bangladesh
Ansari, PloS one 2017 - “...the 3 marker genes. The bab gene located downstream of gene hypD , s18 and hp0318 represents the localization of bab gene at locus A, locus B and locus C, respectively in 26695 strain [ 9 ]. The recent X-ray structure of BabA revealed three pronged...”
- Quantum changes in Helicobacter pylori gene expression accompany host-adaptation
Chua, DNA research : an international journal for rapid publication of reports on genes and genomes 2017 - “...chromosomal locations, downstream of the hypD gene (locus A), the rpsR gene (locus B) and hp0318 in H. pylori 26695 (locus C), respectively. 31 , 35 Nevertheless not all bab genes are present within each H. pylori strain. There are some strains which do not possess...”
- Aconitase Functions as a Pleiotropic Posttranscriptional Regulator in Helicobacter pylori
Austin, Journal of bacteriology 2015 - “...HP1456 HP1099 HP1582 HP0887 HP0390 HP0410 HP1588 HP1256 HP0318 HP0590 HP1178 HP1376 HP0891 HP1388 Gene (Continued on following page) October 2015 Volume 197...”
- More
- Outer Membrane Vesicles Secreted by Helicobacter pylori Transmitting Gastric Pathogenic Virulence Factors
Wei, ACS omega 2022 - “...O24951 HP_0139 223 P66637 rpsI 224 O25036 Omp8 225 P56191 ddl 226 P56052 rpmC 227 O25087 hugZ 228 P48370 gyrA 229 O25080 pgdA 230 O25276 Cag22 231 O25157 HP_0396 232 O25773 proC 233 O25996 HP_1458 234 O25424 ansA 235 P56020 rpsM 236 O25283 accA 237 O25342...”
- “...P56018 rpsK 236 O25820 Dld 237 P56029 rplA 238 O25255 HP_0518 239 O24863 HP_0018 240 O25087 hugZ 241 O26037 HP_1507 242 P56084 atpC 243 O24930 CpdB 244 P56020 rpsM 245 O25368 mqnE 246 P55970 grpE 247 O25218 Omp11 248 P64653 HP_0122 249 O25234 HP_0492 250 O25383...”
E1PY38 Putative heme iron utilization protein from Helicobacter pylori (strain SJM180)
Aligns to 2:74 / 251 (29.1%), covers 98.7% of PF10615, 49.2 bits
HPSH_01645 hypothetical protein (RefSeq) from Helicobacter pylori Shi470
Aligns to 2:74 / 251 (29.1%), covers 98.7% of PF10615, 49.1 bits
- New implications on genomic adaptation derived from the Helicobacter pylori genome comparison
Lara-Ramírez, PloS one 2011 - “...3 jhp_0043-jhp_0298 4 HPAG1_0046-HPAG1_0317 3 HPP12_0044-HPP12_0312 3 HPSH_00245-HPSH_01635 5 Jhp_0301-Jhp_0330 5 HPAG1_0321-HPAG1_0351 4 HPP12_0315-HPP12_0350 4 HPSH_01645- HPSH_01835 6 Jhp_0333-Jhp_0413 6 HPAG1_0354-HPAG1_0436 5 HPP12_0352-HPP12_0433 5 HPSH_01850-HPSH_02260 7 Jhp_0414-jhp_0439 7 HPAG1_0437-HPAG1_0463 6 HPP12_0434-HPP12_0494 6 HPSH_02265-HPSH_02405 8 Jhp_0442-jhp_0556 8 HPAG1_0466- HPAG1_0590 7 HPP12_0498-HPP12_0618 14 HPSH_04465-HPSH_03815 4 Jhp_0299-jhp_0300 9 HPAG1_0591-HPAG1_0594...”
HPF32_0987 HugZ family heme oxygenase from Helicobacter pylori F32
Aligns to 2:74 / 251 (29.1%), covers 98.7% of PF10615, 49.1 bits
3gasA / C0LU01 Crystal structure of helicobacter pylori heme oxygenase hugz in complex with heme
Aligns to 1:73 / 248 (29.4%), covers 97.4% of PF10615, 48.6 bits
- Ligands: protoporphyrin ix containing fe; azide ion (3gasA)
NTHI1022 putative heme iron utilization protein (RefSeq) from Haemophilus influenzae 86-028NP
Aligns to 4:91 / 253 (34.8%), covers 80.5% of PF10615, 46.1 bits
HI0854 conserved hypothetical protein (NCBI ptt file) from Haemophilus influenzae Rd KW20
Aligns to 4:91 / 253 (34.8%), covers 80.5% of PF10615, 44.0 bits
- Crystal structure of HugZ, a novel heme oxygenase from Helicobacter pylori
Hu, The Journal of biological chemistry 2011 - “...Structure FIGURE 5. Sequence alignment of HugZ, Cj1613c, HI0854, and some of the smaller heme-utilization proteins. Residues in bold font with black background...”
- “...C. jejuni protein Cj1613c, H. influenzae protein HI0854, Photobacterium sp. SKA34 HugZ, Vibrio alginolyticus protein V12G01-06051, Shewanella sp. ANA-3,...”
- Complete genome sequence of Haemophilus somnus (Histophilus somni) strain 129Pt and comparison to Haemophilus ducreyi 35000HP and Haemophilus influenzae Rd
Challacombe, Journal of bacteriology 2007 - “...in H. ducreyi 35000HP (HD0620) and H. influenzae Rd (HI0854). H. influenzae Rd had a gene encoding a hemoglobin binding protein with sequence similarity to H....”
- HutZ is required for efficient heme utilization in Vibrio cholerae
Wyckoff, Journal of bacteriology 2004 - “...PM0299 P. multocida PM0042 Campylobacter jejuni Cj1613c Haemophilus influenzae Rd HI0854 Helicobacter pylori 26695 HP0318 86 80 59 56 45 24 24 21 93 91 76 74 65...”
- Pasteurella multocida gene expression in response to iron limitation
Paustian, Infection and immunity 2001 - “...protein L25 L-Lactate dehydrogenase Hypothetical HI0854 protein Putative TonB-dependent receptor Iron(III) dicitrate transport ATP-binding protein Hypothetical...”
- Characterization of the Plesiomonas shigelloides genes encoding the heme iron utilization system
Henderson, Journal of bacteriology 2001 - “...utilization locus, and to Haemophilus influenzae hypothetical protein HI0854 (Table 2), neither of which has a known function. A potential stem-loop structure...”
- “...(5.11) V. cholerae HutZ (19)f H. influenzae hypothetical protein HI0854 (14) 60 21 76 39 TonB (30,200) (10.18) V. cholerae TonB1 (38) V. parahaemolyticus TonB...”
Bdiaspc4_43115 pyridoxamine 5'-phosphate oxidase family protein from Bradyrhizobium diazoefficiens
bll8143 bll8143 (NCBI ptt file) from Bradyrhizobium japonicum USDA 110
Aligns to 165:235 / 249 (28.5%), covers 96.1% of PF10615, 43.5 bits
RPA0359 conserved unknown protein (NCBI) from Rhodopseudomonas palustris CGA009
Aligns to 166:236 / 244 (29.1%), covers 98.7% of PF10615, 40.5 bits
- Apo-bacteriophytochromes modulate bacterial photosynthesis in response to low light
Fixen, Proceedings of the National Academy of Sciences of the United States of America 2014 - “...homolog; rpa2125, a Staphylococcus aureus isdG homolog; and rpa0359, a Helicobacter pylori hugZ homolog. As shown in Fig. 2B, RpBphP2, isolated from the heme...”
- “...HO has deletions in all four putative heme oxygenases: rpa0359, hmuO, rpa2125, and rpa3279. purified from E. coli expressing a heme oxygenase, and cell extracts...”
STR1_STRTC / A0A384XG60 Strobilurin A biosynthesis cluster protein r1 from Strobilurus tenacellus (see 3 papers)
Aligns to 14:89 / 207 (36.7%), covers 85.7% of PF10615, 39.4 bits
- function: Part of the gene cluster that mediates the biosynthesis of strobilurin A, an antifungal polyketide that contains a key beta- methoxyacrylate toxophore that targets the complex III of the mitochondrial electron transport chain (PubMed:30258052). Strobilurin biosynthesis begins with construction of benzoyl CoA by step-wise elimination of ammonia from phenylalanine by the phenylalanine ammonia- lyase str11, oxygenation by str8 and retro-Claisen reaction to form benzoic acid, which is activated to its CoA thiolester benzoyl CoA by the dedicated CoA ligase str10 (PubMed:30258052). Benzoyl CoA forms the starter unit for the highly reducing polyketide synthase stpks1 that produces the polyketide prestrobilutin A (PubMed:30258052). The FAD- dependent oxygenase str9 then catalyzes the key oxidative rearrangement responsible for the creation of the beta-methoxyacrylate toxophore (PubMed:30258052). Str9 performs epoxidation of the 2,3 olefin of prestrobilutin A, followed by Meinwald rearrangement to furnish the aldehyde intermediate (Probable). Rapid enolization of the aldehyde intermediate would give the beta-methoxyacrylate skeleton and methylations catalyzed by str2 and str3 complete the synthesis and lead to the peroduction of strobilurin A (Probable). The short-chain dehydrogenase stl2 and the dehydrogenase str4 play a role in the shunt pathway leading to the production of bolineol (PubMed:30258052). The cluster encodes no obvious halogenase gene that could be involved in production of strobilurin B, nor any obvious dimethylallyl-transferase that could be involved in the production of strobilurin G (Probable). It is possible that unknown proteins encoded in, or near, the cluster (such as str1 or stl1) may form new classes of halogenases or dimethylally-transferases, or that the responsible genes are located elsewhere on the genome (Probable). Similarly, proteins encoded by str5/str6 hydrolases appear to have no chemical role in the biosynthesis of strobilurin A (Probable). Finally, no obvious self- resistance gene is found within the cluster (Probable).
HMU04180 Heme oxygenase (RefSeq) from Helicobacter mustelae 12198
Aligns to 4:74 / 272 (26.1%), covers 81.8% of PF10615, 37.5 bits
Q6UA21 Fiber protein Fb4 (Fragment) from Gossypium barbadense
Aligns to 77:154 / 185 (42.2%), covers 92.2% of PF10615, 36.6 bits
- SuperSAGE: the drought stress-responsive transcriptome of chickpea roots.
Molina, BMC genomics 2008 - “...expressed) Q75I59 Fiber protein Fb22 (Fragment) Q7Y244 Fiber protein Fb27 Q6UA10 Fiber protein Fb4 (Fragment) Q6UA21 Glyceraldehyde 3-phosphate dehydrogenase, cytosolic O81924 Histone H2A H2A2 Kinesin (centromere protein)-like heavy chain-like protein Q9LHL9 Lipoxygenase Q93YA9 Metallothionein-like protein 1; MT-1 MT1 PGM; Glucose phosphomutase PGMC Polygalacturonase inhibiting protein Q6V406...”
SCO0799 hypothetical protein (NCBI) from Streptomyces coelicolor A3(2)
Aligns to 142:219 / 241 (32.4%), covers 96.1% of PF10615, 35.2 bits
MSMEG_6419 hypothetical protein (NCBI) from Mycobacterium smegmatis str. MC2 155
Aligns to 172:244 / 261 (28.0%), covers 85.7% of PF10615, 31.9 bits
Cj1613c hypothetical protein Cj1613c (NCBI ptt file) from Campylobacter jejuni subsp. jejuni NCTC 11168
CJSA_1525 HugZ family heme oxygenase from Campylobacter jejuni subsp. jejuni IA3902
Aligns to 4:73 / 251 (27.9%), covers 80.5% of PF10615, 31.6 bits
- Hydrogen Sulfide and Carbon Monoxide Tolerance in Bacteria.
Mendes, Antioxidants (Basel, Switzerland) 2021 - “...other heme oxygenases, regulated by intracellular iron concentration, have been found in pathogens, such as Cj1613c in C. jejuni , HugZ in H. pylori , and HemO in Neisseria meningitides [ 113 , 119 , 120 , 121 , 122 , 123 , 124 ]. Of...”
- Influence of Environmental and Genetic Factors on Proteomic Profiling of Outer Membrane Vesicles from Campylobacter jejuni
Godlewska, Polish journal of microbiology 2019 - “...3.14 Flagellar hook protein ( flgE , Cj1729c) 34 0.019 +4.67 Putative pyridoxamine 5-phosphate oxidase (Cj1613c) 7 0.08 +6.16 Strain 81176 wt vs. strain 81176 dsbI 60 kDa chaperonin (groL , Cj1221) 95 0.00040 4.45 Fagellar hook-associated protein ( flgL , Cj0887c) 20 0.003 +8.81 Enolase...”
- “...for each spot. Another highly upregulated protein (over 6-fold) was a putative pyridoxamine 5-phosphate oxidase (Cj1613c), predicted to catalyze the terminal step in de novo vitamin B 6 synthesis: oxidation of pyridoxamine-5-P (PMP) and pyridoxine-5-P (PNP) to pyridoxal-5-P ( https://www.ebi.ac.uk/interpro/entry/IPR024029 , InterPro, Protein sequence analysis &...”
- A proteome-wide screen of Campylobacter jejuni using protein microarrays identifies novel and conformational antigens
Liu, PloS one 2019 - “...5.5 3.9 1 0 0 0 0 Cj0152c 5.5 4.2 1 0 0 0 0 Cj1613c 5.5 48.4 1 0 0 0 0 petC 5.4 6.2 1 0 0 0 0 Cj1275c 5.3 3.2 1 0 0 0 0 adk 5.3 20.6 1 0 0 0...”
- Avian Intestinal Mucus Modulates Campylobacter jejuni Gene Expression in a Host-Specific Manner
Looft, Frontiers in microbiology 2018 - “...uptake Cj1397 20 Ferrous iron transport protein A, putative Cj1587c 7 ABC-type siderophore export system Cj1613c 17 Putative heme oxygenase Cj1658 14 High-affinity Fe2+/Pb2+ permease precursor Cj1660 14 Fe2+ ABC transporter, substrate binding protein Cj1661 15 Fe2+ ABC transporter, permease protein 1 Cj1662 14 Fe2+ ABC...”
- “...were adjacent to differentially expressed genes in the sense orientation, within the same samples ( Cj1613c next to prfA and Cj0819 next to fliP ). Global analysis of all of the sense and antisense data showed that many asRNAs that were upregulated in the avian transcriptomes,...”
- Campylobacter jejuni transcriptome changes during loss of culturability in water
Bronowski, PloS one 2017 - “...iron, storage and uptake are tightly regulated. The putative hemin uptake gene cluster chuABCD and Cj1613c ( CJM1_1550 ) are regulated by the ferric uptake repressor (Fur), which in turn is governed by the availability of free iron [ 72 ]. In this study, the chuABCD...”
- “...over all three conditions, whereas chuB , chuD and the heme oxygenase gene CJM1_1550 ( Cj1613c ) were only upregulated at Time 0. These findings strongly support the importance of iron regulation during water survival. The fur gene was statistically significantly downregulated at 25C (24 h)...”
- Transcriptomic analysis of Campylobacter jejuni NCTC 11168 in response to epinephrine and norepinephrine
Xu, Frontiers in microbiology 2015 - “...Cj1662 1.5 1.6 Integral membrane protein Cj1663 Cj1663 1.3 1.6 ABC transporter ATP-binding protein HEMIN Cj1613c chuZ 1.2 1.1 Putative pyridoxamine 5-phosphate oxidase Cj1614 chuA 2.3 1.8 Hemin uptake system outer membrane receptor Cj1615 chuB 16.4 8.8 Hemin uptake system permease Cj1616 chuC 6.1 4.1 Hemin...”
- Evolution and comparative genomics of Campylobacter jejuni ST-677 clonal complex
Kivistö, Genome biology and evolution 2014 - “...to be a functional ferric enterobactin receptor in 81-176 ( Xu et al. 2010 ). Cj1613c and ChuA have been shown to be required for hemin and hemoglobin utilization by C. jejuni ( Ridley et al. 2006 ). Interestingly chuA ( cjj5070_13760 , annotated as hemin...”
- Defining the metabolic requirements for the growth and colonization capacity of Campylobacter jejuni
Hofreuter, Frontiers in cellular and infection microbiology 2014 - “...in the rabbit ileal loop model (Stintzi et al., 2005 ). The chu ABCDZ ( cj1613c - cj1617 ) gene cluster is widespread in C. jejuni and encodes for an iron uptake system that facilitates the utilization of the host compounds like hemoglobin and hemin as...”
- More
- Multi-omics approaches to deciphering a hypervirulent strain of Campylobacter jejuni
Wu, Genome biology and evolution 2013 - “...CJSA_1052 (MCP-type signal transduction protein), Tsf, GroEL, CJSA_1351 (putative methyltransferase), Cj1429c (hypothetical protein), ChuA, ChuZ (CJSA_1525), and P19 were shown to be truly down-expressed ( supplementary table S7 , Supplementary Material online) in IA3902. Overall, most of the differentially expressed proteins as revealed by the proteomic...”
- “...( Zeng et al. 2009 ); ChuA (CJSA_1526) is the heme-containing compound receptor and ChuZ (CJSA_1525) encodes an iron-responsive cellular hemoxygenase ( Ridley et al. 2006 ); and P19 (CJSA_1570) is a periplasmic binding protein which mediates iron acquisition from the fungal hydroxamate siderophore ferri-rhodotorulic acid...”
CJJ81176_1600 hypothetical protein (NCBI) from Campylobacter jejuni subsp. jejuni 81-176
Aligns to 4:71 / 251 (27.1%), covers 80.5% of PF10615, 31.5 bits
CJM1_1550 HugZ family heme oxygenase from Campylobacter jejuni subsp. jejuni M1
Aligns to 4:71 / 251 (27.1%), covers 80.5% of PF10615, 31.5 bits
- Campylobacter jejuni transcriptome changes during loss of culturability in water
Bronowski, PloS one 2017 - “...and uptake are tightly regulated. The putative hemin uptake gene cluster chuABCD and Cj1613c ( CJM1_1550 ) are regulated by the ferric uptake repressor (Fur), which in turn is governed by the availability of free iron [ 72 ]. In this study, the chuABCD genes were...”
- “...significantly upregulated over all three conditions, whereas chuB , chuD and the heme oxygenase gene CJM1_1550 ( Cj1613c ) were only upregulated at Time 0. These findings strongly support the importance of iron regulation during water survival. The fur gene was statistically significantly downregulated at 25C...”
GLUBP_ARATH / Q9LU39 Glutamyl-tRNA reductase-binding protein, chloroplastic; AtGluTRBP; GluTR-binding protein; Protein PROTON GRADIENT REGULATION 7 from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
NP_566678 proton gradient regulation 7 from Arabidopsis thaliana
AT3G21200 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 204:280 / 317 (24.3%), covers 92.2% of PF10615, 27.2 bits
- function: Involved in the regulation of glutamyl-tRNA reductase (GluTR) which is important for the synthesis and distribution of 5- aminolevulinate, a precursor in heme and chlorophyll biosynthesis (PubMed:22180625). Stimulates GluTR activity and regulates glutamate-1- semialdehyde release. May play a role in heme metabolism (PubMed:24753615). Necessary for efficient photosynthetic electron transport in chloroplasts (PubMed:20657737)
subunit: Interacts with HEMA1 (PubMed:22180625, PubMed:24753615) and forms a heterotetramer of two GLUTRBP and two HEMA1 subunits (PubMed:24753615).
disruption phenotype: Reduced growth, slightly pale green leaves, reduced levels of chlorophyll and heme, and low non-photochemical quenching (NPQ). - The GluTR-binding protein is the heme-binding factor for feedback control of glutamyl-tRNA reductase.
Richter, eLife 2019 - GeneRIF: binding of heme to the GluTR-binding protein (GBP) inhibits interaction of GBP with the N-terminal regulatory domain of GluTR1, thus making it accessible to the Clp protease.
- Production of 5-aminolevulinic acid from glutamate by overexpressing HemA1 and pgr7 from Arabidopsis thaliana in Escherichia coli.
Aiguo, World journal of microbiology & biotechnology 2019 (PubMed)- GeneRIF: HemA1 and pgr7 genes from the higher plant Arabidopsis thaliana into recombinant Escherichia coli to overproduce extracellular 5-aminolevulinic acid via the C5 pathway.
- The Arabidopsis glutamyl-tRNA reductase (GluTR) forms a ternary complex with FLU and GluTR-binding protein.
Fang, Scientific reports 2016 - GeneRIF: A ternary complex composed of the C-terminal tetratricopepetide-repeat domain of FLU, GBP, and GluTR and a biological role of the ternary complex for the regulation of plant GluTR is reported. [GBP]
- Posttranslational Control of ALA Synthesis Includes GluTR Degradation by Clp Protease and Stabilization by GluTR-Binding Protein.
Apitz, Plant physiology 2016 - GeneRIF: ClpS1 and the ClpC1 chaperone as well as the GluTR-binding protein (GBP) interact with the N terminus of GluTR Loss-of function mutants of ClpR2 and ClpC1 proteins show increased GluTR stability, whereas absence of GBP results in decreased GluTR stability. Thus, the Clp protease system and GBP contribute to GluTR accumulation levels, and thereby the rate-limiting ALA synthesis.[GBP]
- An Arabidopsis GluTR binding protein mediates spatial separation of 5-aminolevulinic acid synthesis in chloroplasts.
Czarnecki, The Plant cell 2011 - GeneRIF: GluTRBP is bound to the thylakoid membrane. Reduction of GluTRBP contents causes heme deficiency.
- Arabidopsis thaliana PGR7 encodes a conserved chloroplast protein that is necessary for efficient photosynthetic electron transport.
Jung, PloS one 2010 - GeneRIF: Study identified PGR7 as a novel, conserved nuclear gene that is necessary for efficient photosynthetic electron transport in chloroplasts of Arabidopsis.
- The plastidial Arabidopsis thaliana NFU1 protein binds and delivers [4Fe-4S] clusters to specific client proteins
Roland, The Journal of biological chemistry 2020 - “...AT3G62910 ATCG00180 ATCG00190 ATCG00740 AT5G13030 AT1G32900 AT5G24300 AT5G43780 AT3G21200 AT1G22940 AT3G06730 AT4G29670 AT5G65840 AT2G42220 2 3 3 3 6 9 2 6 5 2...”
- The GluTR-binding protein is the heme-binding factor for feedback control of glutamyl-tRNA reductase.
Richter, eLife 2019 - “...photosynthetic organisms. Protein BLAST analyses ( https://blast.ncbi.nlm.nih.gov/Blast.cgi ) were performed using either the full-length AtGBP (AT3G21200, left) or the RED of AtGluTR1 (right). The top 100 hits were used to build the trees. Note that both GBP and the RED-containing GluTR isoform were only found in...”
- Transcriptional Regulation of Tetrapyrrole Biosynthesis in Arabidopsis thaliana
Kobayashi, Frontiers in plant science 2016 - “...c4 (blue) clusters, (B) FLUORESCENT IN BLUE LIGHT (FLU, At3g14110), and (C) GluTR-binding protein (GBP, At3g21200) formed with photosynthesis-associated nuclear genes (PhANGs, orange), plastid ribosome-related genes (purple) and other nuclear genes (white). The coexpression networks were drawn by using the NetworkDrawer of the ATTED-II database v8.0...”
- The Arabidopsis glutamyl-tRNA reductase (GluTR) forms a ternary complex with FLU and GluTR-binding protein
Fang, Scientific reports 2016 - “...constructed as previously described 10 11 . Briefly, the genes of GluTR (At1g58290) and GBP (At3g21200) without their chloroplast localization sequences (residues 73543 and 42317), and the FLU (At3g14110) truncation (residues 195316), were constructed into expression vectors pMAL-c5X (New England Biolabs), pET-28a(+) and pET-22b(+) (Novagen), respectively....”
- Growth and development of Arabidopsis thaliana under single-wavelength red and blue laser light
Ooi, Scientific reports 2016 - “...less stress than white fluorescent light. In addition, the proton gradient regulation 7 protein (PGR7, AT3G21200) is also down-regulated. Arabidopsis thaliana PGR7 has been shown to be involved in both PSII and P700 of photosystem I and is necessary for efficient photosynthetic electron transport 52 ....”
- An integrated approach (CLuster Analysis Integration Method) to combine expression data and protein-protein interaction networks in agrigenomics: application on Arabidopsis thaliana
Santoni, Omics : a journal of integrative biology 2014 - “...was obtained for the couple AT3G21200-ath00195-photosynthesis. Protein AT3G21200 (PGR7) is coded by a nuclear gene conserved in plants, algae, and bacteria,...”
- Crystal structure of Arabidopsis glutamyl-tRNA reductase in complex with its stimulator protein
Zhao, Proceedings of the National Academy of Sciences of the United States of America 2014 - “...genes of Arabidopsis GluTR (At1g58290) and GluBP (At3g21200) lacking the plastid-targeting sequences were cloned into pMAL-c5X (New England Biolabs) and...”
- Arabidopsis thaliana PGR7 encodes a conserved chloroplast protein that is necessary for efficient photosynthetic electron transport
Jung, PloS one 2010 - “...the wild type in optimal growth conditions. Positional cloning located the pgr7 mutation in the At3g21200 ( PGR7 ) gene, which was predicted to encode a chloroplast protein of unknown function. Chloroplast targeting of PGR7 was confirmed by transient expression of a GFP fusion protein and...”
- “...genes encoding predicted chloroplast proteins are displayed with triangles. B) Partial DNA sequence of the At3g21200 gene in pgr7 and L er . The lower and upper cases indicate an intron and an exon region, respectively. The position of the transversion (C G) in pgr7 and...”
- More
DR_B0124 SIP domain-containing protein from Deinococcus radiodurans R1
Aligns to 13:88 / 303 (25.1%), covers 72.7% of PF10615, 27.1 bits
DRB0124 iron-chelator utilization protein, putative (NCBI ptt file) from Deinococcus radiodurans R1
Aligns to 17:92 / 307 (24.8%), covers 72.7% of PF10615, 27.0 bits
- Extracellular dGMP enhances Deinococcus radiodurans tolerance to oxidative stress
Li, PloS one 2013 - “...0.0047 DRB0092 starvation-inducible DNA-binding protein 2.49 8.73E-05 DRB0121 iron ABC transporter, ATP-binding protein 1.62 1.70E-05 DRB0124 iron-chelator utilization protein, putative 9.71 2.43E-06 DRB0067 extracellular nuclease 2.00 0.0005 DR2244 sensory transduction histidine kinase 2.01 0.0032 The high intracellular Mn/Fe ratio in D. radiodurans could contribute to its...”
A1S_2564 putative siderophore-interacting protein (RefSeq) from Acinetobacter baumannii ATCC 17978
Aligns to 1:65 / 145 (44.8%), covers 72.7% of PF10615, 25.1 bits
3swjA Crystal structure of campylobacter jejuni chuz (see paper)
Aligns to 3:68 / 246 (26.8%), covers 77.9% of PF10615, 24.6 bits
- Ligands: protoporphyrin ix containing fe; azide ion (3swjA)
Or search for genetic data about PF10615 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory