Family Search for PF10914 (DUF2781)
PF10914.8 hits 14 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
NP_598467 sigma intracellular receptor 2 from Mus musculus
Aligns to 11:164 / 176 (87.5%), covers 98.6% of PF10914, 168.0 bits
- Sigma 2 Receptor/Tmem97 Agonists Produce Long Lasting Antineuropathic Pain Effects in Mice.
Sahn, ACS chemical neuroscience 2017 - GeneRIF: Study generated a series of sigma1R and sigma2R/Tmem97 agonists and antagonists and tested them for efficacy in the mouse spared nerve injury model. Results show robust antineuropathic pain effects of sigma1R and sigma2R/Tmem97 ligands, demonstrate that sigma2R/Tmem97 is a novel neuropathic pain target, and identify sigma2R/Tmem97 agonist UKH-1114 as a lead molecule for further development.
Q5U3Y7 Sigma intracellular receptor 2 from Rattus norvegicus
Aligns to 11:164 / 176 (87.5%), covers 98.6% of PF10914, 167.2 bits
SGMR2_BOVIN / Q3MHW7 Sigma intracellular receptor 2; Sigma-2 receptor; Sigma2 receptor; Transmembrane protein 97 from Bos taurus (Bovine) (see paper)
Aligns to 11:164 / 176 (87.5%), covers 98.6% of PF10914, 166.9 bits
- function: Intracellular orphan receptor that binds numerous drugs and which is highly expressed in various proliferating cells. Corresponds to the sigma-2 receptor, which is thought to play important role in regulating cell survival, morphology and differentiation. May play a role as a regulator of cellular cholesterol homeostasis. May function as sterol isomerase. May alter the activity of some cytochrome P450 proteins.
subunit: Interacts with NPC1.
SGMR2_HUMAN / Q5BJF2 Sigma intracellular receptor 2; Sigma-2 receptor; Sigma2 receptor; Meningioma-associated protein 30; Transmembrane protein 97 from Homo sapiens (Human) (see 6 papers)
Aligns to 11:164 / 176 (87.5%), covers 98.6% of PF10914, 164.3 bits
- function: Intracellular orphan receptor that binds numerous drugs and which is highly expressed in various proliferating cancer cells (PubMed:28559337). Corresponds to the sigma-2 receptor, which is thought to play important role in regulating cell survival, morphology and differentiation (PubMed:23922215, PubMed:25620095). Under investigation for its potential diagnostic and therapeutic uses (PubMed:23922215, PubMed:25620095). May play a role as a regulator of cellular cholesterol homeostasis (PubMed:19583955). May function as sterol isomerase (PubMed:25566323). May alter the activity of some cytochrome P450 proteins (PubMed:22292588).
subunit: Interacts with NPC1. - THE CONCISE GUIDE TO PHARMACOLOGY 2017/18: Overview
Alexander, British journal of pharmacology 2017 - “...shows activity at opioid receptors. The sigma2 receptor has recently been reported to be TMEM97 Q5BJF2 [ 92 ] , a 4TM protein partner of NPC1, the NiemannPick C1 protein, a 13TM cholesterolbinding protein. Further reading on Sigma receptors Chu UB et al. (2016) Biochemical Pharmacology...”
- Discovery of colorectal cancer biomarker candidates by membrane proteomic analysis and subsequent verification using selected reaction monitoring (SRM) and tissue microarray (TMA) analysis
Kume, Molecular & cellular proteomics : MCP 2014 - “...protein 2 Q9ULK5 Vang-like protein 2 Q5BJF2 Transmembrane protein 97 Q07075 Glutamyl aminopeptidase Q9UGT4 Sushi domain-containing protein 2...”
- Tafazzin protein expression is associated with tumorigenesis and radiation response in rectal cancer: a study of Swedish clinical trial on preoperative radiotherapy.
Pathak, PloS one 2014 - “...(Isoform 1 & 2), FXYD-3 (Isoform 1) and MAC30 [UniProt IDs: Q16635, Q96CA5, Q14802 and Q5BJF2 respectively] and their general and sequence annotations were collected from UNIPROT. Template selection and model building All amino acid sequences were subjected to NCBI PSI-BLAST (Position Specific Iteration-Basic Local Alignment...”
YL050_YEAST / Q12155 Uncharacterized membrane protein YLR050C from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 2 papers)
YLR050C Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the endoplasmic reticulum; YLR050C is not an essential gene (RefSeq) from Saccharomyces cerevisiae
Aligns to 8:161 / 161 (95.7%), covers 95.2% of PF10914, 139.8 bits
- A Proximity Ligation-Based Method for Quantitative Measurement of D-Loop Extension in S. cerevisiae
Piazza, Methods in enzymology 2018 - “...). The intramolecular ligation efficiency of a 765-bp linear dsDNA fragment from Chr. XII (overlapping YLR050C and YLR051C ) with primers olWDH2052 and olWDH2053. In a typical experiment, ~20% of the molecules have been circularized ( Fig. S1A in the online version at https://doi.org/10.1016/bs.mie.2017.11.024 ). The...”
- “...the intramolecular ligation (i.e., circularization) efficiency of a control 765- bp Hin dIII fragment ( YLR050C; Chr. XII) olWDH2053 TCAAGCGTGGTTACATTCCTTAC olWDH1766 GTTTCAGCTTTCCGCAACAG Measure DSB formation at the HOcs. DSB induction causes a loss of signal olWDH1767 GGCGAGGTATTGGATAGTTCC olWDH2010 TGCTCGGAGATTACCGAATC Quantify the Hin dIII cutting efficiency on...”
- Widespread Cumulative Influence of Small Effect Size Mutations on Yeast Quantitative Traits
Hua, Cell systems 2018 - “...YLL055W, YDR424C, YBR287W, YEL040W, YNL125C, YHL003C, YBR283C, YDL121C, YHR045W, YNR075W, YOR377W, YHR039C, YGL010W, YCL025C, YNR044W, YLR050C, YOL137W, YOL107W, YDL018C, YDR307W, YDR297W, YNL190W, YDR503C, YBR177C, YGR266W, YER019C-A, YLR034C, YOR322C, YGR260W, YDR349C, YJR015W, YPL246C, YMR058W, YBR290W, YLL023C, YDR205W, YHR123W, YJL024C, YJL212C, YLR292C, YPL207W, YKR027W, YIL076W, YBR288C, YJL183W, YKL008C,...”
- Enhanced dependency of KRAS-mutant colorectal cancer cells on RAD51-dependent homologous recombination repair identified from genetic interactions in Saccharomyces cerevisiae
Kalimutho, Molecular oncology 2017 - “...AANAT Aralkylamine N acetyltransferase 0.159 RAS2 OST2 DAD1 Defender against cell death 1 0.162 RAS2 YLR050C TMEM97 Transmembrane protein 97 0.166 RAS2 RIA1 EFTUD1 Elongation factor Tu GTPbinding domain containing 1 0.192 RAS2 EMG1 EMG1 EMG1N1specific pseudouridine methyltransferase 0.205 RAS2 MRE11 MRE11A MRE11 homolog A, doublestrand...”
- High-resolution transcription atlas of the mitotic cell cycle in budding yeast
Granovskaia, Genome biology 2010 - “...expression (Additional file 8 ). Expression profiles of the other four SAPs ( PRY3 , YLR050C , YMR253C and YPL230W ) had phase shifts between 0 and . Remarkably, several genes encoding important cell cycle regulators fall within the categories listed above (Figure 3a-c ). Among...”
- “...transcripts of (a) FAR1 , (b) TAF2 , (c) CTF4 , (d) SPS100 and (e) YLR050C . Each horizontal line represents a single experimental time-point. The unit of the time axis (vertical) is minutes. The horizontal axis in the center of each panel represents genomic coordinates,...”
- Bidirectional promoters generate pervasive transcription in yeast
Xu, Nature 2009 - “...from the 3 NFR of an ORF were transcribed antisense to the ORF (for example YLR050C and MBR1 , Figs. 1c, 1e ). Another recurrent configuration is an antisense transcript starting from the 5 NFR of a downstream tandem transcript. These configurations associate three transcripts; an...”
- “...antisense SUT253 originating from both a 5 NFR (of YLR049C) and a 3 NFR (of YLR050C); d , antisense SUT238 originating from a 5 NFR (of YPT52); e , SUT665 originating from a 3 NFR (of BUD2); f , divergent promoter of two ORF-Ts with a...”
- Recognition of protein coding genes in the yeast genome at better than 95% accuracy based on the Z curve
Zhang, Nucleic acids research 2000 - “...YHR217c YLR047c YNL174w YPR096c YCR022c YER066c-a YHR218w-a YLR050c YNL176c YPR100w YCR025c YER072w YIL012w YLR064w YNL179c YPR114w YCR043c YER091c-a YIL025c...”
SPAC56F8.07 dubious (RefSeq) from Schizosaccharomyces pombe
Aligns to 25:162 / 183 (75.4%), covers 98.6% of PF10914, 130.2 bits
- S. pombe genome deletion project: an update
Spirek, Cell cycle (Georgetown, Tex.) 2010 - “...SPAC15E1.03 * viable SPAC23C4.04c * viable SPCC1682.05c * essential SPAC27E2.12 * viable SPBC119.10 * viable SPAC56F8.07 * essential SPAC4D7.08c * viable SPAPB1A10.16 * viable SPAC1786.02 viable SPCC1393.14 * viable SPAC1F3.04c * viable SPAC30D11.09 viable SPAC23D3.14c * viable SPAC3A11.05c viable SPAC2F7.16c * viable SPBC543.04 essential SPAC9.09 *...”
XP_005258022 sigma intracellular receptor 2 isoform X1 from Homo sapiens
Aligns to 61:203 / 215 (66.5%), covers 78.9% of PF10914, 127.7 bits
- A multiplatform approach identifies miR-152-3p as a common epigenetically regulated onco-suppressor in prostate cancer targeting TMEM97.
Ramalho-Carvalho, Clinical epigenetics 2018 - GeneRIF: TMEM97 was found to be overexpressed in prostate cancer, and identified as a novel miR-152 target gene.
- Sigma-2 Receptor/TMEM97 and PGRMC-1 Increase the Rate of Internalization of LDL by LDL Receptor through the Formation of a Ternary Complex.
Riad, Scientific reports 2018 - GeneRIF: These data indicate that the formation of a ternary complex of LDLR-PGRMC1-TMEM97 is necessary for the rapid internalization of LDL by LDLR.
- The Prognostic Effect of MAC30 Expression on Patients With Non-Small Cell Lung Cancer Receiving Adjuvant Chemotherapy.
Ding, Technology in cancer research & treatment 2017 - GeneRIF: MAC30 could be a useful biomarker of tumor differentiation and outcome of patients with non-small cell lung cancer. Overexpression of MAC30 predicts a worse tumor differentiated stage and prognosis in patients with non-small cell lung cancer receiving adjuvant chemotherapy.
- Identification of the gene that codes for the σ2 receptor.
Alon, Proceedings of the National Academy of Sciences of the United States of America 2017 - GeneRIF: TMEM97 possesses the full suite of molecular properties that define the sigma2 receptor, and Asp29 and Asp56 are essential for ligand recognition
- Sigma 2 Receptor/Tmem97 Agonists Produce Long Lasting Antineuropathic Pain Effects in Mice.
Sahn, ACS chemical neuroscience 2017 - GeneRIF: Study generated a series of sigma1R and sigma2R/Tmem97 agonists and antagonists and tested them for efficacy in the mouse spared nerve injury model. Results show robust antineuropathic pain effects of sigma1R and sigma2R/Tmem97 ligands, demonstrate that sigma2R/Tmem97 is a novel neuropathic pain target, and identify sigma2R/Tmem97 agonist UKH-1114 as a lead molecule for further development.
- The prognostic role of MAC30 in advanced gastric cancer patients receiving platinum-based chemotherapy.
Wu, Future oncology (London, England) 2017 (PubMed)- GeneRIF: we not only confirmed the elevated MAC30 mRNA, but also demonstrated that GC with overexpression of MAC30 resisted to adjuvant platinum-based chemotherapy.
- Prognostic Value of MAC30 Expression in Human Pure Squamous Cell Carcinomas of the Lung.
Ding, Asian Pacific journal of cancer prevention : APJCP 2016 (PubMed)- GeneRIF: Overexpression of MAC30 is associated with Squamous Cell Carcinomas of the Lung.
- Reduction of TMEM97 increases NPC1 protein levels and restores cholesterol trafficking in Niemann-pick type C1 disease cells.
Ebrahimi-Fakhari, Human molecular genetics 2016 - GeneRIF: knockdown of TMEM97 also increases levels of residual NPC1 in NPC1-mutant patient fibroblasts and reduces cholesterol storage in an NPC1-dependent manner. Our findings propose TMEM97 inhibition as a novel strategy to increase residual NPC1 levels in cells and a potential therapeutic target for Niemann-Pick type C disease (NP-C).
- More
AT2G32380 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 9:146 / 168 (82.1%), covers 98.6% of PF10914, 116.6 bits
LOC104610879 transmembrane protein 97 from Nelumbo nucifera
Aligns to 30:166 / 189 (72.5%), covers 98.0% of PF10914, 115.5 bits
- Gene Expression Profile in the Long-Living Lotus: Insights into the Heat Stress Response Mechanism
Liu, PloS one 2016 - “...Gene_id log2FoldChange padj Description Subcellular prediction LOC104587372 2.05 1.45E-02 glycine-rich cell wall structural protein - LOC104610879 2.82 5.88E-04 transmembrane protein Vacuole LOC104603094 1.74 8.42E-05 transmembrane protein Nucleus LOC104605640 2.49 3.68E-02 secretory carrier-associated membrane protein Plasma membrane LOC104608147 2.58 1.98E-02 extensin-2 Nucleus LOC104608452 3.73 1.99E-04 extensin-2 Secreted...”
TM6S1_MOUSE / P58749 Transmembrane 6 superfamily member 1 from Mus musculus (Mouse) (see paper)
Aligns to 217:356 / 370 (37.8%), covers 73.5% of PF10914, 77.3 bits
- function: May function as sterol isomerase.
NP_075379 transmembrane 6 superfamily member 1 isoform 1 from Homo sapiens
Aligns to 216:356 / 370 (38.1%), covers 76.2% of PF10914, 76.2 bits
TM6S2_MOUSE / Q8R1J1 Transmembrane 6 superfamily member 2 from Mus musculus (Mouse) (see 2 papers)
Aligns to 218:357 / 378 (37.0%), covers 100.0% of PF10914, 67.2 bits
- function: Regulator of liver fat metabolism influencing triglyceride secretion and hepatic lipid droplet content. May function as sterol isomerase.
NP_001280724 transmembrane 6 superfamily member 2 isoform 1 from Mus musculus
Aligns to 218:357 / 378 (37.0%), covers 100.0% of PF10914, 67.2 bits
TM6S2_HUMAN / Q9BZW4 Transmembrane 6 superfamily member 2 from Homo sapiens (Human) (see 3 papers)
NP_001001524 transmembrane 6 superfamily member 2 from Homo sapiens
Aligns to 218:357 / 377 (37.1%), covers 98.6% of PF10914, 64.7 bits
- function: Regulator of liver fat metabolism influencing triglyceride secretion and hepatic lipid droplet content (PubMed:24531328, PubMed:24927523). May function as sterol isomerase (PubMed:25566323).
- Donor PNPLA3 and TM6SF2 Variant Alleles Confer Additive Risks for Graft Steatosis After Liver Transplantation.
Míková, Transplantation 2020 (PubMed)- GeneRIF: Donor PNPLA3 and TM6SF2 Variant Alleles Confer Additive Risks for Graft Steatosis After Liver Transplantation.
- Independent and joint correlation of PNPLA3 I148M and TM6SF2 E167K variants with the risk of coronary heart disease in patients with non-alcoholic fatty liver disease.
Wu, Lipids in health and disease 2020 - GeneRIF: Independent and joint correlation of PNPLA3 I148M and TM6SF2 E167K variants with the risk of coronary heart disease in patients with non-alcoholic fatty liver disease.
- Disruption of the ERLIN-TM6SF2-APOB complex destabilizes APOB and contributes to non-alcoholic fatty liver disease.
Li, PLoS genetics 2020 - GeneRIF: Disruption of the ERLIN-TM6SF2-APOB complex destabilizes APOB and contributes to non-alcoholic fatty liver disease.
- Fish intake interacts with TM6SF2 gene variant to affect NAFLD risk: results of a case-control study.
Kalafati, European journal of nutrition 2019 (PubMed)- GeneRIF: TM6SF2 protein is believed to participate in the regulation of hepatic triglyceride (TG) secretion and thus impaired function of the protein has been linked to NAFLD.
- PNPLA3 and TM6SF2 variants as risk factors of hepatocellular carcinoma across various etiologies and severity of underlying liver diseases.
Yang, International journal of cancer 2019 (PubMed)- GeneRIF: The association of PNPLA3 and TM6SF2 with HCC risk was confirmed in the prospective cohort with ALD. A genetic score including PNPLA3 and TM6SF2 minor alleles showed a progressive significant increased risk of HCC in ALD patients. PNPLA3-rs738409 and TM6SF2-rs58542926 are inherited risk variants of HCC development in patients with ALD in a dose dependent manner.
- Independent and additive effects of PNPLA3 and TM6SF2 polymorphisms on the development of non-B, non-C hepatocellular carcinoma.
Raksayot, Journal of gastroenterology 2019 (PubMed)- GeneRIF: These data showed that PNPLA3 and TM6SF2 polymorphisms were independently linked to NBNC-HCC but not HBV- or HCV-HCC in Thai populations.
- Genetic and metabolic predictors of hepatic fat content in a cohort of Italian children with obesity.
Di, Pediatric research 2019 - GeneRIF: PNPLA3, GCKR, and TM6SF2 risk alleles may be associated with hepatic fat content in a cohort of Italian children with obesity
- Association of TM6SF2 rs58542926 gene polymorphism with the risk of non-alcoholic fatty liver disease and colorectal adenoma in Chinese Han population.
Li, BMC biochemistry 2019 - GeneRIF: significant association between TM6SF2 rs58542926 polymorphism and the risk of NAFLD and NAFLD&CRA in a Chinese Han population.
- More
Or search for genetic data about PF10914 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory