Family Search for PF11245 (DUF2544)

PF11245 hits 2 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

YfcO / b2332 DUF2544 domain-containing protein YfcO from Escherichia coli K-12 substr. MG1655 (see 5 papers)
YFCO_ECOLI / P76498 Uncharacterized protein YfcO from Escherichia coli (strain K12) (see paper)
NP_416835 DUF2544 domain-containing protein YfcO from Escherichia coli str. K-12 substr. MG1655
Aligns to 44:273 / 273 (84.2%), covers 100.0% of PF11245, 459.0 bits

• function: Part of the yfcOPQRSUV fimbrial operon. Could contribute to adhesion to various surfaces in specific environmental niches. Increases adhesion to eukaryotic T24 bladder epithelial cells in the absence of fim genes.
  disruption phenotype: Deletion of the operon under classical laboratory conditions does not result in any major effect on E.coli capacity to form biofilms compared with the wild-type strain.
• The YfcO fimbriae gene enhances adherence and colonization abilities of avian pathogenic Escherichia coli in vivo and in vitro.
  Li, Microbial pathogenesis 2016 (PubMed)
  • GeneRIF: These results suggest that yfcO contributes to avian pathogenic Escherichia coli virulence through bacterial adherence to host tissues.

ECs3216 hypothetical protein from Escherichia coli O157:H7 str. Sakai
Z3595 orf; hypothetical protein from Escherichia coli O157:H7 EDL933
Aligns to 56:280 / 280 (80.4%), covers 100.0% of PF11245, 256.1 bits

• The genome sequence of E. coli W (ATCC 9637): comparative genome analysis and an improved genome-scale reconstruction of E. coli
  Archer, BMC genomics 2011
  • “...the same chromosomal position in O157:H7. In O157:H7, this cluster is annotated as ECs3222 - ECs3216 ; we have designated it E. coli -type one, with the operon consequently designated epoA-H . Due to an insertion event on pRK1, W has five of the eight genes...”
• Ethanolamine and choline promote expression of putative and characterized fimbriae in enterohemorrhagic Escherichia coli O157:H7
  Gonyar, Infection and immunity 2014
  • “...RT Fd ilvC RT Rv Z3595 Fd Z3596 Rv Z3597 Fd CCAAGTATCGAAGTACTAGCATCAGAGT CCCTGGTCTCATTCTGGTCAA TCTGGGTGCTTGGTATGAAGTTAT TGTGGTGCCGCAGATGAA...”
  • “...and Z3597 are cotranscribed and that Z3596 and Z3595 are cotranscribed. PCR products were not visualized in the negative-control lanes (no RT), and genomic...”

Or search for genetic data about PF11245 in the Fitness Browser