Family Search for PF11523 (DUF3223)

PF11523.8 hits 12 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

DCL_SOLLC / Q42463 Protein DCL, chloroplastic; Defective chloroplasts and leaves protein from Solanum lycopersicum (Tomato) (Lycopersicon esculentum) (see 2 papers)
Aligns to 121:197 / 224 (34.4%), covers 98.7% of PF11523, 99.5 bits

• function: Has a function in the early stage of chloroplast development and palisade cell morphogenesis (PubMed:8861949). Required for correct plastid ribosome assembly. Required for processing and maturation of 4.5S rRNA (PubMed:15010617).
  disruption phenotype: Embryonic lethality due to embryo development arrest at globular stage.

DCL_ARATH / Q9C642 Protein DCL homolog, chloroplastic; AtDCL from Arabidopsis thaliana (Mouse-ear cress) (see paper)
NP_683398 DCL protein (DUF3223) from Arabidopsis thaliana
Aligns to 116:192 / 219 (35.2%), covers 98.7% of PF11523, 95.8 bits

• function: Required for normal plastid function and plant development. Required for correct plastid ribosome assembly. Required for processing and maturation of 4.5S rRNA.
• Altered expression of the Arabidopsis ortholog of DCL affects normal plant development.
  Bellaoui, Planta 2004 (PubMed)
  • GeneRIF: AtDCL is the Arabidopsis ortholog of tomato DCL, and indicate that plastid function is required for normal plant development.

LOC103330828 DNA-directed RNA polymerase V subunit 1 from Prunus mume
Aligns to 1726:1802 / 1855 (4.2%), covers 98.7% of PF11523, 94.7 bits

• Isolation and Characterization of AGAMOUS-Like Genes Associated With Double-Flower Morphogenesis in Kerria japonica (Rosaceae)
  Ma, Frontiers in plant science 2018
  • “...inserted segment) has nearly 95% similarity with P. mume DNA-directed RNA polymerase V subunit 1 (LOC103330828). Another 118 bp fragment (from 1509 to 1627 bp of the inserted segment) was found to share nearly 93% similarity with Malus domestica DNA-directed RNA polymerase V subunit 1-like (LOC103438702)....”

AT3G46630 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 106:182 / 207 (37.2%), covers 100.0% of PF11523, 92.5 bits

• LUX ARRHYTHMO encodes a nighttime repressor of circadian gene expression in the Arabidopsis core clock
  Helfer, Current biology : CB 2011
  • “...a 1870 bp fragment comprising the promoter region up to the previous annotated gene ( At3g46630 ), the 5UTR and the coding sequence of LUX into pENTR/D-TOPO (forward primer 5-caccCGACCACAATCAAGGAGTAAT-3, reverse primer 5-ATTCTCATTTGCGCTTCCACC-3). This construct was recombined using LR Clonase II into pMDC107 [ 45 ],...”

NRPE1_ARATH / Q5D869 DNA-directed RNA polymerase V subunit 1; DNA-directed RNA polymerase D subunit 1b; AtNRPD1b; Nuclear RNA polymerase D 1b; DNA-directed RNA polymerase E subunit 1; Nuclear RNA polymerase E 1; Protein DEFECTIVE IN MERISTEM SILENCING 5; Protein DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 3; Protein RNA-DIRECTED DNA METHYLATION DEFECTIVE 1; RNA polymerase IV subunit 1; POL IV 1; EC 2.7.7.6 from Arabidopsis thaliana (Mouse-ear cress) (see 16 papers)
NP_181532 nuclear RNA polymerase D1B from Arabidopsis thaliana
AT2G40030, NP_181532 NRPD1B; DNA binding / DNA-directed RNA polymerase (RefSeq) from Arabidopsis thaliana
Aligns to 1751:1827 / 1976 (3.9%), covers 98.7% of PF11523, 87.6 bits

• function: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Largest and catalytic component of RNA polymerase V involved in RNA- directed DNA methylation-dependent (RdDM) silencing of endogenous repeated sequences, including transposable elements. Also required for full erasure of methylation when the RNA trigger is withdrawn. Seems also involved in the synthesis of short-interfering RNAs (siRNA). Essential component of a self-reinforcing loop coupling de novo DNA methylation to siRNA production. Involved in the maintenance of post- transcriptional RNA silencing.
  catalytic activity: a ribonucleoside 5'-triphosphate + RNA(n) = diphosphate + RNA(n+1) (RHEA:21248)
  subunit: Component of the RNA polymerase V complex. Interacts with NRPD4, NRPD2A, and (via C-terminus) with AGO4. Interacts with SUVH2.
  disruption phenotype: Blocked in the perpetuation of CNN, CG and CNG methylation in repeated endogenous DNA accompanied by a reduction in 24-nt siRNAs. Reduction of heterochromatin association into chromocenters, coincident with losses in cytosine methylation at pericentromeric 5S gene clusters and AtSN1 retroelements. Impaired RNA- directed DNA methylation-dependent (RdDM) silencing. Defective in the maintenance of post-transcriptional RNA silencing.
• DDR complex facilitates global association of RNA polymerase V to promoters and evolutionarily young transposons.
  Zhong, Nature structural & molecular biology 2012
  • GeneRIF: Genome-wide chromatin association of NRPE1 is dependent on all members of a putative chromatin-remodeling complex termed DDR, which includes the proteins DRD1, DMS3 and RDM1.
• DRD1-Pol V-dependent self-silencing of an exogenous silencer restricts the non-cell autonomous silencing of an endogenous target gene.
  Dong, The Plant journal : for cell and molecular biology 2011
  • GeneRIF: DRD1-Pol V-dependent de novo methylation may play a role in restraining the inappropriate silencing of active protein-coding genes in plants. [NRPE1]
• NRPD1a and NRPD1b are required to maintain post-transcriptional RNA silencing and RNA-directed DNA methylation in Arabidopsis.
  Eamens, The Plant journal : for cell and molecular biology 2008 (PubMed)
  • GeneRIF: Mutants defective for the NRPD1a and NRPD1b alternative largest subunits of polymerase IV were tested for their ability to undergo RNA silencing and mantenance of transcription and post-transcriptional silencing.
• Versatile in vitro assay to recognize Cas9‐induced mutations
  Bente, Plant direct 2020
  • “...2015 ) to target the genes RDR2 (AT4G11130), RDR6 (AT3G49500), AGO4 (AT2G27040), NRPD1a (AT1G63020), NRPE1 (AT2G40030), ADH1 (AT1G77120), CHLI1 (AT4G18480), and PIE1 (AT3G12810) of Arabidopsis thaliana . 2.5 sgRNA preparation Templates for the in vitro transcription of sgRNAs were amplified from vectors containing the initially described...”
  • “...ATM : AT3G48190; ATR : AT5G40820; RDR2: AT4G11130; RDR6: AT3G49500; AGO4 AT2G27040; NRPD1a: AT1G63020; NRPE1: AT2G40030; ADH1: AT1G77120; CHLI1: AT4G18480; PIE1: AT3G12810. 3 RESULTS 3.1 Test of sgRNA candidates based on in vitro cleavage efficiency In contrast to genome editing in yeast or cultured mammalian cells,...”
• Multifaceted roles of RNA polymerase IV in plant growth and development
  Zhang, Journal of experimental botany 2020
  • “...the two alternative largest subunits of Pol IV ( Luo and Hall, 2007 ) AtNRPD1b/AtNRPE1 At2G40030 Unique largest subunit of Pol V ( Wendte et al. , 2017 ) AtNRPD2a At3G23780 Shared, the second largest catalytic subunit of Pol IV ( Herr et al. , 2005...”
• Dormant but Active: Chilling Accumulation Modulates the Epigenome and Transcriptome of Prunus avium During Bud Dormancy
  Rothkegel, Frontiers in plant science 2020
  • “...protein (AT2G40260), NAC3 (AT3G15500), and a subunit of the nuclear DNA-dependent RNA polymerase V NRPE1 (AT2G40030) required for RNA-directed DNA methylation (RdDM) ( Figure 7B ). With the aminoacidic sequence of PavPP2A and the related proteins from Arabidopsis , we observed an 81% of identity and...”
  • “...indicate the interaction sites with a zinc finger protein (AT1G64620), a homeodomain protein (AT2G40260), NRPE1 (AT2G40030) and NAC3 (AT3G15500). (C) Phylogenetic tree considering the aminoacidic sequence of PP2AB2 from sweet cherry (in bold-green) and 25 phosphatases from Arabidopsis thaliana. (D) Level of DNA methylation as percentage...”
• Plant evolution and environmental adaptation unveiled by long-read whole-genome sequencing of Spirodela
  An, Proceedings of the National Academy of Sciences of the United States of America 2019 (secret)
• The complex architecture and epigenomic impact of plant T-DNA insertions
  Jupe, PLoS genetics 2019
  • “...AtACT1 as control, and found this gene expressed. RNA-seq reads were mapped against Pol V AT2G40030 as control, and found this gene not expressed. Resulting reads were extracted and re-mapped against the TAIR10 reference genome to ensure that no off-target reads mapped to the plasmid sequences....”
• Global Methylome and gene expression analysis during early Peanut pod development
  Wang, BMC plant biology 2018
  • “...A genome B genome Arabidopsis NUCLEAR RNA POLYMERASE D1(NRPD1) Aradu.EXQ60 Araip.NHV7F AT1G63020 NRPE1 Aradu.U7301 Araip.A5H9W AT2G40030 NRPD2/NRPE2 Aradu.8Q4X6 Araip.AVR8T AT3G23780 NRPD4/NRPE4 Aradu.WLM92 Araip.F0FD4 AT4G15950 NRPE5 Aradu.LT7X3 Araip.2H1ED AT3G57080 NRPE9B Aradu.8VP1A Araip.4786J AT4G16265 NRPB1 Aradu.FV8TW Araip.AAM5W AT4G35800 RNA-DEPENDENT RNA POLYMERASE 2 (RDR2) Aradu.0K8SM Araip.63JS7 AT4G11130 DICER-LIKE 3...”
• Methylated-antibody affinity purification to improve proteomic identification of plant RNA polymerase Pol V complex and the interacting proteins
  Qin, Scientific reports 2017
  • “...consists of 12 nuclear RNA polymerase E (NRPE) subunits. The large subunit, NRPE 1 (Gene AT2G40030 encoding 1976 amino acids), binds to NRPE 2 to form the catalytic core structure, and several low-abundance subunits of NRPE 3a/3b, NRPE 10, NRPE 11 and NRPE 12 are involved...”
  • “...930.830 as shown in Fig. 3b . Structure modeling of the full-length sequence of NRPE1 (AT2G40030, 1976 amino acids) using Phyre2 retrieved a protein homologue of DNA-directed RNA polymerase II subunit rpb1 from schizosaccharomyces pombe (PDB code 3H0G), which shares 59% amino acid identities 16 ....”
• Identification and expression profiles of sRNAs and their biogenesis and action-related genes in male and female cones of Pinus tabuliformis
  Niu, BMC genomics 2015
  • “...At5g20320 PtDCL4 KJ711040 1716 Rnase III AtNRPD1a At1g63020 PtNRPD1a KJ711089 1856 DNA-dependent RNA polymerase AtNRPD1b At2g40030 PtNRPD1b KJ711090 2530 DNA-dependent RNA polymerase AtNRPD2 At3g23780 PtNRPD2 KJ711091 1348 DNA-dependent RNA polymerase AtAGO1 At1g48410 PtAGO1 KJ710984 1144 RNA slice AtAGO2 At1g31280 NA RNA slice AtAGO3 At1g31290 NA RNA...”
• More

LOC105168792 protein DCL, chloroplastic-like from Sesamum indicum
Aligns to 110:183 / 221 (33.5%), covers 98.7% of PF11523, 86.7 bits

• Development of transcriptome-derived SSR markers for Hoya ledongensis (Apocynaceae) and cross-amplification in a congener
  Chen, Applications in plant sciences 2016
  • “...LN300345 1e-05 R: TGGGATTCTTCCCACCAATA SSR-34 F: GAAATGCAGGGAATGATTGAA (AG) 8 276 54 KX084534 protein DCL, chloroplastic-like (LOC105168792), mRNA [ Sesamum indicum ] XM_011088943 2e-49 R: GACACCGGGACCAATCTTTA SSR-35 F: AAGGCCAATTCTTGTTGGTG (TA) 7 275 54 KX084535 6-phosphogluconate dehydrogenase, decarboxylating 3, transcript variant X3, mRNA [ Nicotiana sylvestris ] XM_009776029...”

EM514_ARATH / Q8L557 Protein EMBRYO DEFECTIVE 514; Protein DOMINO 1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G62440 hypothetical protein (RefSeq) from Arabidopsis thaliana
NP_201050 EMB514 (DUF3223) from Arabidopsis thaliana
Aligns to 85:158 / 202 (36.6%), covers 98.7% of PF11523, 86.4 bits

• function: May play a role in ribosome biogenesis and in determining the rate of cell division. Involved in a process essential for nuclear and nucleolar functions.
  disruption phenotype: Embryonic lethality due to embryo development arrest at globular stage.
• Comparative transcriptome analysis of galls from four different host plants suggests the molecular mechanism of gall development
  Takeda, PloS one 2019
  • “...5.15 2.51 transcription factor cell cycle regulation [ 26 ] DOMINO1|Protein of unknown function (DUF3223) AT5G62440 1.16 2.95 1.52 2.70 nuclear localization cell division, nuclear size regulation [ 27 ] DUT1|DUTP-PYROPHOSPHATASE-LIKE1 AT3G46940 1.60 4.50 3.83 7.44 deoxyuridine triphosphatase (dUTPase) DNA protection [ 28 ] AtTLP2,TLP2|tubby-like protein...”
• Plant Nucleolar Stress Response, a New Face in the NAC-Dependent Cellular Stress Responses
  Ohbayashi, Frontiers in plant science 2017
  • “...Petricka and Nelson, 2007 ; Pontvianne et al., 2010 ; Matsumura et al., 2016 DOMINO1 At5g62440 Small plant-specific protein Nucleus domino1 T-DNA insertion Enlargement Inactivation of ribosome biogenesis Retarded embryogenesis Lahmy et al., 2004 NOF1 At1g17690 DUF1253-containing protein Nucleolus nof1-1 T-DNA insertion (in the promoter region)...”
• DOMINO1, a member of a small plant-specific gene family, encodes a protein essential for nuclear and nucleolar functions.
  Lahmy, The Plant journal : for cell and molecular biology 2004 (PubMed)
  • GeneRIF: DOMINO1 encodes a protein essential for nuclear and nucleolar functions. GFP protein fusion experiment shows that DOMINO1 is targeted to the nucleus. [DOMINO1]

TTHERM_00384860 LA motif RNA-binding domain protein from Tetrahymena thermophila SB210
Aligns to 259:331 / 340 (21.5%), covers 100.0% of PF11523, 81.1 bits

• Plasmodium falciparum translational machinery condones polyadenosine repeats
  Pavlovic, eLife 2020
  • “...so as to fuse YFP to the carboxyl-terminus of a macronucleus-localized protein of unknown function (TTHERM_00384860), separated by a Gateway recombination cassette (Invitrogen/Life Technologies, Inc), and expressed from the cadmium inducible MTT1 promoter ( Shang et al., 2002 ). The TTHERM_00384860 coding region was amplified with...”
• Rapid generation of hypomorphic mutations
  Arthur, Nature communications 2017
  • “...sequence of a M acronucleus- L ocalized P rotein of unknown function ( MLP1 , TTHERM_00384860) fused to eYFP protein ( Supplementary Fig. 3 ). The fusion with MLP1 directed YFP to Tetrahymena macronuclei to allow easier quantification of YFP levels ( Fig. 2c ). These...”
  • “...to fuse YFP to the carboxyl-terminus of a Macronucleus-Localized Protein 1 of unknown function (MLP1, TTHERM_00384860), separated by a Gateway recombination cassette (Invitrogen/Life Technologies, Inc), and expressed from the cadmium inducible MTT1 promoter 54 . The MLP1 gene coding region was amplified with oligonucleotides 5 ALM...”

Sb06g025933 No description from Sorghum bicolor
Aligns to 1108:1181 / 1203 (6.2%), covers 98.7% of PF11523, 79.2 bits

• Identification of RNA silencing components in soybean and sorghum
  Liu, BMC bioinformatics 2014
  • “...4630158..4635863 1205 GmNRPD2b/GmNRPE2b Glyma04g06440 4917151..4922485 1205 Sorghum Locus names Location coordinates Protein length (a) SbNRPD1 Sb06g025933 54997978..55015850 1203 SbNRPE1a Sb03g046922 73928743..73935629 1571 SbNRPD2a/SbNRPE2a Sb01g042100 65423793..65438741 1228 SbNRPD2b/SbNRPE2b Sb06g030300 58746699..58757600 1239 (a) Protein lengths were obtained from Phytozome annotations. AGO proteins AGO proteins often contain four domains:...”

NP_001320709 nuclear RNA polymerase D1A from Arabidopsis thaliana
Aligns to 1333:1405 / 1439 (5.1%), covers 100.0% of PF11523, 78.8 bits

• The Pol IV largest subunit CTD quantitatively affects siRNA levels guiding RNA-directed DNA methylation.
  Wendte, Nucleic acids research 2019
  • GeneRIF: The C-terminal domain is dispensable for Pol IV catalytic activity and Pol IV termination-dependent activation of RNA-DEPENDENT RNA POLYMERASE 2, which partners with Pol IV to generate dsRNA precursors of the 24 nt siRNAs that guide RdDM.
• The NRPD1 N-terminus contains a Pol IV-specific motif that is critical for genome surveillance in Arabidopsis.
  Ferrafiat, Nucleic acids research 2019
  • GeneRIF: The NRPD1 N-terminus is critical for robust Pol IV-dependent transcription, siRNA production and DNA methylation.
• RNA polymerases IV and V influence the 3' boundaries of Polymerase II transcription units in Arabidopsis.
  McKinlay, RNA biology 2018
  • GeneRIF: Results show that although Pols IV and V are detected near transcript ends of the affected Pol II - transcribed genes, their role in limiting Pol II read-through is independent of siRNA biogenesis or cytosine methylation for the majority of these genes. The splicing was less efficient in pol IV or pol V mutant plants, compared to wild-type, suggesting that Pol IV or Pol V might affect pre-mRNA processing. [POL IV]
• Identification of Pol IV and RDR2-dependent precursors of 24 nt siRNAs guiding de novo DNA methylation in Arabidopsis.
  Blevins, eLife 2015
  • GeneRIF: The authors identified Pol IV and RDR2-dependent RNAs (P4R2 RNAs) that accumulate in dcl3 mutants and are diced into 24 nt RNAs by DCL3 in vitro.
• SHH1, a homeodomain protein required for DNA methylation, as well as RDR2, RDM4, and chromatin remodeling factors, associate with RNA polymerase IV.
  Law, PLoS genetics 2011
  • GeneRIF: Data show that SHH1(AT1G15215), RDR2, CLASSY1, and RDM4 were co-purified with NRPD1(At1g63020), the largest subunit of Pol-IV.
• Maternal control of Pol IV-dependent siRNAs in Arabidopsis endosperm.
  Mosher, The New phytologist 2010 (PubMed)
  • GeneRIF: Pol IV-dependent (p4-)siRNAs are initially expressed in the maternal gametophyte and uniparentally expressed from maternal chromosomes in developing endosperm.
• Intergenic transcription by RNA polymerase II coordinates Pol IV and Pol V in siRNA-directed transcriptional gene silencing in Arabidopsis.
  Zheng, Genes & development 2009
  • GeneRIF: Arabidopsis Pol II is indispensable for endogenous siRNA-mediated transcriptional gene silencing (TGS) at intergenic low-copy-number loci, despite the presence of two other polymerases-Pol IV and Pol V-that specialize in TGS through siRNAs
• NRPD1a and NRPD1b are required to maintain post-transcriptional RNA silencing and RNA-directed DNA methylation in Arabidopsis.
  Eamens, The Plant journal : for cell and molecular biology 2008 (PubMed)
  • GeneRIF: Mutants defective for the NRPD1a and NRPD1b alternative largest subunits of polymerase IV were tested for their ability to undergo RNA silencing and mantenance of transcription and post-transcriptional silencing
• More

NRPD1_ARATH / Q9LQ02 DNA-directed RNA polymerase IV subunit 1; DNA-directed RNA polymerase D subunit 1; AtNRPD1a; Nuclear RNA polymerase D 1a; Protein RNA-DIRECTED DNA METHYLATION DEFECTIVE 3; Protein SILENCING DEFECTIVE 4; Protein SILENCING MOVEMENT DEFICIENT 2; RNA polymerase IV subunit 1a; POL IV 1a; EC 2.7.7.6 from Arabidopsis thaliana (Mouse-ear cress) (see 21 papers)
AT1G63020 NRPD1A (NUCLEAR RNA POLYMERASE D 1A); DNA binding / DNA-directed RNA polymerase (RefSeq) from Arabidopsis thaliana
Aligns to 1347:1419 / 1453 (5.0%), covers 100.0% of PF11523, 78.6 bits

• function: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates (By similarity). Largest and catalytic component of RNA polymerase IV which mediates 24-nt short-interfering RNAs (siRNA) accumulation. Implicated in siRNA-directed heterochromatin formation through the action of DCL3 and AGO4, and subsequent DNA methylation-dependent silencing of targeted sequences. Essential component of a self- reinforcing loop coupling de novo DNA methylation to siRNA production. Required for intercellular but not intracellular RNA interference (RNAi) leading to systemic post-transcriptional gene silencing. Involved in the maintenance of post-transcriptional RNA silencing.
  catalytic activity: a ribonucleoside 5'-triphosphate + RNA(n) = diphosphate + RNA(n+1) (RHEA:21248)
  subunit: Component of the RNA polymerase IV complex. Interacts with NRPD2, NRPD3, NRPD3B, NRPD4, NRPD5, NRPD5B, NRPD6A, NRPD7, NRPD7B, NRPD9A, NRPD9B, NRPD10, NRPD11, NRPD12, RDR2, RDM4, CLSY1, CLSY2, CLSY3, CLSY4 and SHH1.
  disruption phenotype: Blocked in the perpetuation of CNN, CG and CNG methylation in repeated endogenous DNA accompanied by a reduction in long 24-26 nt siRNAs. Transient loss of post-transcriptional gene silencing (PTGS) in young leaves. Reduction of heterochromatin association into chromocenters, coincident with losses in cytosine methylation at pericentromeric 5S gene clusters and AtSN1 retroelements. Altered cell-to-cell movement of siRNAs beyond the vasculature. Release of transposon silencing. Not impaired RNA-directed DNA methylation-dependent (RdDM) silencing. Defective in the maintenance of post-transcriptional RNA silencing.
• Versatile in vitro assay to recognize Cas9‐induced mutations
  Bente, Plant direct 2020
  • “...& Mateo, 2015 ) to target the genes RDR2 (AT4G11130), RDR6 (AT3G49500), AGO4 (AT2G27040), NRPD1a (AT1G63020), NRPE1 (AT2G40030), ADH1 (AT1G77120), CHLI1 (AT4G18480), and PIE1 (AT3G12810) of Arabidopsis thaliana . 2.5 sgRNA preparation Templates for the in vitro transcription of sgRNAs were amplified from vectors containing the...”
  • “...Accession numbers ATM : AT3G48190; ATR : AT5G40820; RDR2: AT4G11130; RDR6: AT3G49500; AGO4 AT2G27040; NRPD1a: AT1G63020; NRPE1: AT2G40030; ADH1: AT1G77120; CHLI1: AT4G18480; PIE1: AT3G12810. 3 RESULTS 3.1 Test of sgRNA candidates based on in vitro cleavage efficiency In contrast to genome editing in yeast or cultured...”
• Multifaceted roles of RNA polymerase IV in plant growth and development
  Zhang, Journal of experimental botany 2020
  • “...in the RdDM pathway and DNA methylation in Arabidopsis Proteins Gene ID Description Reference AtNRPD1a At1G63020 One of the two alternative largest subunits of Pol IV ( Luo and Hall, 2007 ) AtNRPD1b/AtNRPE1 At2G40030 Unique largest subunit of Pol V ( Wendte et al. , 2017...”
• Cryptic variation in RNA-directed DNA-methylation controls lateral root development when auxin signalling is perturbed
  Shahzad, Nature communications 2020
  • “...( IAA27 ), AT3G62980 ( TIR1 ), AT1G70940 ( PIN3 ), AT5G20730 ( ARF7 ), AT1G63020 ( NRPD1a ), AT4G11130 ( RDR2 ), AT2G26650 ( AKT1 ), AT1G30270 ( CIPK23 ), and AT1G32450 ( NRT1 . 5 / NPF7 . 3 ). Reporting summary Further information...”
• The root hair defective phenotype of Arabidopsis thaliana Pol IV subunit mutant nrpd1a-3 is associated with a deletion in RHD6
  David, microPublication biology 2019
  • “...can be found in The Arabidopsis Information Resource (TAIR) under the following accession numbers: NRPD1A At1g63020; RHD6 At1g66470 and PP2AA3 At1g13320. The nrpd1a-3 rhd6-4 strain has been submitted to ABRC (Stock ID CS72356). Acknowledgments We thank the ACRF Cancer Genomics (Adelaide, Australia) staff for assistance with...”
• Plant evolution and environmental adaptation unveiled by long-read whole-genome sequencing of Spirodela
  An, Proceedings of the National Academy of Sciences of the United States of America 2019 (secret)
• Global Methylome and gene expression analysis during early Peanut pod development
  Wang, BMC plant biology 2018
  • “...Orthologs in Gene name A genome B genome Arabidopsis NUCLEAR RNA POLYMERASE D1(NRPD1) Aradu.EXQ60 Araip.NHV7F AT1G63020 NRPE1 Aradu.U7301 Araip.A5H9W AT2G40030 NRPD2/NRPE2 Aradu.8Q4X6 Araip.AVR8T AT3G23780 NRPD4/NRPE4 Aradu.WLM92 Araip.F0FD4 AT4G15950 NRPE5 Aradu.LT7X3 Araip.2H1ED AT3G57080 NRPE9B Aradu.8VP1A Araip.4786J AT4G16265 NRPB1 Aradu.FV8TW Araip.AAM5W AT4G35800 RNA-DEPENDENT RNA POLYMERASE 2 (RDR2) Aradu.0K8SM...”
• Agrobacterium-mediated plant transformation: biology and applications
  Hwang, The arabidopsis book 2017
  • “...A. thaliana AGO2 (At1g31280) and NRPD1A (At1g63020) are inhibitors of Agrobacterium-mediated transformation. Transient transformation with AGO2 and NRPD1a...”
• Arabidopsis RNA Polymerases IV and V Are Required To Establish H3K9 Methylation, but Not Cytosine Methylation, on Geminivirus Chromatin
  Jackel, Journal of virology 2016
  • “...(SALK_018319/At3g42670), nrpd1 (SALK_128428/CS66150 and CS66151/ At1g63020) (4), nrpe1 (nrpd1b-11; SALK_022919/At2g40030), and nrpd/e2 (nrpd2a; SALK_109513C,...”
• More

XP_020394614 DNA dependent RNA polymerase D largest subunit isoform X1 from Zea mays
Aligns to 1349:1422 / 1444 (5.1%), covers 98.7% of PF11523, 74.7 bits

• Maize RNA PolIV affects the expression of genes with nearby TE insertions and has a genome-wide repressive impact on transcription.
  Forestan, BMC plant biology 2017
  • GeneRIF: findings reveal that loss of Pol IV activity globally affects genome regulation, pointing at transposable elements as modulator of nearby gene expression and indicating the existence of multiple level epigenetic silencing mechanisms; results also suggest a predominant role of the Pol IV-mediated RdDM pathway in genome dominance regulation and subgenome stability and evolution in maize

Or search for genetic data about PF11523 in the Fitness Browser