Family Search for PF11523 (DUF3223)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

PF11523 hits 14 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

DCL_SOLLC / Q42463 Protein DCL, chloroplastic; Defective chloroplasts and leaves protein from Solanum lycopersicum (Tomato) (Lycopersicon esculentum) (see 2 papers)
Aligns to 121:197 / 224 (34.4%), covers 100.0% of PF11523, 106.5 bits

• function: Has a function in the early stage of chloroplast development and palisade cell morphogenesis (PubMed:8861949). Required for correct plastid ribosome assembly. Required for processing and maturation of 4.5S rRNA (PubMed:15010617).
  disruption phenotype: Embryonic lethality due to embryo development arrest at globular stage.

DCL_ARATH / Q9C642 Protein DCL homolog, chloroplastic; AtDCL from Arabidopsis thaliana (Mouse-ear cress) (see paper)
NP_683398 DCL protein (DUF3223) from Arabidopsis thaliana
Aligns to 116:192 / 219 (35.2%), covers 100.0% of PF11523, 105.9 bits

• function: Required for normal plastid function and plant development. Required for correct plastid ribosome assembly. Required for processing and maturation of 4.5S rRNA.
• Altered expression of the Arabidopsis ortholog of DCL affects normal plant development.
  Bellaoui, Planta 2004 (PubMed)
  • GeneRIF: AtDCL is the Arabidopsis ortholog of tomato DCL, and indicate that plastid function is required for normal plant development.

LOC108225302 protein DCL, chloroplastic-like from Daucus carota subsp. sativus
Aligns to 100:176 / 203 (37.9%), covers 100.0% of PF11523, 104.0 bits

• Comparative analysis of the carrot miRNAome in response to salt stress
  Szymonik, Scientific reports 2023
  • “...chloroplastic LOC108202773 2 0.055 dca-miR397b Protein BPS1, chloroplastic-like LOC108193212 2 0.068 dca-miR397b Protein DCL, chloroplastic-like LOC108225302 1 0.001 dca-miR423 ATPase family AAA domain-containing protein 1-B-like LOC108214061 1 0.005 dca-miR423 Uncharacterized LOC108211904 1 0.005 dca-miR423 Uncharacterized LOC108197576 2 0.012 dca-miR423 17.1kDa class II heat shock protein-like LOC108198986...”

AT3G46630 hypothetical protein from Arabidopsis thaliana
Aligns to 106:182 / 207 (37.2%), covers 100.0% of PF11523, 103.7 bits

• Nano-Strainer: A workflow for the identification of single-copy nuclear loci for plant systematic studies, using target capture kits and Oxford Nanopore long reads
  Scheunert, Ecology and evolution 2023
  • “...AGCTCAACCTCATGATCTTTGTG Protondependent oligopeptide t. f. 1719 Med 1 (2) 4 Amplified 2? 41 41 41 At3g46630 No primer design possible n.a. n.a. n.a. n.a. n.a. n.a. n.a. At5g17560 (#45) GCTGCTTCTTCGGGAGTCTT TCAATGAYGCTTATGGTGATGG BoIA(like) protein 2111 High 4 Amplified 12* 53 34/17 15/17 At4g11560 (#46) TCAACTCATTAGGTGACATGTTCAG CAAACAAGAAGCCKTATGTAGC Bromo...”
• LUX ARRHYTHMO encodes a nighttime repressor of circadian gene expression in the Arabidopsis core clock
  Helfer, Current biology : CB 2011
  • “...a 1870 bp fragment comprising the promoter region up to the previous annotated gene ( At3g46630 ), the 5UTR and the coding sequence of LUX into pENTR/D-TOPO (forward primer 5-caccCGACCACAATCAAGGAGTAAT-3, reverse primer 5-ATTCTCATTTGCGCTTCCACC-3). This construct was recombined using LR Clonase II into pMDC107 [ 45 ],...”

LOC103330828 DNA-directed RNA polymerase V subunit 1 from Prunus mume
Aligns to 1726:1802 / 1855 (4.2%), covers 98.7% of PF11523, 102.5 bits

• Isolation and Characterization of AGAMOUS-Like Genes Associated With Double-Flower Morphogenesis in Kerria japonica (Rosaceae)
  Ma, Frontiers in plant science 2018
  • “...inserted segment) has nearly 95% similarity with P. mume DNA-directed RNA polymerase V subunit 1 (LOC103330828). Another 118 bp fragment (from 1509 to 1627 bp of the inserted segment) was found to share nearly 93% similarity with Malus domestica DNA-directed RNA polymerase V subunit 1-like (LOC103438702)....”

EM514_ARATH / Q8L557 Protein EMBRYO DEFECTIVE 514; Protein DOMINO 1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
NP_201050 EMB514 (DUF3223) from Arabidopsis thaliana
AT5G62440 hypothetical protein from Arabidopsis thaliana
Aligns to 85:158 / 202 (36.6%), covers 98.7% of PF11523, 99.6 bits

• function: May play a role in ribosome biogenesis and in determining the rate of cell division. Involved in a process essential for nuclear and nucleolar functions.
  disruption phenotype: Embryonic lethality due to embryo development arrest at globular stage.
• DOMINO1, a member of a small plant-specific gene family, encodes a protein essential for nuclear and nucleolar functions.
  Lahmy, The Plant journal : for cell and molecular biology 2004 (PubMed)
  • GeneRIF: DOMINO1 encodes a protein essential for nuclear and nucleolar functions. GFP protein fusion experiment shows that DOMINO1 is targeted to the nucleus. [DOMINO1]
• Nitrile-Specific Protein NSP2 and Its Interacting Protein MPK3 Synergistically Regulate Plant Disease Resistance in Arabidopsis
  Zhai, Plants (Basel, Switzerland) 2023
  • “...that four proteins were upregulated in NSP2 -OE and downregulated in nsp2 (AT1G10940, AT1G24280, AT2G29350, AT5G62440), while another four proteins were upregulated in nsp2 and downregulated in NSP2 -OE (AT2G03870, AT3G01520, AT5G04420, AT5G08060). It is worth noting that two of these eight genes, AT1G10940 (SnrK2.4) and...”
• A Pan-plant Protein Complex Map Reveals Deep Conservation and Novel Assemblies
  McWhite, Cell 2020
  • “...lab. Purchased strains were SALK_056025 ( 3hsd/d2 , AT2G26260), CS832348/SAIL_726_H02 ( vdac2 , AT5G67500), CS1002787/SK15485(domino1, AT5G62440), CS823259/SAIL_548_H11 ( la1 , AT4G32720). All mutant lines except CS832348 were grown an additional generation prior to phenotyping and quantitation. Days to flower were marked from the introduction of plates...”
• Comparative transcriptome analysis of galls from four different host plants suggests the molecular mechanism of gall development
  Takeda, PloS one 2019
  • “...5.15 2.51 transcription factor cell cycle regulation [ 26 ] DOMINO1|Protein of unknown function (DUF3223) AT5G62440 1.16 2.95 1.52 2.70 nuclear localization cell division, nuclear size regulation [ 27 ] DUT1|DUTP-PYROPHOSPHATASE-LIKE1 AT3G46940 1.60 4.50 3.83 7.44 deoxyuridine triphosphatase (dUTPase) DNA protection [ 28 ] AtTLP2,TLP2|tubby-like protein...”
• Plant Nucleolar Stress Response, a New Face in the NAC-Dependent Cellular Stress Responses
  Ohbayashi, Frontiers in plant science 2017
  • “...Petricka and Nelson, 2007 ; Pontvianne et al., 2010 ; Matsumura et al., 2016 DOMINO1 At5g62440 Small plant-specific protein Nucleus domino1 T-DNA insertion Enlargement Inactivation of ribosome biogenesis Retarded embryogenesis Lahmy et al., 2004 NOF1 At1g17690 DUF1253-containing protein Nucleolus nof1-1 T-DNA insertion (in the promoter region)...”

LOC105168792 protein DCL, chloroplastic-like from Sesamum indicum
Aligns to 110:183 / 221 (33.5%), covers 98.7% of PF11523, 97.2 bits

• Development of transcriptome-derived SSR markers for Hoya ledongensis (Apocynaceae) and cross-amplification in a congener
  Chen, Applications in plant sciences 2016
  • “...LN300345 1e-05 R: TGGGATTCTTCCCACCAATA SSR-34 F: GAAATGCAGGGAATGATTGAA (AG) 8 276 54 KX084534 protein DCL, chloroplastic-like (LOC105168792), mRNA [ Sesamum indicum ] XM_011088943 2e-49 R: GACACCGGGACCAATCTTTA SSR-35 F: AAGGCCAATTCTTGTTGGTG (TA) 7 275 54 KX084535 6-phosphogluconate dehydrogenase, decarboxylating 3, transcript variant X3, mRNA [ Nicotiana sylvestris ] XM_009776029...”

NRPE1_ARATH / Q5D869 DNA-directed RNA polymerase V subunit 1; DNA-directed RNA polymerase D subunit 1b; AtNRPD1b; Nuclear RNA polymerase D 1b; DNA-directed RNA polymerase E subunit 1; Nuclear RNA polymerase E 1; Protein DEFECTIVE IN MERISTEM SILENCING 5; Protein DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 3; Protein RNA-DIRECTED DNA METHYLATION DEFECTIVE 1; RNA polymerase IV subunit 1; POL IV 1; EC 2.7.7.6 from Arabidopsis thaliana (Mouse-ear cress) (see 16 papers)
NP_181532 nuclear RNA polymerase D1B from Arabidopsis thaliana
AT2G40030, NP_181532 NRPD1B; DNA binding / DNA-directed RNA polymerase from Arabidopsis thaliana
Aligns to 1751:1827 / 1976 (3.9%), covers 98.7% of PF11523, 95.9 bits

• function: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Largest and catalytic component of RNA polymerase V involved in RNA- directed DNA methylation-dependent (RdDM) silencing of endogenous repeated sequences, including transposable elements. Also required for full erasure of methylation when the RNA trigger is withdrawn. Seems also involved in the synthesis of short-interfering RNAs (siRNA). Essential component of a self-reinforcing loop coupling de novo DNA methylation to siRNA production. Involved in the maintenance of post- transcriptional RNA silencing.
  catalytic activity: a ribonucleoside 5'-triphosphate + RNA(n) = diphosphate + RNA(n+1) (RHEA:21248)
  subunit: Component of the RNA polymerase V complex. Interacts with NRPD4, NRPD2A, and (via C-terminus) with AGO4. Interacts with SUVH2.
  disruption phenotype: Blocked in the perpetuation of CNN, CG and CNG methylation in repeated endogenous DNA accompanied by a reduction in 24-nt siRNAs. Reduction of heterochromatin association into chromocenters, coincident with losses in cytosine methylation at pericentromeric 5S gene clusters and AtSN1 retroelements. Impaired RNA- directed DNA methylation-dependent (RdDM) silencing. Defective in the maintenance of post-transcriptional RNA silencing.
• DDR complex facilitates global association of RNA polymerase V to promoters and evolutionarily young transposons.
  Zhong, Nature structural & molecular biology 2012
  • GeneRIF: Genome-wide chromatin association of NRPE1 is dependent on all members of a putative chromatin-remodeling complex termed DDR, which includes the proteins DRD1, DMS3 and RDM1.
• DRD1-Pol V-dependent self-silencing of an exogenous silencer restricts the non-cell autonomous silencing of an endogenous target gene.
  Dong, The Plant journal : for cell and molecular biology 2011
  • GeneRIF: DRD1-Pol V-dependent de novo methylation may play a role in restraining the inappropriate silencing of active protein-coding genes in plants. [NRPE1]
• NRPD1a and NRPD1b are required to maintain post-transcriptional RNA silencing and RNA-directed DNA methylation in Arabidopsis.
  Eamens, The Plant journal : for cell and molecular biology 2008 (PubMed)
  • GeneRIF: Mutants defective for the NRPD1a and NRPD1b alternative largest subunits of polymerase IV were tested for their ability to undergo RNA silencing and mantenance of transcription and post-transcriptional silencing.
• Pol V produced RNA facilitates transposable element excision site repair in Arabidopsis
  Renken, microPublication biology 2023
  • “...experiments was to test if the Pol IV ( AT1G63020 ) and Pol V ( AT2G40030 ) proteins are required for mPing excision site repair in Arabidopsis . As mutations of these genes result in alteration of DNA methylation, we also tested DNA repair in plants...”
  • “...pol V 1-3 ) was confirmed by sequencing the PCR amplicon from the following primers: AT2G40030 1317 For 5 CCCTCTGATGTGTAGCCCCCTCAG and AT2G40030 1627 Rev 5 GGAAAACTGTCCAAGCTGGGCCAG. Young plants were grown at 23C in 10 hours of light per day, mature plants were grown at 25C with...”
• A cryo-EM structure of KTF1-bound polymerase V transcription elongation complex
  Zhang, Nature communications 2023
  • “...The plasmid pLZ009 -GFP-NRPE1 was constructed by inserting the DNA sequence encoding Arabidopsis thaliana NRPE1 (At2g40030) by a homogenous recombination method (pEASY-Basic Seamless Cloning and Assembly Kit, Transgen Biotech, Inc) into a modified pLZ009 vector (pLZ009-GFP), which contains the CaMV35S promoter, the NOS terminator, and a...”
• New insights into the regulation of plant metabolism by O-acetylserine: sulfate and beyond
  Apodiakou, Journal of experimental botany 2023
  • “...NFYB2 AT5G47640 7 ChIP-seq Response to nutrient levels E2Fa AT2G36010 7 ChIP-seq E2F pathway NRPE1 AT2G40030 6 ChIP-seq DNA methylation, defense response to fungus BBM AT5G17430 6 ChIP-seq Lateral roof formation HY5 AT5G11260 6 ChIP-seq Anthocyanin accumulation in far-red light NFYC2 AT1G56170 5 ChIP-seq Response to...”
• Regulatory dynamics of gene expression in the developing male gametophyte of Arabidopsis
  Klodová, Plant reproduction 2023
  • “...2020 ) and our data show high levels of accumulation of AGO1 (At1g48410) and NRPD1B (At2g40030) in mature pollen. These proteins are active in 21nt siRNA production in the vegetative nucleus. Interestingly, despite the limited contribution of the sperm cell proteome, we also detected increased expression...”
• Dynamic changes in transposable element and gene methylation in mulberry (Morus notabilis) in response to Botrytis cinerea
  Xin, Horticulture research 2021
  • “...MnMET1 (KE344409.1), MnDRM3 (KE344683.1), MnDRM1 (KE345913.1), AtAGO4 (AT2G27040), AtAGO6 (AT2G32940), AtDCL3 (AT3G43920), AtNRPD1A (AT1G63020), AtNRPD1B (AT2G40030), AtRDR2 (AT4G11130), FvAGO4 (gene07657), FvAGO6.1 (gene16926), FvAGO6.2 (gene16928), FvDCL3 (gene15481), FvNRPD1 (gene32373), FvNRPE1 (gene14287), FvRDR2 (gene32159), MnAGO4 (KE344194.1), MnAGO4 (KE346072.1), MnDCL3 (KE344662.1), MnNRPD1 (KE345823.1), MnNRPE1 (KE344454.1), and MnRDR2 (KE345786.1). c...”
• Insights into the Role of Transcriptional Gene Silencing in Response to Herbicide-Treatments in Arabidopsis thaliana
  Markus, International journal of molecular sciences 2021
  • “...associated with this publication: AGO6 (AT2G32940), DDM1 (AT5G66750), FAS1 (AT1G65470), IBM1 (AT3G07610), NRPD2A (AT3G23780), NRPE1 (AT2G40030), RDR6 (AT3G49500), ROS1 (AT2G36490), RPA2 (AT2G24490), RTS1 (AT5G63110), TT4 (AT5G13930), TT5 (AT3G55120), TT7 (AT5G07990), UPF1 (AT5G47010). Acknowledgments We thank Wilfried Rozhon (Technical University Munich, Freising) for the analysis of global...”
• Arabidopsis MORC proteins function in the efficient establishment of RNA directed DNA methylation
  Xue, Nature communications 2021
  • “...39 0 0 73 49 AT4G36290 MORC1 0 0 6 0 0 0 82 65 AT2G40030 NRPE1 0 0 3 2 30 10 81 114 AT3G49250 DMS3 5 4 43 41 0 0 91 77 AT4G13460 SUVH9 3 0 3 0 0 0 27 14 AT5G04290...”
• Lasting consequences of psyllid (Bactericera cockerelli L.) infestation on tomato defense, gene expression, and growth
  Harrison, BMC plant biology 2021
  • “...xue xue bao= Journal of plant physiology and molecular biology 33.3 (2007): 179-187. Solyc01g096390.2 NRPE1 AT2G40030 0.37 DNA-directed RNA polymerase V subunit 1 DNA-dependent RNA polymerase; Catalytic component of RNA polymerase V involved in RNA-directed DNA methylation-dependent silencing of endogenous repeated sequences; Essential component of siRNA...”
  • “...origins as specialized forms of RNA polymerase II." Molecular cell 33.2 (2009): 192-203. Solyc01g096390.2 NRPE1 AT2G40030 0.37 DNA-directed RNA polymerase V subunit 1 DNA-dependent RNA polymerase; Catalytic component of RNA polymerase V involved in RNA-directed DNA methylation-dependent silencing of endogenous repeated sequences; Essential component of siRNA...”
• More

B8AHU1 DNA-directed RNA polymerase subunit from Oryza sativa subsp. indica
Aligns to 1698:1772 / 1867 (4.0%), covers 100.0% of PF11523, 87.7 bits

• Identification of Phosphorus Stress Related Proteins in the Seedlings of Dongxiang Wild Rice (Oryza Rufipogon Griff.) Using Label-Free Quantitative Proteomic Analysis
  Deng, Genes 2022
  • “...RNA recognition, Q5TKF9 ( LOC_Os05g51650 , up-regulated) with annotation of U6 snRNA-associated Sm-like protein LSm8, B8AHU1 ( LOC_Os02g05880 , downregulated) with annotation of RNA polymerase, and B8AC69 ( LOC_Os01g16010 , downregulated) with annotation of BACS2 protein, which is the core component of the Prp19-related complex, along...”

NRPD1_ARATH / Q9LQ02 DNA-directed RNA polymerase IV subunit 1; DNA-directed RNA polymerase D subunit 1; AtNRPD1a; Nuclear RNA polymerase D 1a; Protein RNA-DIRECTED DNA METHYLATION DEFECTIVE 3; Protein SILENCING DEFECTIVE 4; Protein SILENCING MOVEMENT DEFICIENT 2; RNA polymerase IV subunit 1a; POL IV 1a; EC 2.7.7.6 from Arabidopsis thaliana (Mouse-ear cress) (see 21 papers)
AT1G63020 NRPD1A (NUCLEAR RNA POLYMERASE D 1A); DNA binding / DNA-directed RNA polymerase from Arabidopsis thaliana
Aligns to 1347:1419 / 1453 (5.0%), covers 100.0% of PF11523, 84.5 bits

• function: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates (By similarity). Largest and catalytic component of RNA polymerase IV which mediates 24-nt short-interfering RNAs (siRNA) accumulation. Implicated in siRNA-directed heterochromatin formation through the action of DCL3 and AGO4, and subsequent DNA methylation-dependent silencing of targeted sequences. Essential component of a self- reinforcing loop coupling de novo DNA methylation to siRNA production. Required for intercellular but not intracellular RNA interference (RNAi) leading to systemic post-transcriptional gene silencing. Involved in the maintenance of post-transcriptional RNA silencing.
  catalytic activity: a ribonucleoside 5'-triphosphate + RNA(n) = diphosphate + RNA(n+1) (RHEA:21248)
  subunit: Component of the RNA polymerase IV complex. Interacts with NRPD2, NRPD3, NRPD3B, NRPD4, NRPD5, NRPD5B, NRPD6A, NRPD7, NRPD7B, NRPD9A, NRPD9B, NRPD10, NRPD11, NRPD12, RDR2, RDM4, CLSY1, CLSY2, CLSY3, CLSY4 and SHH1.
  disruption phenotype: Blocked in the perpetuation of CNN, CG and CNG methylation in repeated endogenous DNA accompanied by a reduction in long 24-26 nt siRNAs. Transient loss of post-transcriptional gene silencing (PTGS) in young leaves. Reduction of heterochromatin association into chromocenters, coincident with losses in cytosine methylation at pericentromeric 5S gene clusters and AtSN1 retroelements. Altered cell-to-cell movement of siRNAs beyond the vasculature. Release of transposon silencing. Not impaired RNA-directed DNA methylation-dependent (RdDM) silencing. Defective in the maintenance of post-transcriptional RNA silencing.
• The plant siRNA landscape
  Vaucheret, The Plant cell 2024
  • “...AT5G58760 AGO10 Gramene: AT5G43810 AGO10 Araport: AT5G43810 DDM1 Gramene: AT5G66750 DDM1 Araport: AT5G66750 NRPD1 Gramene: AT1G63020 NRPD1 Araport: AT1G63020 References Allen E , Xie Z , Gustafson AM , Carrington JC . microRNA-directed phasing during trans-acting siRNA biogenesis in plants . Cell . 2005 : 121...”
• Pol V produced RNA facilitates transposable element excision site repair in Arabidopsis
  Renken, microPublication biology 2023
  • “...2015) . The purpose of these experiments was to test if the Pol IV ( AT1G63020 ) and Pol V ( AT2G40030 ) proteins are required for mPing excision site repair in Arabidopsis . As mutations of these genes result in alteration of DNA methylation, we...”
• Population-level annotation of lncRNAs in Arabidopsis reveals extensive expression variation associated with transposable element-like silencing
  Kornienko, The Plant cell 2023
  • “...https://www.ncbi.nlm.nih.gov/geo/ GEO Araport: https://www.ncbi.nlm.nih.gov/geo/ DDM1 Gramene: AT5G66750 DDM1 Araport: AT5G66750 h3k27me3 CHEBI: CHEBI:85045 NRPD1 Gramene: AT1G63020 NRPD1 Araport: AT1G63020 References 1001 Genomes Consortium . 1,135 genomes reveal the global pattern of polymorphism in Arabidopsis thaliana . Cell 2016 : 166 ( 2 ): 481 491 ....”
• DNA-dependent RNA polymerases in plants
  Yang, The Plant cell 2023
  • “...Pol II Pol IV Pol V 1 At NRPA1 At3g57660 NRPC1 At5g60040 NRPB1 At4g35800 NRPD1 At1g63020 NRPE1 At2g40030 Sc A190 C160 RPB1 / / 2 At NRPA2 At1g29940 NRPC2 At5g45140 NRPB2 At4g21710 NRP(D/E)2 At3g23780 Sc A135 C128 RPB2 / / 3 At NRPA3 At1g60850 NRPC3 At1g60620...”
  • “...AT2G16390 NRPA1 Gramene: AT3G57660 NRPA1 Araport: AT3G57660 AGO6 Gramene: AT2G32940 AGO6 Araport: AT2G32940 NRPD1 Gramene: AT1G63020 NRPD1 Araport: AT1G63020 References Abascal-Palacios G , Ramsay EP , Beuron F , Morris E , Vannini A . Structural basis of RNA polymerase III transcription initiation . Nature ....”
• Endosperm cellularization failure induces a dehydration-stress response leading to embryo arrest
  Xu, The Plant cell 2023
  • “...in the TAIR database ( https://www.arabidopsis.org ) and NCBI under the following accession numbers: NRPD1 (AT1G63020), OSD1 (AT3G57860), CYP707A2 (AT2G29090), ABA3 (AT1G16540), ABI5 (AT2G36270). The sequencing data generated in this study are available in the Gene Expression Omnibus under accession number GSE196667. Supplemental Data The following...”
• The eINTACT system dissects bacterial exploitation of plant osmosignalling to enhance virulence
  You, Nature plants 2023
  • “...1 XopD-affected genes involved in gene silencing ID Gene Full name Expression change a,b Annotation AT1G63020 NRPD1A NUCLEAR RNA POLYMERASE D 1A 5.17 The unique, largest subunit of Pol IV required for siRNA synthesis 20 . AT2G19520 MSI4 MULTICOPY SUPPRESSOR OF IRA1 4 3.89 Interacts with...”
• Dynamic changes in transposable element and gene methylation in mulberry (Morus notabilis) in response to Botrytis cinerea
  Xin, Horticulture research 2021
  • “...MnCMT3 (KE343837.1), MnMET1 (KE344409.1), MnDRM3 (KE344683.1), MnDRM1 (KE345913.1), AtAGO4 (AT2G27040), AtAGO6 (AT2G32940), AtDCL3 (AT3G43920), AtNRPD1A (AT1G63020), AtNRPD1B (AT2G40030), AtRDR2 (AT4G11130), FvAGO4 (gene07657), FvAGO6.1 (gene16926), FvAGO6.2 (gene16928), FvDCL3 (gene15481), FvNRPD1 (gene32373), FvNRPE1 (gene14287), FvRDR2 (gene32159), MnAGO4 (KE344194.1), MnAGO4 (KE346072.1), MnDCL3 (KE344662.1), MnNRPD1 (KE345823.1), MnNRPE1 (KE344454.1), and MnRDR2...”
• Arabidopsis MORC proteins function in the efficient establishment of RNA directed DNA methylation
  Xue, Nature communications 2021
  • “...0 0 0 6 0 AT3G43920 DCL3 0 0 0 0 0 0 0 0 AT1G63020 NRPD1A 0 0 0 0 0 0 17 13 AT3G42670 CLSY1 0 0 0 0 0 0 0 0 AT1G15215 SHH1 0 0 0 0 0 0 0 0 Normalized...”
• More

NP_001320709 nuclear RNA polymerase D1A from Arabidopsis thaliana
Aligns to 1333:1405 / 1439 (5.1%), covers 100.0% of PF11523, 84.3 bits

• The Pol IV largest subunit CTD quantitatively affects siRNA levels guiding RNA-directed DNA methylation.
  Wendte, Nucleic acids research 2019
  • GeneRIF: The C-terminal domain is dispensable for Pol IV catalytic activity and Pol IV termination-dependent activation of RNA-DEPENDENT RNA POLYMERASE 2, which partners with Pol IV to generate dsRNA precursors of the 24 nt siRNAs that guide RdDM.
• The NRPD1 N-terminus contains a Pol IV-specific motif that is critical for genome surveillance in Arabidopsis.
  Ferrafiat, Nucleic acids research 2019
  • GeneRIF: The NRPD1 N-terminus is critical for robust Pol IV-dependent transcription, siRNA production and DNA methylation.
• RNA polymerases IV and V influence the 3' boundaries of Polymerase II transcription units in Arabidopsis.
  McKinlay, RNA biology 2018
  • GeneRIF: Results show that although Pols IV and V are detected near transcript ends of the affected Pol II - transcribed genes, their role in limiting Pol II read-through is independent of siRNA biogenesis or cytosine methylation for the majority of these genes. The splicing was less efficient in pol IV or pol V mutant plants, compared to wild-type, suggesting that Pol IV or Pol V might affect pre-mRNA processing. [POL IV]
• Identification of Pol IV and RDR2-dependent precursors of 24 nt siRNAs guiding de novo DNA methylation in Arabidopsis.
  Blevins, eLife 2015
  • GeneRIF: The authors identified Pol IV and RDR2-dependent RNAs (P4R2 RNAs) that accumulate in dcl3 mutants and are diced into 24 nt RNAs by DCL3 in vitro.
• SHH1, a homeodomain protein required for DNA methylation, as well as RDR2, RDM4, and chromatin remodeling factors, associate with RNA polymerase IV.
  Law, PLoS genetics 2011
  • GeneRIF: Data show that SHH1(AT1G15215), RDR2, CLASSY1, and RDM4 were co-purified with NRPD1(At1g63020), the largest subunit of Pol-IV.
• Maternal control of Pol IV-dependent siRNAs in Arabidopsis endosperm.
  Mosher, The New phytologist 2010 (PubMed)
  • GeneRIF: Pol IV-dependent (p4-)siRNAs are initially expressed in the maternal gametophyte and uniparentally expressed from maternal chromosomes in developing endosperm.
• Intergenic transcription by RNA polymerase II coordinates Pol IV and Pol V in siRNA-directed transcriptional gene silencing in Arabidopsis.
  Zheng, Genes & development 2009
  • GeneRIF: Arabidopsis Pol II is indispensable for endogenous siRNA-mediated transcriptional gene silencing (TGS) at intergenic low-copy-number loci, despite the presence of two other polymerases-Pol IV and Pol V-that specialize in TGS through siRNAs
• NRPD1a and NRPD1b are required to maintain post-transcriptional RNA silencing and RNA-directed DNA methylation in Arabidopsis.
  Eamens, The Plant journal : for cell and molecular biology 2008 (PubMed)
  • GeneRIF: Mutants defective for the NRPD1a and NRPD1b alternative largest subunits of polymerase IV were tested for their ability to undergo RNA silencing and mantenance of transcription and post-transcriptional silencing
• More

TTHERM_00384860 LA motif RNA-binding domain protein from Tetrahymena thermophila SB210
Aligns to 259:331 / 340 (21.5%), covers 98.7% of PF11523, 83.0 bits

• Altered tRNA processing is linked to a distinct and unusual La protein in Tetrahymena thermophila
  Kerkhofs, Nature communications 2022
  • “...La protein (NCBI Reference Sequence: XP_001019287.2 ) was obtained from the Genome Database http://www.ciliate.org/ ( TTHERM_00384860 ) 48 , and codon optimized for expression in Escherichia coli . gBlocks of the optimized codon sequence were ordered from integrated DNA technologies (IDT) (sequence can be found in...”
• Plasmodium falciparum translational machinery condones polyadenosine repeats
  Pavlovic, eLife 2020
  • “...so as to fuse YFP to the carboxyl-terminus of a macronucleus-localized protein of unknown function (TTHERM_00384860), separated by a Gateway recombination cassette (Invitrogen/Life Technologies, Inc), and expressed from the cadmium inducible MTT1 promoter ( Shang et al., 2002 ). The TTHERM_00384860 coding region was amplified with...”
• Rapid generation of hypomorphic mutations
  Arthur, Nature communications 2017
  • “...sequence of a M acronucleus- L ocalized P rotein of unknown function ( MLP1 , TTHERM_00384860) fused to eYFP protein ( Supplementary Fig. 3 ). The fusion with MLP1 directed YFP to Tetrahymena macronuclei to allow easier quantification of YFP levels ( Fig. 2c ). These...”
  • “...to fuse YFP to the carboxyl-terminus of a Macronucleus-Localized Protein 1 of unknown function (MLP1, TTHERM_00384860), separated by a Gateway recombination cassette (Invitrogen/Life Technologies, Inc), and expressed from the cadmium inducible MTT1 promoter 54 . The MLP1 gene coding region was amplified with oligonucleotides 5 ALM...”

Sb06g025933 No description from Sorghum bicolor
Aligns to 1108:1181 / 1203 (6.2%), covers 98.7% of PF11523, 81.6 bits

• Identification of RNA silencing components in soybean and sorghum
  Liu, BMC bioinformatics 2014
  • “...4630158..4635863 1205 GmNRPD2b/GmNRPE2b Glyma04g06440 4917151..4922485 1205 Sorghum Locus names Location coordinates Protein length (a) SbNRPD1 Sb06g025933 54997978..55015850 1203 SbNRPE1a Sb03g046922 73928743..73935629 1571 SbNRPD2a/SbNRPE2a Sb01g042100 65423793..65438741 1228 SbNRPD2b/SbNRPE2b Sb06g030300 58746699..58757600 1239 (a) Protein lengths were obtained from Phytozome annotations. AGO proteins AGO proteins often contain four domains:...”

XP_020394614 DNA dependent RNA polymerase D largest subunit isoform X1 from Zea mays
Aligns to 1349:1422 / 1444 (5.1%), covers 98.7% of PF11523, 78.0 bits

• Maize RNA PolIV affects the expression of genes with nearby TE insertions and has a genome-wide repressive impact on transcription.
  Forestan, BMC plant biology 2017
  • GeneRIF: findings reveal that loss of Pol IV activity globally affects genome regulation, pointing at transposable elements as modulator of nearby gene expression and indicating the existence of multiple level epigenetic silencing mechanisms; results also suggest a predominant role of the Pol IV-mediated RdDM pathway in genome dominance regulation and subgenome stability and evolution in maize

Or search for genetic data about PF11523 in the Fitness Browser