Family Search for PF11738 (DUF3298)

PF11738 hits 54 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

CD630_15590, CDIF630erm_01728 anti-sigma-V factor rsiV from Clostridioides difficile
CD1559 hypothetical protein (RefSeq) from Clostridium difficile 630
Aligns to 199:284 / 289 (29.8%), covers 97.6% of PF11738, 77.2 bits

• Activation of the extracytoplasmic function σ factor σ^V by lysozyme
  Ho, Molecular microbiology 2019
  • “...CD630_15560 N-acetylglucosamine deacetylase* pdaVprsA2sigVrsiV15601562 prsA2 CD630_15570 Peptidyl isomerase pdaVprsA2sigVrsiV15601562 sigV (csfV) CD630_15580 factor* pdaVprsA2sigVrsiV15601562 rsiV CD630_15590 Anti- factor* pdaVprsA2sigVrsiV15601562 cd1560 CD630_15600 Lysozyme binding protein pdaVprsA2sigVrsiV15601562 cd1561 CD630_15561 XdhC-like Xanthine dehydrogenase maturation factor pdaVprsA2sigVrsiV15601562 cd1562 CD630_15562 cytoplasmic zinc metalloprotease pdaVprsA2sigVrsiV15601562 dltD CD630_28540 D-alanine transfer from undecaprenol-phosphate to...”
• Iron Regulation in Clostridioides difficile
  Berges, Frontiers in microbiology 2018
  • “...-0.58 3.69 0.16 + CD630_15580 CDIF630erm_01727 csfV ECF RNA polymerase sigma factor CsfV 2.29 3.42 CD630_15590 CDIF630erm_01728 rsiV Anti ECF RNA polymerase sigma factor RsiV 1.55 2.73 CD630_26510 CDIF630erm_02905 murG UDP- N -acetylglucosamine- N -acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N - acetylglucosamine transferase 1.30 0.63 1.54 1.34 CD630_26520 CDIF630erm_02906...”
  • “...3.69 0.16 + CD630_15580 CDIF630erm_01727 csfV ECF RNA polymerase sigma factor CsfV 2.29 3.42 CD630_15590 CDIF630erm_01728 rsiV Anti ECF RNA polymerase sigma factor RsiV 1.55 2.73 CD630_26510 CDIF630erm_02905 murG UDP- N -acetylglucosamine- N -acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N - acetylglucosamine transferase 1.30 0.63 1.54 1.34 CD630_26520 CDIF630erm_02906 spoVE...”
• Clostridium difficile extracytoplasmic function σ factor σV regulates lysozyme resistance and is necessary for pathogenesis in the hamster model of infection
  Ho, Infection and immunity 2014
  • “...cd1117 cd1555 cd1556 (pdaV) cd1557 (prsA2) cd1558 (csfV) cd1559 (rsiV) cd1560 cd1561 cd1562 cd1565 cd1605 cd1606 cd1607 cd1608 cd1609 cd1610 cd1611 cd3329...”
• PrsW is required for colonization, resistance to antimicrobial peptides, and expression of extracytoplasmic function σ factors in Clostridium difficile
  Ho, Infection and immunity 2011
  • “...domains in the predicted protein sequence. Both CsfV and CD1559 (RsiV) have strong homology to B. subtilis V and anti-V (RsiV) (Fig. 1). For both csfT and...”
  • “...csfU and cd1888 (rsiU) as well as csfV and cd1559 (rsiV) coexpressions (Fig. 3). This finding suggests that these genes encode negative regulators of the ECF...”

CD0543 hypothetical protein (RefSeq) from Clostridium difficile 630
Aligns to 193:270 / 287 (27.2%), covers 97.6% of PF11738, 73.8 bits

• Genome-wide analysis of cell type-specific gene transcription during spore formation in Clostridium difficile
  Saujet, PLoS genetics 2013
  • “...Putative membrane protein 0.48 0.51 CD2841 Putatie amidohydrolase 0.57 G + proteins of unknown function CD0543 Conserved hypothetical protein 0.38 0.57 G CD1297 Conserved hypothetical protein 0.31 0.66 CD1298 Conserved hypothetical protein 0.19 0.55 CD1301.1 Conserved hypothetical protein 0.28 0.45 CD1354 Conserved hypothetical protein 0.22 0.48...”

RSIV_BACSU / O05403 Anti-sigma-V factor RsiV from Bacillus subtilis (strain 168) (see 2 papers)
BSU27130 anti-sigma(V) factor (RefSeq) from Bacillus subtilis subsp. subtilis str. 168
NP_390591 anti-sigma(V) factor from Bacillus subtilis subsp. subtilis str. 168
Aligns to 189:271 / 285 (29.1%), covers 97.6% of PF11738, 73.4 bits

• function: Anti-sigma factor for SigV. Negatively regulates SigV activity through direct interaction.
  subunit: Interacts (via N-terminal region) with SigV.
• Activation of the extracytoplasmic function σ factor σ^V by lysozyme
  Ho, Molecular microbiology 2019
  • “...Operon 4 B. subtilis sigV BSU27120 RNA polymerase ECF-type sigma factor V * sigVrsiVoatAyrhK rsiV BSU27130 Anti- factor for V * sigVrsiVoatAyrhK oatA BSU27140 O-acetyl transferase* sigVrsiVoatAyrhK yrhK BSU27150 Hypothetical protein sigVrsiVoatAyrhK dltA BSU27150 D-alanyl-D-alanine carrier protein ligase dltABCDE dltB BSU38510 D-alanine transfer from DltC to...”
• Bacterial sensing: A putative amphipathic helix in RsiV is the switch for activating σV in response to lysozyme.
  Lewerke, PLoS genetics 2018
  • GeneRIF: In Bacillus subtilis upon lysozyme binding to RsiV, the hydrophobic face of the amphipathic helix becomes accessible to a membrane-impermeable reagent. Thus, study proposes that amphipathic helices protect RsiV from cleavage in the absence of lysozyme.
• Evidence of a bacterial receptor for lysozyme: binding of lysozyme to the anti-σ factor RsiV controls activation of the ecf σ factor σV.
  Hastie, PLoS genetics 2014
  • GeneRIF: RsiV directly binds to lysozyme.RsiV controls activation of the factor sigma V.
• The activity of σV, an extracytoplasmic function σ factor of Bacillus subtilis, is controlled by regulated proteolysis of the anti-σ factor RsiV.
  Hastie, Journal of bacteriology 2013
  • GeneRIF: Authors demonstrate that the activation of a member of the ECF30 subfamily of ECF sigma factors, sigma(V) in Bacillus subtilis, is controlled by the proteolytic destruction of the anti-sigma factor RsiV.

Cthe_1437 hypothetical protein (RefSeq) from Clostridium thermocellum ATCC 27405
Aligns to 200:287 / 300 (29.3%), covers 97.6% of PF11738, 72.1 bits

• Global transcriptome analysis of Clostridium thermocellum ATCC 27405 during growth on dilute acid pretreated Populus and switchgrass
  Wilson, Biotechnology for biofuels 2013
  • “...0.09 -2.28 -1.36 Cthe_1404 GTP-binding protein HSR1-related -1.26 -1.33 0.02 -0.02 -2.55 -1.46 -3.82 -2.78 Cthe_1437 Hypothetical protein -2.50 -1.23 -0.16 -0.04 -0.16 -0.07 -2.50 -1.26 Cthe_1438 RNA polymerase sigma factor, sigma-70 family -1.90 -1.40 -0.10 -0.09 -1.03 -0.16 -2.83 -1.46 Cthe_1480 Hypothetical protein -0.38 -0.32...”
  • “...(Table 4 ). Other genes affected in the growth stage comparison include an anti-sigma factor (Cthe_1437) and a putative ABC transporter subunit (Cthe_2573). These genes are potentially contributing to the transition of the cells from log to stationary phase. Substrate-specific gene expression Comparison of differentially expressed...”

CD1560 hypothetical protein (RefSeq) from Clostridium difficile 630
CD630_15600 DUF3298 and DUF4163 domain-containing protein from Clostridioides difficile 630
Aligns to 160:245 / 251 (34.3%), covers 94.0% of PF11738, 69.5 bits

• Lysozyme Resistance in Clostridioides difficile Is Dependent on Two Peptidoglycan Deacetylases
  Kaus, Journal of bacteriology 2020 (secret)
• Clostridium difficile extracytoplasmic function σ factor σV regulates lysozyme resistance and is necessary for pathogenesis in the hamster model of infection
  Ho, Infection and immunity 2014
  • “...in the csfV operon (cd1556, cd1557, csfV, rsiV, and cd1560) had between 14- and 183-fold increases in Vdependent expression in the presence of lysozyme (Table...”
  • “...cd1556 (pdaV) cd1557 (prsA2) cd1558 (csfV) cd1559 (rsiV) cd1560 cd1561 cd1562 cd1565 cd1605 cd1606 cd1607 cd1608 cd1609 cd1610 cd1611 cd3329 Putative exported...”
• Activation of the extracytoplasmic function σ factor σ^V by lysozyme
  Ho, Molecular microbiology 2019
  • “...CD630_15570 Peptidyl isomerase pdaVprsA2sigVrsiV15601562 sigV (csfV) CD630_15580 factor* pdaVprsA2sigVrsiV15601562 rsiV CD630_15590 Anti- factor* pdaVprsA2sigVrsiV15601562 cd1560 CD630_15600 Lysozyme binding protein pdaVprsA2sigVrsiV15601562 cd1561 CD630_15561 XdhC-like Xanthine dehydrogenase maturation factor pdaVprsA2sigVrsiV15601562 cd1562 CD630_15562 cytoplasmic zinc metalloprotease pdaVprsA2sigVrsiV15601562 dltD CD630_28540 D-alanine transfer from undecaprenol-phosphate to the poly(glycerophosphate) chain dltDABC dltA...”

CPR_2297 hypothetical protein (NCBI) from Clostridium perfringens SM101
Aligns to 149:224 / 236 (32.2%), covers 98.8% of PF11738, 67.8 bits

• Genome-Wide Transcriptional Profiling of Clostridium perfringens SM101 during Sporulation Extends the Core of Putative Sporulation Genes and Genes Determining Spore Properties and Germination Characteristics
  Xiao, PloS one 2015
  • “...CPR2663 ( yyaC ), CPR2565 ( yyaD/ykvI ), CPR_0309 (CD0546), CPR_1322 (CD1594), CPR_2328 (CD2809), CPR_2525(CD3522), CPR_2297 (CD3580) * Homologs of the known sporulation genes summarized in reference [ 8 ] but that do not have specific sporulation-associated increased expression (grouped in Clusters 36) can be retrieved...”

CDR20291_1409 hypothetical protein (RefSeq) from Clostridium difficile R20291
Aligns to 160:245 / 251 (34.3%), covers 94.0% of PF11738, 64.5 bits

• Lysozyme Resistance in Clostridioides difficile Is Dependent on Two Peptidoglycan Deacetylases
  Kaus, Journal of bacteriology 2020 (secret)

BTHUR0008_RS23575 DUF3298 and DUF4163 domain-containing protein from Bacillus thuringiensis serovar berliner ATCC 10792
Aligns to 154:229 / 247 (30.8%), covers 98.8% of PF11738, 63.1 bits

• Replicates, Read Numbers, and Other Important Experimental Design Considerations for Microbial RNA-seq Identified Using Bacillus thuringiensis Datasets
  Manga, Frontiers in microbiology 2016
  • “...<0.001 BTHUR0008_RS21765 Heme ABC transporter substrate-binding protein 2.31 <0.001 BTHUR0008_RS23110 Iron transporter FeoA 1.13 <0.001 BTHUR0008_RS23575 Ferritin 1.60 <0.001 BTHUR0008_RS25020 Iron ABC transporter substrate-binding protein 2.17 <0.001 BTHUR0008_RS25025 Iron ABC transporter permease 1.70 <0.001 BTHUR0008_RS25030 Iron ABC transporter permease 1.31 <0.001 BTHUR0008_RS25035 Iron ABC transporter ATP-binding...”

lpp0767 hypothetical protein (NCBI) from Legionella pneumophila str. Paris
Aligns to 137:214 / 231 (33.8%), covers 100.0% of PF11738, 62.4 bits

• Analysis of the Legionella longbeachae genome and transcriptome uncovers unique strategies to cause Legionnaires' disease
  Cazalet, PLoS genetics 2010
  • “...lpp0946 / lpg0885 / lpl0916 / LPC_2408 llo0816 Putative endo-1,4-beta-xylanase + Unknown 100% 99% 99% lpp0767 / lpg0712 / lpl0749 / LPC_2581 llo1693 Putative pectin lyase Unknown 100% 96% * 96% * llo1410 Putative pectin lyase + Extracellular 100% 99% 99% llo1162 Putative pectin lyase +...”

LPC_2581 endo-1,4-beta-xylanase-like protein (RefSeq) from Legionella pneumophila str. Corby
Aligns to 137:214 / 231 (33.8%), covers 100.0% of PF11738, 62.3 bits

• Analysis of the Legionella longbeachae genome and transcriptome uncovers unique strategies to cause Legionnaires' disease
  Cazalet, PLoS genetics 2010
  • “...LPC_2408 llo0816 Putative endo-1,4-beta-xylanase + Unknown 100% 99% 99% lpp0767 / lpg0712 / lpl0749 / LPC_2581 llo1693 Putative pectin lyase Unknown 100% 96% * 96% * llo1410 Putative pectin lyase + Extracellular 100% 99% 99% llo1162 Putative pectin lyase + Extracellular 100% 99% 99% *: frameshift...”

lpl0749 hypothetical protein (NCBI) from Legionella pneumophila str. Lens
Aligns to 137:214 / 231 (33.8%), covers 100.0% of PF11738, 62.3 bits

• Analysis of the Legionella longbeachae genome and transcriptome uncovers unique strategies to cause Legionnaires' disease
  Cazalet, PLoS genetics 2010
  • “...lpl0916 / LPC_2408 llo0816 Putative endo-1,4-beta-xylanase + Unknown 100% 99% 99% lpp0767 / lpg0712 / lpl0749 / LPC_2581 llo1693 Putative pectin lyase Unknown 100% 96% * 96% * llo1410 Putative pectin lyase + Extracellular 100% 99% 99% llo1162 Putative pectin lyase + Extracellular 100% 99% 99%...”

lpg0712 endo-1,4-beta-xylanase-like (NCBI) from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Aligns to 137:214 / 231 (33.8%), covers 100.0% of PF11738, 61.7 bits

• Analysis of the Legionella longbeachae genome and transcriptome uncovers unique strategies to cause Legionnaires' disease
  Cazalet, PLoS genetics 2010
  • “...lpg0885 / lpl0916 / LPC_2408 llo0816 Putative endo-1,4-beta-xylanase + Unknown 100% 99% 99% lpp0767 / lpg0712 / lpl0749 / LPC_2581 llo1693 Putative pectin lyase Unknown 100% 96% * 96% * llo1410 Putative pectin lyase + Extracellular 100% 99% 99% llo1162 Putative pectin lyase + Extracellular 100%...”

OG1RF_12447 RsiV family protein from Enterococcus faecalis OG1RF
Aligns to 195:281 / 294 (29.6%), covers 95.2% of PF11738, 61.3 bits

• Comparative Biofilm Assays Using Enterococcus faecalis OG1RF Identify New Determinants of Biofilm Formation
  Willett, mBio 2021
  • “...protein Intergenic_2022 2075283 IGR between OG1RF_11962 and OG1RF_11963 Intergenic_2295 2348175 IGR between OG1RF_12228 and OG1RF_12229 OG1RF_12447 2581857 DUF3298 domain-containing protein OG1RF_12502 2644218 WxL domain-containing protein Intergenic_2613 2692363 IGR between OG1RF_r10012 and OG1RF_12535, encodes OG1RF_RS13855 OG1RF_12540 2699893 DUF1129 domain-containing protein Next, we asked which Tn mutants were...”

MSMEG_1150 hypothetical protein (NCBI) from Mycobacterium smegmatis str. MC2 155
Aligns to 158:260 / 273 (37.7%), covers 98.8% of PF11738, 61.2 bits

• Genome-Wide Transcriptome Profiling of Mycobacterium smegmatis MC² 155 Cultivated in Minimal Media Supplemented with Cholesterol, Androstenedione or Glycerol.
  Li, International journal of molecular sciences 2016
  • “...Start End MSMEG_0132 MSMEG_0144 MSMEG_0132 MSMEG_0144 MSMEG_0329 MSMEG_0346 MSMEG_2705 MSMEG_2714 MSMEG_0500 MSMEG_0518 MSMEG_0638 MSMEG_0649 MSMEG_1141 MSMEG_1150 MSMEG_1141 MSMEG_1150 MSMEG_1364 MSMEG_1375 MSMEG_1435 MSMEG_1448 MSMEG_2705 MSMEG_2713 MSMEG_6115 MSMEG_6125 MSMEG_2854 MSMEG_2865 MSMEG_2854 MSMEG_2861 MSMEG_3997 MSMEG_4005 MSMEG_4414 MSMEG_4427 MSMEG_4419 MSMEG_4427 MSMEG_4835 MSMEG_4843 MSMEG_4461 MSMEG_4468 MSMEG_5953 MSMEG_5966 MSMEG_4864 MSMEG_4873...”

Cthe_0057 hypothetical protein (RefSeq) from Clostridium thermocellum ATCC 27405
Aligns to 122:194 / 210 (34.8%), covers 96.4% of PF11738, 60.9 bits

• Global transcriptome analysis of Clostridium thermocellum ATCC 27405 during growth on dilute acid pretreated Populus and switchgrass
  Wilson, Biotechnology for biofuels 2013
  • “...- (Switchgrass 37hours) RNA-seq (KDMM) Array RNA-seq (KDMM) Array RNA-seq (KDMM) Array RNA-seq (KDMM) Array Cthe_0057 Hypothetical protein -0.18 -0.44 0.56 0.26 -2.27 -1.53 -3.01 -2.23 Cthe_0264 Hypothetical protein -2.96 -1.63 -1.05 -0.45 -3.16 -1.70 -5.07 -2.88 Cthe_0272 Peptidase S11 D-alanyl-D-alanine carboxypeptidase 1 -1.33 -0.69 0.80...”

EF3179 conserved hypothetical protein (NCBI ptt file) from Enterococcus faecalis V583
EF_3179 RsiV family protein from Enterococcus faecalis V583
Aligns to 195:281 / 294 (29.6%), covers 95.2% of PF11738, 60.3 bits

• SigV Mediates Lysozyme Resistance in Enterococcus faecalis via RsiV and PgdA
  Parthasarathy, Journal of bacteriology 2021 (secret)
• Activation of the extracytoplasmic function σ factor σ^V by lysozyme
  Ho, Molecular microbiology 2019
  • “...Hypothetical protein cd1606-cd1611 cd1611 CD630_16110 Hypothetical protein cd1606-cd1611 E. faecalis sigV EF_3180 factor* sigVrsiV rsiV EF_3179 Anti- factor* sigVrsiV pgdA EF_1843 N-acetylglucosamine deacetylase* pdgA ef0159 EF_0159 Hypothetical protein ef0159 ef1934 EF_1934 Hypothetical protein ef19331934 ef0315 EF_0315 Hypothetical protein ef0315 1. Common gene name 2. Locus tags...”

CD3580 hypothetical protein (RefSeq) from Clostridium difficile 630
Aligns to 144:217 / 247 (30.0%), covers 100.0% of PF11738, 60.0 bits

• Increased sporulation underpins adaptation of Clostridium difficile strain 630 to a biologically-relevant faecal environment, with implications for pathogenicity
  Ternan, Scientific reports 2018
  • “...of genes reported to be regulated by sporulationspecific sigma factors 41 43 , including K (CD3580 & CD1065), G (CD2808 & CD2375) and E (CD1063A-C, CD2150A & CD3522) were also DE in FW. Dembek 83 reported that a large proportion of C. difficile spore transcripts encoded...”
• A Recombination Directionality Factor Controls the Cell Type-Specific Activation of σK and the Fidelity of Spore Development in Clostridium difficile
  Serrano, PLoS genetics 2016
  • “...+/- 8 6 +/-0.2 CD1133 31 +/- 2 2.7 +/- 0.8 30 +/-1 2.2 +/-0.8 CD3580 70 +/-15 2.9 +/- 0.9 50 +/-5 3 +/- 0.5 Total RNAs were extracted from C . difficile 630 erm strain, the CD1231 and CD1234 mutants, and the complementation strains...”
• SpoIIID-mediated regulation of σK function during Clostridium difficile sporulation
  Pishdadian, Molecular microbiology 2015
  • “...gene expression between the spoIIID train and swild type for K regulon genes, sleC, cotE, CD3580 and cdeC ( Fig. 4 ; 100-fold, 55-fold, 224-fold and 27-fold respectively; p < 0.001), consistent with results of the RNA-Seq analyses ( Tables S4 and S5 ). While no...”
  • “...both the spoIIID and sigK mutants fail to produce K -regulated gene products (SleC, CotE, CD3580 and CotE) even though they produce wild-type levels of the E -regulated gene products SpoIVA and CotB ( Fig. S5 ; Fimlaid et al ., 2013 ). As the spoIIID...”
• Genome-Wide Transcriptional Profiling of Clostridium perfringens SM101 during Sporulation Extends the Core of Putative Sporulation Genes and Genes Determining Spore Properties and Germination Characteristics
  Xiao, PloS one 2015
  • “...( yyaC ), CPR2565 ( yyaD/ykvI ), CPR_0309 (CD0546), CPR_1322 (CD1594), CPR_2328 (CD2809), CPR_2525(CD3522), CPR_2297 (CD3580) * Homologs of the known sporulation genes summarized in reference [ 8 ] but that do not have specific sporulation-associated increased expression (grouped in Clusters 36) can be retrieved from...”
• Genome-wide analysis of cell type-specific gene transcription during spore formation in Clostridium difficile
  Saujet, PLoS genetics 2013
  • “...protein 0.01 0.01 + CD2055 Conserved hypothetical protein 0.33 CD2409 Conserved hypothetical protein 0.11 K CD3580 Conserved hypothetical protein 0.11 0.12 K + CD3613 Conserved hypothetical protein 0.04 K + CD3620 Conserved hypothetical protein, similar to YmaF 0.34 0.04 + a A gene is considered differentially...”
  • “...-dependent promoter upstream five of their encoding genes ( CD1063.1 , CD1067 , CD1133 , CD3580 and CD3613 ). These proteins are most likely spore coat proteins but further work would be necessary to characterize their localization and their function in C. difficile . In conclusion,...”

MAB_1003c hypothetical protein (RefSeq) from Mycobacterium abscessus ATCC 19977
Aligns to 159:260 / 272 (37.5%), covers 97.6% of PF11738, 57.5 bits

• A Simplified and Efficient Method for Himar-1 Transposon Sequencing in Bacteria, Demonstrated by Creation and Analysis of a Saturated Transposon-Mutant Library in Mycobacterium abscessus.
  Foreman, mSystems 2020
  • “...CGCGCCAAGCAG MAB_0962 2,403 259 + ACCCGGGATCAA TA CTGCCCTCGGGC MAB_0978 2,235 967 + CTGGCCGAGCCT TA CCTCCTGGAGGG MAB_1003c 819 531 ATCCAGTGCTAC TA CGGCTTCTACGC MAB_1011c 858 708 ACCGCATCAACT TA TGTACCCCCGAT MAB_1011c 858 15 CGAATCGTGGCC TA CGGTCGTGTCCG MAB_1019c 1,071 608 GGAAAAGATACC TA TAGCCGAGCAGA MAB_1103 729 369 + CCCGCTGCCCTT TA CTTATCCGCCTT...”
• Identification of antigens specific to non-tuberculous mycobacteria: the Mce family of proteins as a target of T cell immune responses
  Checkley, PloS one 2011
  • “...protein MMAR_0160 [Mycobacterium marinum M], YP_908294.1: hypothetical protein MUL_4936 [Mycobacterium ulcerans Agy99], YP_001701747.1: hypothetical protein MAB_1003c [Mycobacterium abscessus ATCC 19977], NP_959049.1: hypothetical protein MAP0115 [Mycobacterium avium subsp. paratuberculosis K-10], YP_879405.1: hypothetical protein MAV_0109 [Mycobacterium avium 104], NZ_ABIN01000160_P_8921: predicted protein sequence from M. intracellulare genome, NOTNCBI_FOR324_P_3844: predicted...”

MMAR_3871 hypothetical protein (RefSeq) from Mycobacterium marinum M
MUL_3803 conserved hypothetical secreted protein (NCBI) from Mycobacterium ulcerans Agy99
Aligns to 151:251 / 259 (39.0%), covers 98.8% of PF11738, 56.2 bits

• Identification of antigens specific to non-tuberculous mycobacteria: the Mce family of proteins as a target of T cell immune responses
  Checkley, PloS one 2011
  • “...protein [Mycobacterium abscessus ATCC 19977]. B. Protein sequences making up cluster B: YP_001852137.1: hypothetical protein MMAR_3871 [Mycobacterium marinum M], YP_907374.1: hypothetical protein MUL_3803 [Mycobacterium ulcerans Agy99], NP_960792.1: hypothetical protein MAP1858 [Mycobacterium avium subsp. paratuberculosis K-10], YP_881582.1: hypothetical protein MAV_2381 [Mycobacterium avium 104], NZ_ABIN01000058_P_11097: predicted protein sequence...”
• Identification of antigens specific to non-tuberculous mycobacteria: the Mce family of proteins as a target of T cell immune responses
  Checkley, PloS one 2011
  • “...sequences making up cluster B: YP_001852137.1: hypothetical protein MMAR_3871 [Mycobacterium marinum M], YP_907374.1: hypothetical protein MUL_3803 [Mycobacterium ulcerans Agy99], NP_960792.1: hypothetical protein MAP1858 [Mycobacterium avium subsp. paratuberculosis K-10], YP_881582.1: hypothetical protein MAV_2381 [Mycobacterium avium 104], NZ_ABIN01000058_P_11097: predicted protein sequence from M. intracellulare genome, YP_001848485.1: hypothetical protein...”

MAV_2381 hypothetical protein (NCBI) from Mycobacterium avium 104
Aligns to 147:247 / 255 (39.6%), covers 98.8% of PF11738, 52.3 bits

• Identification of antigens specific to non-tuberculous mycobacteria: the Mce family of proteins as a target of T cell immune responses
  Checkley, PloS one 2011
  • “...[Mycobacterium ulcerans Agy99], NP_960792.1: hypothetical protein MAP1858 [Mycobacterium avium subsp. paratuberculosis K-10], YP_881582.1: hypothetical protein MAV_2381 [Mycobacterium avium 104], NZ_ABIN01000058_P_11097: predicted protein sequence from M. intracellulare genome, YP_001848485.1: hypothetical protein MMAR_0160 [Mycobacterium marinum M], YP_908294.1: hypothetical protein MUL_4936 [Mycobacterium ulcerans Agy99], YP_001701747.1: hypothetical protein MAB_1003c [Mycobacterium...”

MAP1858 hypothetical protein (NCBI) from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 147:247 / 255 (39.6%), covers 98.8% of PF11738, 52.2 bits

• Identification of antigens specific to non-tuberculous mycobacteria: the Mce family of proteins as a target of T cell immune responses
  Checkley, PloS one 2011
  • “...protein MMAR_3871 [Mycobacterium marinum M], YP_907374.1: hypothetical protein MUL_3803 [Mycobacterium ulcerans Agy99], NP_960792.1: hypothetical protein MAP1858 [Mycobacterium avium subsp. paratuberculosis K-10], YP_881582.1: hypothetical protein MAV_2381 [Mycobacterium avium 104], NZ_ABIN01000058_P_11097: predicted protein sequence from M. intracellulare genome, YP_001848485.1: hypothetical protein MMAR_0160 [Mycobacterium marinum M], YP_908294.1: hypothetical protein...”

MUL_4936 conserved secreted protein (NCBI) from Mycobacterium ulcerans Agy99
Aligns to 138:240 / 252 (40.9%), covers 97.6% of PF11738, 52.1 bits

• Identification of antigens specific to non-tuberculous mycobacteria: the Mce family of proteins as a target of T cell immune responses
  Checkley, PloS one 2011
  • “...sequence from M. intracellulare genome, YP_001848485.1: hypothetical protein MMAR_0160 [Mycobacterium marinum M], YP_908294.1: hypothetical protein MUL_4936 [Mycobacterium ulcerans Agy99], YP_001701747.1: hypothetical protein MAB_1003c [Mycobacterium abscessus ATCC 19977], NP_959049.1: hypothetical protein MAP0115 [Mycobacterium avium subsp. paratuberculosis K-10], YP_879405.1: hypothetical protein MAV_0109 [Mycobacterium avium 104], NZ_ABIN01000160_P_8921: predicted protein...”

MMAR_0160 hypothetical protein (RefSeq) from Mycobacterium marinum M
Aligns to 149:251 / 263 (39.2%), covers 97.6% of PF11738, 51.4 bits

• Identification of antigens specific to non-tuberculous mycobacteria: the Mce family of proteins as a target of T cell immune responses
  Checkley, PloS one 2011
  • “...MAV_2381 [Mycobacterium avium 104], NZ_ABIN01000058_P_11097: predicted protein sequence from M. intracellulare genome, YP_001848485.1: hypothetical protein MMAR_0160 [Mycobacterium marinum M], YP_908294.1: hypothetical protein MUL_4936 [Mycobacterium ulcerans Agy99], YP_001701747.1: hypothetical protein MAB_1003c [Mycobacterium abscessus ATCC 19977], NP_959049.1: hypothetical protein MAP0115 [Mycobacterium avium subsp. paratuberculosis K-10], YP_879405.1: hypothetical protein...”

MAP0115 hypothetical protein (NCBI) from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 147:247 / 261 (38.7%), covers 96.4% of PF11738, 50.7 bits

• A Bovine Enteric Mycobacterium Infection Model to Analyze Parenteral Vaccine-Induced Mucosal Immunity and Accelerate Vaccine Discovery
  Facciuolo, Frontiers in immunology 2020
  • “...(p=0.028) MAP4263 3.1 (p=0.049) 2.1 (p=0.019) 15.2 (p=0.0006) 1.6 (p=0.001) MAP3550 2.7 (p=0.069) 1.8 (p=0.003) MAP0115 3.2 (p=0.052) 2.4 (p=0.006) 14.8 (p=0.003) 2.1 (p=0.008) MAP0187c 1.7 (p=0.037) 8.8 (p=0.027) 1.6 (p=0.061) A 5.73 1.0 PBMCs (5 x 10 6 ) and Discrete PP cells (2 x...”
• Identification of antigens specific to non-tuberculous mycobacteria: the Mce family of proteins as a target of T cell immune responses
  Checkley, PloS one 2011
  • “...MUL_4936 [Mycobacterium ulcerans Agy99], YP_001701747.1: hypothetical protein MAB_1003c [Mycobacterium abscessus ATCC 19977], NP_959049.1: hypothetical protein MAP0115 [Mycobacterium avium subsp. paratuberculosis K-10], YP_879405.1: hypothetical protein MAV_0109 [Mycobacterium avium 104], NZ_ABIN01000160_P_8921: predicted protein sequence from M. intracellulare genome, NOTNCBI_FOR324_P_3844: predicted protein sequence from M. fortuitum genome. Note: protein...”

MAV_0109 hypothetical protein (NCBI) from Mycobacterium avium 104
Aligns to 147:247 / 261 (38.7%), covers 96.4% of PF11738, 50.7 bits

• Identification of antigens specific to non-tuberculous mycobacteria: the Mce family of proteins as a target of T cell immune responses
  Checkley, PloS one 2011
  • “...abscessus ATCC 19977], NP_959049.1: hypothetical protein MAP0115 [Mycobacterium avium subsp. paratuberculosis K-10], YP_879405.1: hypothetical protein MAV_0109 [Mycobacterium avium 104], NZ_ABIN01000160_P_8921: predicted protein sequence from M. intracellulare genome, NOTNCBI_FOR324_P_3844: predicted protein sequence from M. fortuitum genome. Note: protein sequences from M. marinum and M. ulcerans are shown...”

BLi04185 hypothetical protein (NCBI) from Bacillus licheniformis DSM 13
Aligns to 138:224 / 227 (38.3%), covers 88.1% of PF11738, 48.9 bits

• Cell envelope stress response in Bacillus licheniformis: integrating comparative genomics, transcriptional profiling, and regulon mining to decipher a complex regulatory network
  Wecke, Journal of bacteriology 2006
  • “...yxeIG recU-ponA yerH ywrO htpG rocR-yckKJI Bli04025 yjbIH Bli04185 YtrA CtsR Acetoin utilization, stress inducible in B. subtilis Class III heat shock operon,...”

PGN_1502 hypothetical protein (RefSeq) from Porphyromonas gingivalis ATCC 33277
Aligns to 187:266 / 290 (27.6%), covers 98.8% of PF11738, 47.8 bits

• The Porphyromonas gingivalis ferric uptake regulator orthologue binds hemin and regulates hemin-responsive biofilm development
  Butler, PloS one 2014
  • “...for EMSA PGN_0001_240bp_For GGTGTTGATAACTCGGTCGCGCCTT PGN_0001Rev CTAAAAAAATATCGTTTTGAGAGCAGT Construction of har mutant PGN_1502-Fwd ATGTCGCCTTCCGAGGCTAT ErmF-PGN_1502-Rev GCAATAGCGGAAGCTATCGG TTATCTTTTCGATCCATTCTTGC PGN_1502- ErmF -Fwd AGAATGGATCGAAAAGATAA CCGATAGCTTCCGCTATTGC Term- ErmF -Rev GTCTTTCGACTGAGCCTTTCGTT TTAGCATCTAATTTAACTTCAATTCC Term- Prom-region -Fwd GCTCAGTCGAAAGACTGGGCCTTTCGTTTTA CGGAGTGAAAAAGGAGCCG PGN_1504- Prom-region -Rev CAATGTTATATGTCTGTGTTA TCTCTCTTTTACATCATATTTTCC Prom-region- PGN_1504 -Fwd AATATGATGTAAAAGAGAGA TAACACAGACATATAACATTGATCC PGN_1504-Rev GCAGATATTTTGTAGCCTCCATC Construction of har complement...”
  • “...cassette for deletion of the har gene consisted of the final 600 bp of the PGN_1502 gene, the ermF gene encoding erythromycin resistance in P. gingivalis , followed by a transcriptional terminator then a copy of the promoter region that drives the operon containing PGN_1503, followed...”

MUL_5032 immunogenic protein Mpt64 (NCBI) from Mycobacterium ulcerans Agy99
Aligns to 147:223 / 230 (33.5%), covers 96.4% of PF11738, 45.8 bits

• Exposure Risk for Infection and Lack of Human-to-Human Transmission of Mycobacterium ulcerans Disease, Australia
  O'Brien, Emerging infectious diseases 2017
  • “...MUL_4830 Putative GTPase T/C Synonymous mu248 T: 0, A: 0, G: 0, C: 20 5577431 MUL_5032 Immunogenic protein mbt64 A/G Synonymous mu394 T: 0, A: 0, G: 28, C: 0 *A total of 4,918 core single-nucleotide polymorphisms were identified for all 6 isolates compared with the...”
• Genomic diversity and evolution of Mycobacterium ulcerans revealed by next-generation sequencing
  Qi, PLoS pathogens 2009
  • “...protein COG2185I 77 MUL_3194 - hypothetical protein COG2261S 77 MUL_0424 - hypothetical protein - 77 MUL_5032 mpt64 immunogenic protein Mpt64 COG0425O 77 MUL_4365 - hypothetical protein COG0393S 77 MUL_4394 - hypothetical protein COG0526OC 78 MUL_3305 ribD hypothetical protein COG1985H 78 MUL_3524 - diphosphomevalonate decarboxylase COG3407I 78...”

PG1308 hypothetical protein (NCBI) from Porphyromonas gingivalis W83
Aligns to 185:264 / 281 (28.5%), covers 97.6% of PF11738, 45.6 bits

• Role of vimA in cell surface biogenesis in Porphyromonas gingivalis
  Osbourne, Microbiology (Reading, England) 2010
  • “...55 7 Probable outer membrane lipoprotein PG1177 Cell wall biogenesis 21 18 Conserved hypothetical protein PG1308 Unknown 100 24 Conserved hypothetical protein PG1496 Transport 99 19 Conserved hypothetical protein PG1772 Proteolysis 98 4 Hypothetical protein PG1790 Unknown 10 1 Outer-membrane protein (immunogenic 23kDa lipoprotein) PG1793 Cell...”

Mb2002c IMMUNOGENIC PROTEIN MPT64 (ANTIGEN MPT64/MPB64) (NCBI) from Mycobacterium bovis AF2122/97
NP_216496 immunogenic protein Mpt64 from Mycobacterium tuberculosis H37Rv
P9WIN9 Immunogenic protein MPT64 from Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
NP_216496, Rv1980c IMMUNOGENIC PROTEIN MPT64 (ANTIGEN MPT64/MPB64) (NCBI) from Mycobacterium tuberculosis H37Rv
Aligns to 145:221 / 228 (33.8%), covers 97.6% of PF11738, 45.1 bits

• Towards Reverse Vaccinology for Bovine TB: High Throughput Expression of Full Length Recombinant Mycobacterium bovis Proteins
  Paliwal, Frontiers in molecular biosciences 2022
  • “...& Insect +++ +++ Mb3644c ESX-1 secretion-associated protein espd E. coli & Insect - - Mb2002c Immunogenic protein mpt64 (antigen mpt64/mpb64) E. coli & Insect +++ +++ Mb1762 Probable conserved transmembrane protein E. coli & Insect 0 ++ Information pathway related proteins Mb0055 Single-strand binding protein...”
• Proteome characterization of the culture supernatant of Mycobacterium bovis in different growth stages
  Assal, Biochemistry and biophysics reports 2021
  • “...complex B (Ag85B) Mb2397c + + + S Y 16.6 Low molecular weight antigen MTB12 Mb2002c + + S Y 24.8 Antigen MPB64 Mb0192A + + + U N 5.7 Metallothionein OS Mb1858 + + + CW/EC N 17.3 Uncharacterized protein Mb1858 Mb1891 + + +...”
  • “...a role in the development of immune responses to mycobacterial infection, MTB12 (Mb2397c) and MPB64 (Mb2002c), were also identified [ 31 ]. MPB64 is a possible plasminogen-binding protein that may have a role in the bacterial virulence [ 32 ]. Mb1858 is another possible extracellular protein...”
• Proteomic analysis of protein purified derivative of Mycobacterium bovis
  Roperto, Journal of translational medicine 2017
  • “...H37Rv, and M. bovis, strain AN5, are highly related. Accordingly, some proteins including Mb0448, Mb1918c, Mb2002c, Mb3789, Mb3834c, Mb3904, Mb3905, just like their orthologs from M. tuberculosis H37RV, could have more than 20 different T cell epitopes since they are known to be evolutionarily hyperconserved [...”
• Understanding HIV-Mycobacteria synergism through comparative proteomics of intra-phagosomal mycobacteria during mono- and HIV co-infection
  Ganji, Scientific reports 2016
  • “...Rv2100 13 BCG0079c 7.5 30.8 cell wall and cell processes Possible membrane protein/Unknown Rv0048c 14 Mb2002c 4.5 24.8 cell wall and cell processes Immunogenic protein Mpt64/Unknown. Rv1980c 15 BCG3662c 10.69 12 information pathways Iron-regulated H-NS-like protein Lsr2/Has DNA-bridging activity. Rv3597c 16 BCG3174 5.2 85.3 intermediary metabolism...”
• Single-antigen serological testing for bovine tuberculosis
  Green, Clinical and vaccine immunology : CVI 2009
  • “...MPB83 (Mb2898) ESAT6 (Mb3905) CFP10 (Mb3904) Acr1 (Mb3423) MPB64 (Mb2002c) PPE68 (Mb3903) 100 (4e121) 76 (2e83) ND 40 (1e22) 100 (2e46) 97 (2e45) ND 71 (7e30)...”
• Electrochemical aptasensor using optimized surface chemistry for the detection of Mycobacterium tuberculosis secreted protein MPT64 in human serum.
  Sypabekova, Biosensors & bioelectronics 2019 (PubMed)
  • GeneRIF: The study investigates combinatorial effects of an aptamer linker and a co-adsorbent onto a gold electrode for optimal binding efficiency and reduced non-specific interactions for label-free detection of MPT64 using electrochemical impedance spectroscopy.
• Association of Mycobacterium tuberculosis L-formmpb64 gene and lung cancer.
  Abudureheman, European review for medical and pharmacological sciences 2019 (PubMed)
  • GeneRIF: The Mpb64 gene fragment is highly expressed in the nucleus of pulmonary tuberculosis tissues. Its expression in the nucleus of pulmonary tuberculosis plus lung cancer tissue is significant and the expression in the nucleus of lung cancer tissue is also high. The expression of Mpb64 is independent from the various pathological features of the cancerous tissues.
• Immunochromatographic detection of MPB64 secreted from active BCG by heating: toward same-day diagnosis of tuberculosis.
  Nakaishi, BioTechniques 2019 (PubMed)
  • GeneRIF: When BCG was included in solution at a concentration >2.75 x 10(4) CFU/ml, our method for collecting MPB64 through heating active BCG combined with an immunochromatographic assay detected active bacilli within 2.5 h.
• Selection, characterization, and application of DNA aptamers for detection of Mycobacterium tuberculosis secreted protein MPT64.
  Sypabekova, Tuberculosis (Edinburgh, Scotland) 2017 (PubMed)
  • GeneRIF: Aptamers against Mtb secreted protein MPT64 were successfully selected and could be used as an alternative for detection and diagnosis of tuberculosis.
• Polymorphism of antigen MPT64 in Mycobacterium tuberculosis strains.
  Jiang, Journal of clinical microbiology 2013
  • GeneRIF: we found that polymorphisms of the mpt64 gene in the MTBC may be the reason for changes in the antigen produced, which may in turn cause alterations of related functions, thereby allowing immune evasion.
• A DNA vaccine expressing CFP21 and MPT64 fusion protein enhances BCG-induced protective immunity against Mycobacterium tuberculosis infection in mice.
  Wang, Medical microbiology and immunology 2011 (PubMed)
  • GeneRIF: CFP21 (cutinase precursor) and MPT64 fusion protein stimulate higher level of interferon (IFN)-gamma in tuberculin skin test (TST)-positive healthy population than in TST-negative healthy population.
• [Immunoprophylaxis of recombinant Mycobacterium vaccae secreted MPT64 of Mycobacterium tuberculosis].
  Bai, Xi bao yu fen zi mian yi xue za zhi = Chinese journal of cellular and molecular immunology 2009 (PubMed)
  • GeneRIF: Data show that Recombinant Mycobacterium vaccae secreted MPT64 could induce high level humoral and cell mediated immune responses in mice and could be used as a candidate of new vaccine against TB.
• Design and optimization of a recombinant system for large-scale production of the MPT64 antigen from Mycobacterium tuberculosis.
  Geisbrecht, Protein expression and purification 2006 (PubMed)
  • GeneRIF: Recombinant rMPT64 elicits a specific immune response indistinguishable from that of MPB64 purified from BCG Tokyo culture filtrates.
• A standardized production pipeline for high profile targets from Mycobacterium tuberculosis
  Milewski, Proteomics. Clinical applications 2016
  • “...32.7 4.93 Rv1886c Ag85b (FbpB) P9WQP1 Diacylglycerol acyltransferase/mycolyltransferase 1 S 18 34.6 5.62 Rv1980c Mpt64 P9WIN9 Immunogenic protein 2 S 18 24.9 4.84 Rv2031c Acr (HspX) P9WMK1 Alphacrystallin 0 C; M 16.2 5.00 Rv2654c Antitoxin Rv2654 P9WJ11 Antitoxin component of a toxinantitoxin module (Rv2654cRv2653c) 0 g...”
• Pathogenicity and virulence of Mycobacterium tuberculosis
  Rahlwes, Virulence 2023 (no snippet)
• Expression and epitope prediction of MPT64 recombinant proteins from clinical isolates of Mycobacterium tuberculosis as immunoserodiagnostic candidates
  Fihiruddin, Veterinary world 2022
  • “...treatment. The efficacy of the Bacille CalmetteGuerin (BCG) vaccine is inconclusive in eastern Indonesia. The RV1980c gene of Mycobacterium tuberculosis encodes an antigenic protein that is considered to be a virulence factor, as it can stimulate the immune response in patients with TB. This study aimed...”
  • “...tests and recombinant vaccines. Materials and Methods: The polymerase chain reaction (PCR) product of the RV1980c gene was inserted into the SUMO pET plasmid, which was then transformed into Escherichia coli BL21 (DE3) cells and expressed in Luria Bertani media induced by 1.0 M IPTG. Subsequently,...”
• Diagnosis of urogenital tuberculosis by multiplex-nested PCR targeting mpt64 (Rv1980c) and IS6110: comparison with multiplex PCR and GeneXpert® MTB/RIF
  Kamra, Letters in applied microbiology 2022 (PubMed)
  • “...A multiplex-nested PCR (M-nested PCR) targeting mpt64 (Rv1980c) + IS6110 was designed to detect Mycobacterium tuberculosis (Mtb) DNA within urine (n = 35), endometrial biopsies (n = 22) and menstrual blood (n = 3) of male/female UGTB patients,...”
• Mycobacterium tuberculosis exploits MPT64 to generate myeloid-derived suppressor cells to evade the immune system
  Singh, Cellular and molecular life sciences : CMLS 2022 (PubMed)
  • “...intimidating environment of the host by taming and tuning the immune system. Mtb releases MPT64 (Rv1980c) protein in high amounts in patients with active tuberculosis (TB). Consequently, we were curious to decipher the role of MPT64 on the differentiating dendritic cells (DCs) and its relation to...”
• Molecular characterization of Mycobacterium tuberculosis through MPT64 gene polymorphism using next-generation sequencing technology
  Zamir, Future microbiology 2022 (PubMed) (secret)
• Enhanced Serum IgG Detection Potential Using 38KD-MPT32-MPT64, CFP10-Mtb81-EspC Fusion Protein and Lipoarabinomannan (LAM) for Human Tuberculosis
  Yan, Pathogens (Basel, Switzerland) 2022
  • “...found that the 38KD (antigen 5, Rv0934), MPT32 ( M. tuberculosis protein 32, Rv1860), MPT64 (Rv1980c), EspC (ESX-1 substrate protein C, Rv3615c), Mtb81 (Rv1837c), and lipoarabinomannan (LAM) antigens had relatively high frequencies of IgG detection in TB patients, and showed high specificity (9096.7%) [ 10 ]....”
• Gene evolutionary trajectories in Mycobacterium tuberculosis reveal temporal signs of selection
  Chiner-Oms, Proceedings of the National Academy of Sciences of the United States of America 2022
  • “...( A ) Cumulative pN, pS, and pN/pS trajectories over time for the mpt64 gene (Rv1980c). The x axis represents the genetic distance of each node to the root. The left y axis represents the cumulative pN (red line) and pS (blue line) values. The right...”
• A combined application of molecular docking technology and indirect ELISA for the serodiagnosis of bovine tuberculosis
  Song, Journal of veterinary science 2022
  • “...CFP-10 (gene ID: RV3874), ESAT-6 (gene ID: RV3875), HSPX (gene ID: RV2031C), MPT64 (gene ID: RV1980C), MPT70 (gene ID: RV2875), MPT83 (gene ID: RV2873), NRDF-1 (gene ID: RV1981C), PPE57 (gene ID: RV3425), PSTS1 (gene ID: RV0934), LIPC (gene ID: RV0220), RV1985C, RV1987, and RV3807C were found...”
• More

MAP3084c hypothetical protein (NCBI) from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 144:220 / 227 (33.9%), covers 97.6% of PF11738, 44.6 bits

• Early antibody response against Mycobacterium avium subspecies paratuberculosis antigens in subclinical cattle
  Bannantine, Proteome science 2008
  • “...right corner of the array (in column 12) are polyhistidine tagged proteins (MAP0087, MAP2121c and MAP3084c). The remaining 89 spots contain MBP fusion proteins of M. paratuberculosis coding sequences. Note that the MAP2121c coding sequence is represented twice on the array; once as an MBP fusion...”
• Profiling bovine antibody responses to Mycobacterium avium subsp. paratuberculosis infection by using protein arrays
  Bannantine, Infection and immunity 2008
  • “...Fig. 2A. The three polyhistidine-tagged proteins (MAP0087, MAP2121c, and MAP3084c) are present on the upper right corner of the array (Fig. 2A, column 12). Note...”

BJAB0868_02946 RsiV family protein from Acinetobacter baumannii BJAB0868
Aligns to 163:242 / 262 (30.5%), covers 85.7% of PF11738, 44.3 bits

• Complete genome analysis of three Acinetobacter baumannii clinical isolates in China for insight into the diversification of drug resistance elements
  Zhu, PloS one 2013
  • “...Dihydropteroate synthase Sulphonamides BJAB07104_p0005 BJAB0868_p0016 gyr A a DNA gyrase subunit A Fluoroquinolones BJAB07104_03067, R BJAB0868_02946, R BJAB0715_02991, R par C b Topoisomerase IV subunit A BJAB07104_00229, S BJAB0868_00235, R BJAB0715_00241, S a R: Ser-Leu mutation at 83, S: no mutation at 83; b : R:...”

MAV_4130 immunogenic protein MPT64 (NCBI) from Mycobacterium avium 104
Aligns to 154:251 / 258 (38.0%), covers 90.5% of PF11738, 44.1 bits

• Mycobacterium smegmatis Vaccine Vector Elicits CD4+ Th17 and CD8+ Tc17 T Cells With Therapeutic Potential to Infections With Mycobacterium avium
  Kannan, Frontiers in immunology 2020
  • “...The Msm espG 3 :: mpt64 was generated from Msm espG 3 by introducing mpt64 (MAV_4130) under a constitutive promoter p750 into the mycobacterial shuttle vector pDE43 ( 32 ). The bacteria were grown on 7H10 Middlebrook (Difco/Becton Dickinson) plates supplemented with 10% ADC (Difco/Becton Dickinson)....”
• Identification of Mycobacterium avium subsp. hominissuis secreted proteins using an in vitro system mimicking the phagosomal environment
  Chinison, BMC microbiology 2016
  • “...Conserved domain protein 0 1 0 3 MAV_4240 Two-component response regulator 0 1 0 3 MAV_4130 Immunogenic protein MPT64 0 0 0 3 MAV_3875 Electron transfer flavoprotein 0 0 0 3 MAV_1096 Protease 0 1 0 2 MAV_4274 PPE family protein 0 1 2 1 MAV_4077...”
• Discovery of stable and variable differences in the Mycobacterium avium subsp. paratuberculosis type I, II, and III genomes by pan-genome microarray analysis
  Castellanos, Applied and environmental microbiology 2009
  • “...described as MAV7 {42}]; INDEL12, or MAV_4125 to MAV_4130 [previously described as MAV21 {42}]; INDEL14, or MAV_4351 to MAV_4353 [dioxygenase]; and INDEL16, or...”
  • “...V . . . . MAP2443 to MAP2457c MAP2523c to MAP2529 MAP2704 MAP2767c to MAP2769c MAV_4125 to MAV_4130 . . . . . . . . . . . . . . . . . . . . . . . . . . . V V ....”

A1S_0556 hypothetical protein (RefSeq) from Acinetobacter baumannii ATCC 17978
Aligns to 169:247 / 275 (28.7%), covers 100.0% of PF11738, 43.2 bits

• Identification of a general O-linked protein glycosylation system in Acinetobacter baumannii and its role in virulence and biofilm formation
  Iwashkiw, PLoS pathogens 2012
  • “...A. baumannii ATCC 17978 749.02 2245.040 3 1214.68 31 301 AKPASTPAVKSAS 313 Putative uncharacterized protein A1S_0556 1000.47 1999.943 2 969.57 49 301 AKPASTPAVK 310 Putative uncharacterized protein A1S_0556 999.95 3996.794 4 2966.41 40 108 AAQADKKTEASAAATTEQQDSFDAQVQR 135 Putative uncharacterized protein A1S_0556 1090.53 5448.631 5 4418.21 39 203...”

BP1296 RsiV family protein from Bordetella pertussis Tohama I
NP_880063 putative lipoprotein (NCBI) from Bordetella pertussis Tohama I
Aligns to 182:261 / 275 (29.1%), covers 52.4% of PF11738, 43.1 bits

• Genomic epidemiology of Iranian Bordetella pertussis: 50 years after the implementation of whole cell vaccine
  Safarchi, Emerging microbes & infections 2019
  • “...isolates P8 (1), P9 (1) Genic (18) 10 nsSNPs: BP0082 ( bplL ), BP0724, BP1142, BP1296, BP1324 ( malA ), BP1881 ( fhaD ), BP2117, BP2467, BP3271, BP3385 Insertion: BP0192 (1), cusC (1), copA (5) 8 sSNPs: BP0222 ( catJ ), BP0454, BP1037 ( cutE ),...”
• A gel-free proteomic-based method for the characterization of Bordetella pertussis clinical isolates
  Williamson, Journal of microbiological methods 2012
  • “...29 OM 13 (2) 25 (4) 16 (4) 11 (3) Putative transport Putative lipoprotein NP_880063 BP1296 Pu 30 U 16 (3) 12 (2) 12 (2) 12 (2) U Putative lipoprotein NP_880303 BP1296 Pu 41 U 26 (5) 30 (6) 22 (5) 30 (7) Putative membrane Putative...”
• Pulsed-field gel electrophoresis, pertactin, pertussis toxin S1 subunit polymorphisms, and surfaceome analysis of vaccine and clinical Bordetella pertussis strains
  Bottero, Clinical and vaccine immunology : CVI 2007
  • “...III secretion protein Hypothetical protein BP1146 BP3441 BP2667 BP1296 BP2360 29.8 19.8 263.6 30.6 27.2 5.0 5.1 9.7 7.4 6.2 Unknown Cytoplasmic/membranec Outer...”
• A gel-free proteomic-based method for the characterization of Bordetella pertussis clinical isolates
  Williamson, Journal of microbiological methods 2012
  • “...Pu 29 OM 13 (2) 25 (4) 16 (4) 11 (3) Putative transport Putative lipoprotein NP_880063 BP1296 Pu 30 U 16 (3) 12 (2) 12 (2) 12 (2) U Putative lipoprotein NP_880303 BP1296 Pu 41 U 26 (5) 30 (6) 22 (5) 30 (7) Putative membrane...”

ABBFA_003004 hypothetical protein (RefSeq) from Acinetobacter baumannii AB307-0294
Aligns to 189:267 / 295 (26.8%), covers 100.0% of PF11738, 43.0 bits

• Polymyxin Resistance in Acinetobacter baumannii: Genetic Mutations and Transcriptomic Changes in Response to Clinically Relevant Dosage Regimens
  Cheah, Scientific reports 2016
  • “...NAD(+) synthetase 1.00 0.13 9.09E-10 ABBFA_002915 HMPREF0010_01204 33.7% Peptidase C13 family protein 0.74 0.28 1.79E-08 ABBFA_003004 HMPREF0010_01698 32.3% Hypothetical protein 1.12 0.12 1.14E-09 ABBFA_002591 HMPREF0010_01555 32.3% Protein hupE precursor 0.52 0.83 1.16E-08 ABBFA_000299 HMPREF0010_02497 30.7% Cobalt-zinc-cadmium resistance protein czcD 0.62 0.44 1.97E-07 Component 1 of the...”

TDE0098 conserved domain protein (NCBI) from Treponema denticola ATCC 35405
Aligns to 153:236 / 239 (35.1%), covers 97.6% of PF11738, 42.8 bits

• The major outer sheath protein forms distinct conformers and multimeric complexes in the outer membrane and periplasm of Treponema denticola
  Puthenveetil, Scientific reports 2017
  • “...88.4 0.00E+00 NP_972263.1 TDE1658 Basic membrane protein (SurA/PrsA) Y SpI 37.4 0.00E+00 48.6 8.70E-62 NP_970715.1 TDE0098 Hypothetical Y SpI 20.5 2.50E-80 NP_972810.1 TDE2210 Hypothetical Y SpI 13.1 2.10E-51 NP_971082.1 TDE0468 Hypothetical Y SpI 40.1 5.00E-51 NP_972660.1 TDE2058 Hypothetical Y SpI 24.3 2.00E-38 NP_972968.1 TDE2369 Hypothetical Y...”

Mjls_1842 immunogenic protein MPB64/MPT64 precursor (NCBI) from Mycobacterium sp. JLS
Aligns to 148:224 / 232 (33.2%), covers 97.6% of PF11738, 42.6 bits

• Comparative Genomics and Proteomic Analysis of Four Non-tuberculous Mycobacterium Species and Mycobacterium tuberculosis Complex: Occurrence of Shared Immunogenic Proteins
  Gcebe, Frontiers in microbiology 2016
  • “...product lipoprotein antigen family protein; dnaK: locus tag Mjls_0449, product molecular chaperone DnaK;mpt64: locus tag Mjls_1842, product immunogenic protein MPB64/MPT64; mpt70_1: locus tag Mjls_2023, product beta-Ig-H3/fasciclin; mpt70_2: locus tag Mjls_2024, product beta-Ig-H3/fasciclin; mpt70_3: locus tagMjls_4307, product beta-Ig-H3/fasciclin; Mjls_1176: locus tag Mjls_1176, product peptidase M22, glycoprotease; gcp:...”

HMPREF0010_01698 RsiV family protein from Acinetobacter baumannii ATCC 19606 = CIP 70.34 = JCM 6841
Aligns to 207:285 / 313 (25.2%), covers 98.8% of PF11738, 41.8 bits

• Polymyxin Resistance in Acinetobacter baumannii: Genetic Mutations and Transcriptomic Changes in Response to Clinically Relevant Dosage Regimens
  Cheah, Scientific reports 2016
  • “...synthetase 1.00 0.13 9.09E-10 ABBFA_002915 HMPREF0010_01204 33.7% Peptidase C13 family protein 0.74 0.28 1.79E-08 ABBFA_003004 HMPREF0010_01698 32.3% Hypothetical protein 1.12 0.12 1.14E-09 ABBFA_002591 HMPREF0010_01555 32.3% Protein hupE precursor 0.52 0.83 1.16E-08 ABBFA_000299 HMPREF0010_02497 30.7% Cobalt-zinc-cadmium resistance protein czcD 0.62 0.44 1.97E-07 Component 1 of the SPLS-DA...”

ESTR2_MYCTU / I6YF08 Esterase Rv3036c; EC 3.1.1.- from Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) (see 2 papers)
Rv3036c PROBABLE CONSERVED SECRETED PROTEIN TB22.2 (NCBI) from Mycobacterium tuberculosis H37Rv
Aligns to 144:220 / 227 (33.9%), covers 98.8% of PF11738, 41.7 bits

• function: Hydrolyzes ester substrates carbon chain lengths ranging from C2 to C14 (PubMed:25224799). In vitro, acetate (C2), butyrate (C4) and caprylate (C6) are hydrolyzed with high efficiency. Has lower activity against laurate (C12), myristate (C14) and caproate (C8), and weak activity against palmitate (C16) (PubMed:25224799).
  catalytic activity: a fatty acid ester + H2O = a fatty acid + an aliphatic alcohol + H(+) (RHEA:59388)
  catalytic activity: an acetyl ester + H2O = acetate + an aliphatic alcohol + H(+) (RHEA:12957)
  catalytic activity: a butanoate ester + H2O = an aliphatic alcohol + butanoate + H(+) (RHEA:47348)
  catalytic activity: a hexanoate ester + H2O = an aliphatic alcohol + H(+) + hexanoate (RHEA:47352)
  catalytic activity: a dodecanoate ester + H2O = an aliphatic alcohol + dodecanoate + H(+) (RHEA:47364)
  catalytic activity: a tetradecanoate ester + H2O = an aliphatic alcohol + H(+) + tetradecanoate (RHEA:47388)
  catalytic activity: an octanoate ester + H2O = an aliphatic alcohol + H(+) + octanoate (RHEA:47356)
• Comparative Analysis on Proteomics Profiles of Intracellular and Extracellular M.tb and BCG From Infected Human Macrophages
  Liu, Frontiers in genetics 2022
  • “...TB22.2, among them, TB22.2 was mostly down-regulated (five folds down) ( Table 3 ). TB22.2 (Rv3036c), as a surface-anchored esterase, may play a role in structurally modifying the cell wall composition when M.tb infection ( Trivedi et al., 2005 ). In addition, of the top 10...”
  • “...et al., 2012 ). Other interested proteins with the expression difference above fourfold contained TB22.2 (Rv3036c) and gnd1. TB22.2 was characterized as a novel cell wallanchored esterase from M.tb that can efficiently hydrolyze soluble p -nitrophenyl esters ( Chen et al., 2014 ). Gnd1 encoding 6-phosphogluconate...”
• Identification of Mycobacterium tuberculosis Antigens with Vaccine Potential Using a Machine Learning-Based Reverse Vaccinology Approach.
  Teahan, Vaccines 2021
  • “...Rv0755c PPE30 Rv1802 peptidase S1C HtrA Rv1223 PepD Rv0983 PstS PstS2 Rv0932c RsiV Hypothetical protein Rv3036c Rv3036c WXG100 EsxI Rv1037c vaccines-09-01098-t002_Table 2 Table 2 Novel Vaxign-ML-predicted PAgs having biological processes related to MTB virulence or latency. More than 72 proteins are listed here due to redundancy...”
• Structure-Aware Mycobacterium tuberculosis Functional Annotation Uncloaks Resistance, Metabolic, and Virulence Genes
  Modlin, mSystems 2021
  • “...Conserved hypothetical alanine-rich protein Rv2991 Probable flavin/deazaflavin oxidoreductase 26434506 Conserved protein Conserved protein (F420-dependent protein) Rv3036c Esterase 25224799 Probable conserved secreted protein TB22.2 Probable conserved secreted protein TB22.2 Possible membrane protein Rv3354 Protein kinase 25139900 Conserved hypothetical protein Lipoprotein Possible lipoprotein LprJ Orthogonal annotation Rv0256c* B...”
  • “...Probable membrane oxidoreductase component (MRC) DoxX RIF 26067605 Rv1184c Exported protein Mycoacyltransferase RIF 25331437, 25124040 Rv3036c Secreted protein Secreted esterase RIF, INH 25224799 Rv2190c Hypothetical protein Peptidoglycan peptidase RipC/antigen RIF 24843173, 22952680, 28241799 Rv0079 Hypothetical protein Putative dormancy-associated translation inhibitor (DATIN) RIF (+) 22719925, 23819907, 28261197...”
• Multisystem Analysis of Mycobacterium tuberculosis Reveals Kinase-Dependent Remodeling of the Pathogen-Environment Interface.
  Carette, mBio 2018
  • “...in expression of the corresponding genes. The 5 proteins with the greatest decrease in expression (Rv3036c [antigen TB22.2], Rv3668c [a predicted protease], Rv1815 [a protein of unknown function], Rv3572 [a protein of unknown function], and Rv1887 [a possible protease]) were all experimentally verified to be secreted...”
• Small-Molecule Probes Reveal Esterases with Persistent Activity in Dormant and Reactivating Mycobacterium tuberculosis
  Tallman, ACS infectious diseases 2016
  • “...active in all three culture conditions. Fluorogenic probes additionally revealed LipH (Rv1399c), Culp1 (Rv1984c), and Rv3036c esterase activity in dormant and active cultures. Esterases with persistent activity are potential diagnostic biomarkers or therapeutic targets for Mtb -infected individuals with latent or active tuberculosis. Graphical Abstract Mycobacterium...”
  • “...probes to confirm esterase functionality and to detect esterases that were missed by ABPs (e.g., Rv3036c). We propose that esterases with persistent activity in dormancy and reactivation are valuable targets for new diagnostic assays or therapeutics. RESULTS AND DISCUSSION TAMRA-FP Reveals Serine Hydrolase Activity Is Down-regulated...”
• Identification of Mycobacterium tuberculosis adherence-mediating components: a review of key methods to confirm adhesin function
  Ramsugit, Iranian journal of basic medical sciences 2016
  • “..., Rv0679c , Rv0988 , Rv1115 , Rv1116A , Rv1269c , Rv2190c , Rv2730 , Rv3036c , Rv3067 , Rv3207c , Rv3337 , Rv3491 , Rv3705c , Rv3811 , and Rv3822 Immunogenic protein Mpt64 Rv1980c Low-molecular-weight antigen CFP2 Rv2376c Major secreted immunogenic protein Mpt70 Rv2875 Mce-family...”
• PE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence
  Singh, Scientific reports 2016
  • “...starvation 30 suggests that PE11 might be required to maintain viability under nutritional stress. Interestingly, Rv3036c of M. tuberculosis was also characterized as a novel cell wall-anchored esterase that hydrolyzes soluble p -nitrophenyl acetate 47 . However, its role in mycobacterial virulence and pathogenesis is not...”
  • “...e55320 ( 2013 ). 23383323 Chen L. et al. Characterization of a novel exported esterase Rv3036c from Mycobacterium tuberculosis . Protein. Expr. Purif. 104 , 50 56 ( 2014 ). 25224799 Lun S. & Bishai W. R. Characterization of a novel cell wall-anchored protein with carboxylesterase...”
• Characterization of a novel exported esterase Rv3036c from Mycobacterium tuberculosis
  Chen, Protein expression and purification 2014 (PubMed)
  • “...esterase Rv3036c from Mycobacterium tuberculosis Protein Expression and Purification Journal 10465928 104 50 56 50-56 text/xml 2014-12-31 December 2014...”
  • “...and a predicted signal peptide, the gene rv3036c from M. tuberculosis was cloned and characterized biochemically. Rv3036c efficiently hydrolyzes soluble...”
• More

APJL_1469 hypothetical protein (RefSeq) from Actinobacillus pleuropneumoniae serovar 3 str. JL03
Aligns to 228:305 / 335 (23.3%), covers 97.6% of PF11738, 41.1 bits

• Genome-wide screening of lipoproteins in Actinobacillus pleuropneumoniae identifies three antigens that confer protection against virulent challenge
  Cao, Scientific reports 2020
  • “...APP7_1356 APJL_1380 YP_001652380.1 hypothetical protein 87.4 APL_1362 APP7_1413 APJL_1467 YP_001652463.1 hypothetical protein 42.0 APL_1435 APP7_1497 APJL_1469 YP_001652465.1 hypothetical protein 62.6 APL_1437 APP7_1495 APJL_1726 YP_001652722.1 putative ABC transporter periplasmic binding protein 53.9 APL_1694 APP7_1755 APJL_1919 YP_001652913.1 hypothetical protein 50.9 APL_1875 APP7_1963 APJL_1942 YP_001652936.1 Zn-dependent protease with chaperone...”
  • “...as hypothetical. It is worth noting that a number of hypothetical proteins (APJL_0221, APJL_1318, APJL_1380, APJL_1469, APJL_1726 and APJL_1976) yielded clearly positive reactions with rabbit anti- A. pleuropneumoniae serum in western blotting. Two hypothetical lipoproteins, APJL_1380 and APJL_1976, were selected for further investigation. On the basis...”

A1S_1734 hypothetical protein (RefSeq) from Acinetobacter baumannii ATCC 17978
Aligns to 116:203 / 224 (39.3%), covers 73.8% of PF11738, 40.0 bits

• A corepressor participates in LexA-independent regulation of error-prone polymerases in Acinetobacter
  Peterson, Microbiology (Reading, England) 2020
  • “...1.99 A1S_1319 hypothetical 1.59 * A1S_1467 put. glutamate symport transmembrane protein 1.54 A1S_1476 hypothetical 1.30 A1S_1734 hypothetical 1.31 A1S_1811 ankyrin-related protein 1.26 A1S_1924 A1S_1926 cydA , cytochrome d terminal oxidase 2.00 yes put. membrane protein 2.12 yes A1S_1927 put. acetyltransferase 1.24 * A1S_2098 put. alcohol dehydrogenase...”

S5ZKA9 Endo-1,4-beta-xylanase from Treponema pedis str. T A4
Aligns to 141:228 / 231 (38.1%), covers 54.8% of PF11738, 39.8 bits

• Phenotypic and proteomic characterization of treponemes associated with bovine digital dermatitis
  Nally, Veterinary microbiology 2019
  • “...TmpC 2749 125 TPE Sec/SPII 19 S3KLN3 95894 Uncharacterized protein 345 27 TREDN Sec/SPII 20 S5ZKA9 25431 Endo-1,4-beta-xylanase 1710 59 TPE Sec/SPI 1 As assigned by Uniprot. 2 As assigned by Mascot. 3 As assigned by Uniprot; TREPPH=T. phagedenis, TREBD=T. brennaborense, TPE=T. pedis, TREDN=T. denticola. 4...”

APP7_1495 hypothetical protein (RefSeq) from Actinobacillus pleuropneumoniae serovar 7 str. AP76
Aligns to 251:328 / 358 (21.8%), covers 97.6% of PF11738, 39.8 bits

• Genome-wide screening of lipoproteins in Actinobacillus pleuropneumoniae identifies three antigens that confer protection against virulent challenge
  Cao, Scientific reports 2020
  • “...APL_1362 APP7_1413 APJL_1467 YP_001652463.1 hypothetical protein 42.0 APL_1435 APP7_1497 APJL_1469 YP_001652465.1 hypothetical protein 62.6 APL_1437 APP7_1495 APJL_1726 YP_001652722.1 putative ABC transporter periplasmic binding protein 53.9 APL_1694 APP7_1755 APJL_1919 YP_001652913.1 hypothetical protein 50.9 APL_1875 APP7_1963 APJL_1942 YP_001652936.1 Zn-dependent protease with chaperone function 51.8 APL_1898 APP7_1985 APJL_1976 YP_001652968.1...”

MSMEG_1051 immunogenic protein MPB64/MPT64 (NCBI) from Mycobacterium smegmatis str. MC2 155
Aligns to 150:225 / 233 (32.6%), covers 96.4% of PF11738, 38.9 bits

• Functional analyses of mycobacterial lipoprotein diacylglyceryl transferase and comparative secretome analysis of a mycobacterial lgt mutant
  Tschumi, Journal of bacteriology 2012
  • “...1.31 Other and unknown function MSMEG_5617 SP MSMEG_1051 SP MSMEG_3599 Lip MSMEG_2408 MSMEG_1038 tuf (MSMEG_1401) MSMEG_0233 SP MSMEG_3528 SP MSMEG_2381...”

PDAC_BACSU / O34798 Peptidoglycan-N-acetylmuramic acid deacetylase PdaC; Peptidoglycan MurNAc deacetylase; Polysaccharide deacetylase PdaC; EC 3.5.1.- from Bacillus subtilis (strain 168) (see 2 papers)
BSU12100 secreted deoxyriboendonuclease (RefSeq) from Bacillus subtilis subsp. subtilis str. 168
Aligns to 156:235 / 467 (17.1%), covers 98.8% of PF11738, 38.8 bits

• function: Catalyzes the deacetylation of N-acetylmuramic acid (MurNAc) residues in peptidoglycan, a modification that confers resistance to lysosyme. Is not able to deacetylate N-acetylglucosamine (GlcNAc) residues in peptidoglycan, but can deacylate chitin oligomers such as GlcNAc4 and GlcNAc5. Is essentially not active toward chitosan (partially deacetylated GlcNAc polymer) and has very low activity toward chitin (GlcNAc polymer). Does not deacetylate GlcNAc.
  disruption phenotype: Cells lacking this gene show sensitivity to lysosyme, in contrast to wild-type.
• Structure-function relationships underlying the dual N-acetylmuramic and N-acetylglucosamine specificities of the bacterial peptidoglycan deacetylase PdaC
  Grifoll-Romero, The Journal of biological chemistry 2019 (secret)
• Secondary structural entropy in RNA switch (Riboswitch) identification
  Manzourolajdad, BMC bioinformatics 2015
  • “...955738 955894 forward BSU08780 ygaJ -74 0.3822 79 thiC BSU08790 0.828 57 1283149 1283305 forward BSU12100 yjeA -539 0.3758 236 yjfC BSU12130 0.827 58 3988764 3988920 reverse BSU38860 galE -1105 0.293 79 yxkD BSU38840 0.825 59 200120 200276 forward BSU01770 glmM -198 0.2611 79 glmS BSU01780...”

MMAR_1665 hypothetical protein (RefSeq) from Mycobacterium marinum M
Aligns to 141:217 / 224 (34.4%), covers 97.6% of PF11738, 38.3 bits

• A novel ESX-1 locus reveals that surface-associated ESX-1 substrates mediate virulence in Mycobacterium marinum
  Kennedy, Journal of bacteriology 2014
  • “...acid identity MMAR_1663 MMAR_1664 Rv3038c Rv3037c 87 77 MMAR_1665 MMAR_1666 MMAR_1667 Rv3036c (TB22.2) Not conserved Rv3035 79 NAb 82 MMAR_1668 Rv3034c 93...”
  • “...the genome (45), it is probable that either MMAR_1664, MMAR_1665, or both genes are required. In M. tuberculosis, the ortholog of MMAR_1664 is Rv3037c (77%...”

ACIAD1781 conserved hypothetical protein (NCBI) from Acinetobacter sp. ADP1
Aligns to 167:251 / 271 (31.4%), covers 82.1% of PF11738, 37.4 bits

• Pangenome of Acinetobacter baumannii uncovers two groups of genomes, one of them with genes involved in CRISPR/Cas defence systems associated with the absence of plasmids and exclusive genes for biofilm formation.
  Mangas, Microbial genomics 2019
  • “..., pepO , moeA_2 , kstR and five unknown genes (annotated as BIT33_04875, NT90_15810, BAV2244, ACIAD1781 and unknown126). Some of these genes are hypothetical proteins, but others, such as hdsS , are involved in a type I restriction-modification system, and together with the peptidase pepO ,...”

PP_4920 lipoprotein, putative (NCBI ptt file) from Pseudomonas putida KT2440
Aligns to 137:233 / 248 (39.1%), covers 64.3% of PF11738, 36.1 bits

• Genome-Wide Analysis of Targets for Post-Transcriptional Regulation by Rsm Proteins in Pseudomonas putida
  Huertas-Rosales, Frontiers in molecular biosciences 2021
  • “...Part of the pea operon - EPS synthesis PP_4795 Lipoprotein LptE family - LPS assembly PP_4920 Lipoprotein PdaC superfamily (polysaccharide deacetylase) PP_5083 pilM Type IV pili biogenesis protein PilM Operon 5083-5079 (type IV pili + aroK ) Hypothetical/unknown function PP_5720 Pseudogene PP_0085 Hypothetical protein YqjD/ElaB family...”

APL_1437 hypothetical protein (NCBI) from Actinobacillus pleuropneumoniae L20
Aligns to 227:305 / 335 (23.6%), covers 83.3% of PF11738, 34.9 bits

• Genome-wide screening of lipoproteins in Actinobacillus pleuropneumoniae identifies three antigens that confer protection against virulent challenge
  Cao, Scientific reports 2020
  • “...87.4 APL_1362 APP7_1413 APJL_1467 YP_001652463.1 hypothetical protein 42.0 APL_1435 APP7_1497 APJL_1469 YP_001652465.1 hypothetical protein 62.6 APL_1437 APP7_1495 APJL_1726 YP_001652722.1 putative ABC transporter periplasmic binding protein 53.9 APL_1694 APP7_1755 APJL_1919 YP_001652913.1 hypothetical protein 50.9 APL_1875 APP7_1963 APJL_1942 YP_001652936.1 Zn-dependent protease with chaperone function 51.8 APL_1898 APP7_1985 APJL_1976...”
• Effects of growth conditions on biofilm formation by Actinobacillus pleuropneumoniae
  Labrie, Veterinary research 2010
  • “...APL_1355 APL_1355 Hypothetical protein 1.716 APL_0471 APL_0471 Hypothetical protein 1.707 APL_1438 APL_1438 Hypothetical protein 1.689 APL_1437 APL_1437 Hypothetical protein 1.643 APL_1423 APL_1423 Hypothetical protein 1.612 APL_0125 APL_0125 Hypothetical protein 1.608 APL_0096 APL_0096 Zinc transporter family protein ZIP 1.592 APL_0220 APL_0220 Putative lipoprotein 1.583 APL_1934 APL_1934 Hypothetical...”
• Host-pathogen interactions of Actinobacillus pleuropneumoniae with porcine lung and tracheal epithelial cells
  Auger, Infection and immunity 2009
  • “...APL_1887 APL_1284 APL_0049 APL_0970 APL_1100 APL_1437 APL_0116 APL_0389 APL_0704 APL_1365 APL_0110 APL_1396 APL_0756 APL_0889 Gene 1438...”

HD0195 hypothetical protein (NCBI) from Haemophilus ducreyi 35000HP
Aligns to 224:304 / 332 (24.4%), covers 50.0% of PF11738, 34.2 bits

• Haemophilus ducreyi Hfq contributes to virulence gene regulation as cells enter stationary phase
  Gangaiah, mBio 2014
  • “...protein 4.41 HD1622 Conserved hypothetical protein 4.39 HD1163 ribAB Riboflavin biosynthesis protein RibA 4.38 3.5 HD0195 Hypothetical protein 4.35 4.1 HD1343 Hypothetical protein 4.29 HD0380 nqrB NADH dehydrogenase 4.26 4.3 HD1162 ribE Riboflavin synthase, alpha chain 4.11 3.7 HD1357 Conserved possible translation initiation factor 4.11 2.9...”

PFLU0494 putative lipoprotein (RefSeq) from Pseudomonas fluorescens SBW25
Aligns to 56:233 / 248 (71.8%), covers 52.4% of PF11738, 32.9 bits

• Analyzing the Complex Regulatory Landscape of Hfq - an Integrative, Multi-Omics Approach
  Grenga, Frontiers in microbiology 2017
  • “...2015 ). Flag-Tagging of Candidate SBW25 Genes C-terminal flag-tagged versions of PFLU2152, PFLU6032, PFLU0299 and PFLU0494 were produced by amplifying each gene and its upstream regulatory region with primers 1718, 1920, 2122, and 2324 respectively, from SBW25 chromosomal DNA. The resulting PCR fragments were ligated between...”

XC_2828 hypothetical protein (NCBI) from Xanthomonas campestris pv. campestris str. 8004
Aligns to 164:264 / 280 (36.1%), covers 89.3% of PF11738, 27.6 bits

• hpaR, a putative marR family transcriptional regulator, is positively controlled by HrpG and HrpX and involved in the pathogenesis, hypersensitive response, and extracellular protease production of Xanthomonas campestris pathovar campestris
  Wei, Journal of bacteriology 2007
  • “...that the nearest ORF upstream of hpaR is XC_2828, which is annotated as a "Xanthomonas conserved hypothetical protein" (40). The reverse transcription-PCR...”
  • “...(18) showed that the XC_2826 mutant 161E12 and the XC_2828 mutant NK2828 (Table 1) displayed a wild-type virulence phenotype on the cabbage Jingfeng no. 1 (data...”

MAP0087 hypothetical protein (NCBI) from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 152:224 / 238 (30.7%), covers 82.1% of PF11738, 27.6 bits

• Early antibody response against Mycobacterium avium subspecies paratuberculosis antigens in subclinical cattle
  Bannantine, Proteome science 2008
  • “...on the upper right corner of the array (in column 12) are polyhistidine tagged proteins (MAP0087, MAP2121c and MAP3084c). The remaining 89 spots contain MBP fusion proteins of M. paratuberculosis coding sequences. Note that the MAP2121c coding sequence is represented twice on the array; once as...”
• Profiling bovine antibody responses to Mycobacterium avium subsp. paratuberculosis infection by using protein arrays
  Bannantine, Infection and immunity 2008
  • “...are shown in Fig. 2A. The three polyhistidine-tagged proteins (MAP0087, MAP2121c, and MAP3084c) are present on the upper right corner of the array (Fig. 2A,...”

Or search for genetic data about PF11738 in the Fitness Browser