Family Search for PF11753 (DUF3310)

PF11753 hits 13 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

SAOUHSC_01560 hypothetical protein from Staphylococcus aureus subsp. aureus NCTC 8325
Aligns to 18:77 / 85 (70.6%), covers 98.3% of PF11753, 82.6 bits

• Functional Mapping of Phenotypic Plasticity of Staphylococcus aureus Under Vancomycin Pressure
  Yang, Frontiers in microbiology 2021
  • “...> S SAOUHSC_00544 Fibrinogen-binding protein SdrC 4 g/mL 1,496,942 15.44 M < - > L SAOUHSC_01560 Hypothetical protein 4 g/mL 1,954,079 16.08 Y < - > F SAOUHSC_02063 PV83 orf 23-like protein 4 g/mL 2,771,775 14.42 L < - > F SAOUHSC_02998 Capsular polysaccharide biosynthesis protein...”

MW1422 hypothetical protein from Staphylococcus aureus subsp. aureus MW2
Aligns to 18:77 / 85 (70.6%), covers 100.0% of PF11753, 82.0 bits

• Two different Panton-Valentine leukocidin phage lineages predominate in Japan
  Ma, Journal of clinical microbiology 2008
  • “...(558) DNA polymerase (1,962) MW1424 (186) MW1423 (402) MW1422 (258) MW1420 (243) MW1419 (255) MW1415 (534) Repressor (324) Integrase (1,206) Putative membrane...”

SA1787 hypothetical protein from Staphylococcus aureus subsp. aureus N315
Aligns to 18:77 / 85 (70.6%), covers 98.3% of PF11753, 81.6 bits

• Global transcriptome analysis of Staphylococcus aureus biofilms in response to innate immune cells
  Scherr, Infection and immunity 2013
  • “...SA1592 SA2363 SA2151 SA0024 SA0793 SA1351 SA1420 SA0031 SA1787 SA1969 SA1144 SA2459 SA2617 SA1753 SA1223 SA2138 SA0458 SA1546 SA1568 SA2180 SA0876 SA1610 SA1549...”
• Direct targets of CodY in Staphylococcus aureus
  Majerczyk, Journal of bacteriology 2010
  • “...ratio Gene group and annotationa SA1504 SA1787 Gene Genetic organizationb aroA SA1787 Expd Assignmentc 3-Phosphoshikimate 1-carboxyvinyltransferase Chorismate...”
• Characterization of the dsDNA prophage sequences in the genome of Neisseria gonorrhoeae and visualization of productive bacteriophage
  Piekarowicz, BMC microbiology 2007
  • “...32, 55% on 430 1110 NGO0486 468417468701 94 NS 1109 NGO0487 468740469234 164 hypothetical protein SA1787 [ Staphylococcus phage phiN315] 41, 51% on 58 1108 1638 NGO0488 469411469560 49 NS 1106 NGO0489 469696470241 181 Endodeoxyribo-nuclease rus [Phage 82] 34, 47% on102 (pfamRusA family) RUS Sb45 [...”
• Characterization of the Staphylococcus aureus heat shock, cold shock, stringent, and SOS responses and their effects on log-phase mRNA turnover
  Anderson, Journal of bacteriology 2006
  • “...SA1058 SA1360 SA1433 SA1434 SA1594 SA1787 2.4 7.4 2.3* Carbohydrates sa_c9528s8308_a_at sa_c8477s7437_at sa_c629s448_at sa_c2791s2362_a_at sa_c5142s4440_at...”

lin2585 lin2585 from Listeria innocua Clip11262
Aligns to 149:205 / 214 (26.6%), covers 100.0% of PF11753, 80.0 bits

• Comparative genome analysis of Listeria bacteriophages reveals extensive mosaicism, programmed translational frameshifting, and a novel prophage insertion site
  Dorscht, Journal of bacteriology 2009
  • “...AL. J. BACTERIOL. to L. innocua Clip11262 (locus tags lin2585 to lin2610) and other L. monocytogenes genomes. Many of the structural components are also related...”
• Genomic and genetic analysis of Bordetella bacteriophages encoding reverse transcriptase-mediated tropism-switching cassettes
  Liu, Journal of bacteriology 2004
  • “...to the C-terminal regions of Listeria innocua protein lin2585 (214 aa), Streptococcus pneumoniae phage MM1 Orf26, a protein in Streptococcus pyogenes phage...”

1.7 / P03781 nucleotide kinase gp1.7 from Escherichia phage T7 (see paper)
NUCK_BPT7 / P03781 Nucleotide kinase gp1.7; Gene product 1.7; Gp1.7 from Escherichia phage T7 (Bacteriophage T7) (see 3 papers)
NP_041967 nucleotide kinase from Escherichia phage T7
Aligns to 122:185 / 196 (32.7%), covers 98.3% of PF11753, 77.0 bits

• function: Nucleotide kinase that catalyzes the phosphorylation of dGMP and dTMP to dGDP and dTDP (PubMed:18599435, PubMed:20497505). A double mutation in this protein and the RecBCD inhibitor gp5.9 protein allow phage to overcome the retron Ec48 bacteriophage defense system. This protein alone when overexpressed in E.coli does not cause growth arrest; Y128C may be a silent mutation (PubMed:33157039).
  subunit: Dodecamer.
• Cryo-EM structure of the periplasmic tunnel of T7 DNA-ejectosome at 2.7 Å resolution.
  Swanson, Molecular cell 2021
  • GeneRIF: Cryo-EM structure of the periplasmic tunnel of T7 DNA-ejectosome at 2.7 A resolution.

NP_052079 1.7 protein from Yersinia phage phiYeO3-12
Aligns to 80:143 / 156 (41.0%), covers 98.3% of PF11753, 76.2 bits

• Complete genome sequence of bacteriophage vB_YenP_AP5 which infects Yersinia enterocolitica of serotype O:3
  Leon-Velarde, Virology journal 2014
  • “...100 1.26e -53 1.7 ORF11 hypothetical protein 8,392 8,871 9.38 17869.64 unknown Yersinia phage phiYeO3-12 NP_052079 84.9 7.83e -95 1.8 ORF12 hypothetical protein 8,858 8,995 5.14 5267.92 unknown Yersinia phage phiYeO3-12 NP_052080 100 2.81e -23 2 ORF13 Host RNA polymerase inhibitor 8,992 9,228 4.85 8839.87 inhibition...”

PE3_014 nucleotide kinase from Escherichia phage PE3-1
Aligns to 30:93 / 106 (60.4%), covers 98.3% of PF11753, 75.1 bits

• First Characterization of a Hafnia Phage Reveals Extraordinarily Large Burst Size and Unusual Plaque Polymorphism
  Pan, Frontiers in microbiology 2021
  • “...[ Enterococcus phage EFA-1] 95% (81/85) 7e-53 14 149 Hypothetical protein ref| YP_009044262.1| hypothetical protein PE3_014 [ Escherichia phage PE3-1] 92% (97/106) 8e-66 15 52 RNA polymerase inhibitor ref| YP_009787269.1| host RNA polymerase inhibitor [ Escherichia phage ZG49] 52/52 (100%) 3e-28 16 232 ssDNA-binding protein ref|...”

Sca_0483 hypothetical protein from Staphylococcus carnosus subsp. carnosus TM300
Aligns to 90:149 / 158 (38.0%), covers 93.2% of PF11753, 73.2 bits

• Characterization of two virulent phages of Lactobacillus plantarum
  Briggiler, Applied and environmental microbiology 2012
  • “...30) LRU_02117 (Lactobacillus ruminis SPM0211) (68/143; 48) Sca_0483 (Streptococcus carnosus TM300) (32/67; 48) ORF148 (L. plantarum phage LP65) (39/95; 41)...”

NGO0487 hypothetical protein, putative phage associated protein from Neisseria gonorrhoeae FA 1090
NGO1108 hypothetical protein, putative phage associated protein from Neisseria gonorrhoeae FA 1090
NGO1638 hypothetical protein, putative phage associated protein from Neisseria gonorrhoeae FA 1090
Aligns to 23:73 / 164 (31.1%), covers 96.6% of PF11753, 43.9 bits

• Evaluation of a Hydrogel-Based Diagnostic Approach for the Point-of-Care Based Detection of Neisseria gonorrhoeae
  Perera, Antibiotics (Basel, Switzerland) 2018
  • “...CCCAAGCTTTTCAACCGGTCC Primer16 (93bp) NGO1131, NGO1209 2 - Forward CGGAACAAGCGTTTTTCAGCG Reverse TCTTTGGCTTGTCCGGGTGT Primer 17-1 (73bp) NGO1638, NGO0487, NGO1108 3 - Forward TCCGAAACACGCAAACCGAAA Reverse TAGCCCGGGTTGGTATTGCC Primer 17-2 (82bp) NGO1638, NGO0487, NGO1108 3 - Forward ACACGCAAACCGAAACCGTC Reverse GCGCGGTTTTTGTAATAGCCC Primer 21-5 (101bp) NGO1085, NGO1652 2 - Forward GCACGAAACCCGTCCAATCC Reverse CAAGACATGCGGCTATGCGG...”
• Sequence features contributing to chromosomal rearrangements in Neisseria gonorrhoeae
  Spencer-Smith, PloS one 2012
  • “...540,223540,873 651 bp NGK_0658 & NGK_0659 518,752519,404 653 bp NGTW0519 468,565469,216 652 bp NGO0486 & NGO0487 SSREE2 1,204,3921,205,041 650 bp NGK_1449 & NGK_1450 1,119,7831,120,435 653 bp NGTW1137 1,065,6701,066,321 652 bp NGO1108 & NGO1109 SSREE3 1,605,6481,606,297 650 bp NGK_1941 & NGK_1942 1,508,4931,509,145 653 bp NGTW1542 1,597,1771,597,828 652...”
• Characterization of the dsDNA prophage sequences in the genome of Neisseria gonorrhoeae and visualization of productive bacteriophage
  Piekarowicz, BMC microbiology 2007
  • “...Pseudomona s phage D3 ] 32, 55% on 430 1110 NGO0486 468417468701 94 NS 1109 NGO0487 468740469234 164 hypothetical protein SA1787 [ Staphylococcus phage phiN315] 41, 51% on 58 1108 1638 NGO0488 469411469560 49 NS 1106 NGO0489 469696470241 181 Endodeoxyribo-nuclease rus [Phage 82] 34, 47% on102...”
• Evaluation of a Hydrogel-Based Diagnostic Approach for the Point-of-Care Based Detection of Neisseria gonorrhoeae
  Perera, Antibiotics (Basel, Switzerland) 2018
  • “...Primer16 (93bp) NGO1131, NGO1209 2 - Forward CGGAACAAGCGTTTTTCAGCG Reverse TCTTTGGCTTGTCCGGGTGT Primer 17-1 (73bp) NGO1638, NGO0487, NGO1108 3 - Forward TCCGAAACACGCAAACCGAAA Reverse TAGCCCGGGTTGGTATTGCC Primer 17-2 (82bp) NGO1638, NGO0487, NGO1108 3 - Forward ACACGCAAACCGAAACCGTC Reverse GCGCGGTTTTTGTAATAGCCC Primer 21-5 (101bp) NGO1085, NGO1652 2 - Forward GCACGAAACCCGTCCAATCC Reverse CAAGACATGCGGCTATGCGG Primer...”
• Sequence features contributing to chromosomal rearrangements in Neisseria gonorrhoeae
  Spencer-Smith, PloS one 2012
  • “...NGO0487 SSREE2 1,204,3921,205,041 650 bp NGK_1449 & NGK_1450 1,119,7831,120,435 653 bp NGTW1137 1,065,6701,066,321 652 bp NGO1108 & NGO1109 SSREE3 1,605,6481,606,297 650 bp NGK_1941 & NGK_1942 1,508,4931,509,145 653 bp NGTW1542 1,597,1771,597,828 652 bp NGO1637 & NGO1638 * Genomic base positions from the genome sequences. Coding sequences annotated...”
• Evaluation of a Hydrogel-Based Diagnostic Approach for the Point-of-Care Based Detection of Neisseria gonorrhoeae
  Perera, Antibiotics (Basel, Switzerland) 2018
  • “...Reverse CCCAAGCTTTTCAACCGGTCC Primer16 (93bp) NGO1131, NGO1209 2 - Forward CGGAACAAGCGTTTTTCAGCG Reverse TCTTTGGCTTGTCCGGGTGT Primer 17-1 (73bp) NGO1638, NGO0487, NGO1108 3 - Forward TCCGAAACACGCAAACCGAAA Reverse TAGCCCGGGTTGGTATTGCC Primer 17-2 (82bp) NGO1638, NGO0487, NGO1108 3 - Forward ACACGCAAACCGAAACCGTC Reverse GCGCGGTTTTTGTAATAGCCC Primer 21-5 (101bp) NGO1085, NGO1652 2 - Forward GCACGAAACCCGTCCAATCC Reverse...”
• Sequence features contributing to chromosomal rearrangements in Neisseria gonorrhoeae
  Spencer-Smith, PloS one 2012
  • “...1,605,6481,606,297 650 bp NGK_1941 & NGK_1942 1,508,4931,509,145 653 bp NGTW1542 1,597,1771,597,828 652 bp NGO1637 & NGO1638 * Genomic base positions from the genome sequences. Coding sequences annotated between the inverted repeat sequences. As is seen in NGO1, the NGO2 sequences of strains NCCP11945 and TCDC-NG08107 are...”

NGK_1942 putative phage associated protein from Neisseria gonorrhoeae NCCP11945
NGK_1449 putative phage associated protein from Neisseria gonorrhoeae NCCP11945
Aligns to 37:87 / 178 (28.7%), covers 96.6% of PF11753, 43.7 bits

• Sequence features contributing to chromosomal rearrangements in Neisseria gonorrhoeae
  Spencer-Smith, PloS one 2012
  • “...653 bp NGTW1137 1,065,6701,066,321 652 bp NGO1108 & NGO1109 SSREE3 1,605,6481,606,297 650 bp NGK_1941 & NGK_1942 1,508,4931,509,145 653 bp NGTW1542 1,597,1771,597,828 652 bp NGO1637 & NGO1638 * Genomic base positions from the genome sequences. Coding sequences annotated between the inverted repeat sequences. As is seen in...”
• Sequence features contributing to chromosomal rearrangements in Neisseria gonorrhoeae
  Spencer-Smith, PloS one 2012
  • “...NGK_0659 518,752519,404 653 bp NGTW0519 468,565469,216 652 bp NGO0486 & NGO0487 SSREE2 1,204,3921,205,041 650 bp NGK_1449 & NGK_1450 1,119,7831,120,435 653 bp NGTW1137 1,065,6701,066,321 652 bp NGO1108 & NGO1109 SSREE3 1,605,6481,606,297 650 bp NGK_1941 & NGK_1942 1,508,4931,509,145 653 bp NGTW1542 1,597,1771,597,828 652 bp NGO1637 & NGO1638 *...”

NGK_0659 putative phage associated protein from Neisseria gonorrhoeae NCCP11945
Aligns to 46:96 / 187 (27.3%), covers 96.6% of PF11753, 43.6 bits

• Sequence features contributing to chromosomal rearrangements in Neisseria gonorrhoeae
  Spencer-Smith, PloS one 2012
  • “...CDSs Position * Length CDSs Position * Length CDSs SSREE1 540,223540,873 651 bp NGK_0658 & NGK_0659 518,752519,404 653 bp NGTW0519 468,565469,216 652 bp NGO0486 & NGO0487 SSREE2 1,204,3921,205,041 650 bp NGK_1449 & NGK_1450 1,119,7831,120,435 653 bp NGTW1137 1,065,6701,066,321 652 bp NGO1108 & NGO1109 SSREE3 1,605,6481,606,297 650...”

O21894 SaV protein from Lactococcus phage SK1
Aligns to 4:65 / 128 (48.4%), covers 91.5% of PF11753, 37.3 bits

• Genome Characterization of Nocturne116, Novel Lactococcus lactis-Infecting Phage Isolated from Moth
  Zrelovs, Microorganisms 2021
  • “...search top hit was to a UniProt entry of SaV protein from Lactococcus phage SK1 (O21894; [ 45 ]), with a close second being to the aforementioned DUF3310 present also in CDD search. SaV protein of SK1, indeed, had an identifiable conserved DUF3310 present in its...”
  • “...presenting a better alignment of CD to SK1 query (764 aa positions of SK1 SaV (O21894) aligned to 559 aa positions of 60 aa long DUF3310, showing bit score of 40.38 and an E-value of 8.61 10 6 , according to the Pssm-ID: 403068) than the...”

SAV_BPLP2 / B6UL32 SaV protein; Gene product 26; Gp26 from Lactococcus phage p2 (Lactococcus lactis bacteriophage p2) (see paper)
Aligns to 4:65 / 128 (48.4%), covers 91.5% of PF11753, 36.9 bits

• function: Involved in the sensitivity of the virus to the host AbiV system.

Or search for genetic data about PF11753 in the Fitness Browser