Family Search for PF11816 (DUF3337)
PF11816 hits 11 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
NP_080512 WD repeat-containing protein 48 isoform 1 from Mus musculus
Aligns to 509:673 / 676 (24.4%), covers 99.4% of PF11816, 163.9 bits
D3Z8C7 WD repeat-containing protein 48 from Rattus norvegicus
Aligns to 498:662 / 665 (24.8%), covers 99.4% of PF11816, 163.2 bits
NP_001026135 WD repeat-containing protein 48 from Gallus gallus
Aligns to 510:675 / 678 (24.5%), covers 99.4% of PF11816, 162.8 bits
WDR48_HUMAN / Q8TAF3 WD repeat-containing protein 48; USP1-associated factor 1; WD repeat endosomal protein; p80 from Homo sapiens (Human) (see 17 papers)
NP_065890 WD repeat-containing protein 48 isoform 1 from Homo sapiens
Aligns to 509:674 / 677 (24.5%), covers 99.4% of PF11816, 162.0 bits
- function: Regulator of deubiquitinating complexes, which acts as a strong activator of USP1, USP12 and USP46 (PubMed:18082604, PubMed:19075014, PubMed:26388029, PubMed:31253762). Enhances the USP1- mediated deubiquitination of FANCD2; USP1 being almost inactive by itself (PubMed:18082604, PubMed:31253762). Activates deubiquitination by increasing the catalytic turnover without increasing the affinity of deubiquitinating enzymes for the substrate (PubMed:19075014, PubMed:27373336). Also activates deubiquitinating activity of complexes containing USP12 (PubMed:19075014, PubMed:27373336, PubMed:27650958). In complex with USP12, acts as a potential tumor suppressor by positively regulating PHLPP1 stability (PubMed:24145035). Docks at the distal end of the USP12 fingers domain and induces a cascade of structural changes leading to the activation of the enzyme (PubMed:27373336, PubMed:27650958). Together with RAD51AP1, promotes DNA repair by stimulating RAD51-mediated homologous recombination (PubMed:27239033, PubMed:27463890, PubMed:32350107). Binds single- stranded DNA (ssDNA) and double-stranded DNA (dsDNA) (PubMed:27239033, PubMed:31253762, PubMed:32350107). DNA-binding is required both for USP1-mediated deubiquitination of FANCD2 and stimulation of RAD51- mediated homologous recombination: both WDR48/UAF1 and RAD51AP1 have coordinated role in DNA-binding during these processes (PubMed:31253762, PubMed:32350107). Together with ATAD5 and by regulating USP1 activity, has a role in PCNA-mediated translesion synthesis (TLS) by deubiquitinating monoubiquitinated PCNA (PubMed:20147293). Together with ATAD5, has a role in recruiting RAD51 to stalled forks during replication stress (PubMed:31844045).
function: (Microbial infection) In case of infection by Herpesvirus saimiri, may play a role in vesicular transport or membrane fusion events necessary for transport to lysosomes. Induces lysosomal vesicle formation via interaction with Herpesvirus saimiri tyrosine kinase- interacting protein (TIP). Subsequently, TIP recruits tyrosine-protein kinase LCK, resulting in down-regulation of T-cell antigen receptor TCR. May play a role in generation of enlarged endosomal vesicles via interaction with TIP (PubMed:12196293). In case of infection by papillomavirus HPV11, promotes the maintenance of the viral genome via its interaction with HPV11 helicase E1 (PubMed:18032488).
subunit: Interacts with USP46 (PubMed:19075014, PubMed:26388029). Interacts with USP1 (PubMed:18082604, PubMed:26388029). Interacts with USP12 (PubMed:19075014, PubMed:27373336, PubMed:27650958). Component of the USP12-WDR20-WDR48 deubiquitinating complex (PubMed:27373336). Component of the USP12/DMWD/WDR48 deubiquitinating complex (PubMed:33844468). Interacts with PHLPP1 (PubMed:24145035). Interacts with RAD51AP1; the interaction is direct and promotes formation of a trimeric complex with RAD51 via RAD51AP1 (PubMed:27239033, PubMed:27463890). Interacts with ATAD5; the interaction regulates USP1- mediated PCNA deubiquitination (PubMed:20147293). Interacts with RAD51; the interaction is enhanced under replication stress (PubMed:31844045).
subunit: (Microbial infection) Interacts with papillomavirus HPV11 E1 protein.
subunit: (Microbial infection) Interacts with Saimiriine herpesvirus TIP protein.
subunit: (Microbial infection) Interacts with human cytomegalovirus protein UL138.
subunit: (Microbial infection) Interacts with Epstein-Barr virus protein EBNA3. - The UAF1-USP1 Deubiquitinase Complex Stabilizes cGAS and Facilitates Antiviral Responses.
Yu, Journal of immunology (Baltimore, Md. : 1950) 2024 (PubMed)- GeneRIF: The UAF1-USP1 Deubiquitinase Complex Stabilizes cGAS and Facilitates Antiviral Responses.
- USP1-WDR48 deubiquitinase complex enhances TGF-β induced epithelial-mesenchymal transition of TNBC cells via stabilizing TAK1.
Han, Cell cycle (Georgetown, Tex.) 2021 - GeneRIF: USP1-WDR48 deubiquitinase complex enhances TGF-beta induced epithelial-mesenchymal transition of TNBC cells via stabilizing TAK1.
- Structural basis of FANCD2 deubiquitination by USP1-UAF1.
Rennie, Nature structural & molecular biology 2021 (PubMed)- GeneRIF: Structural basis of FANCD2 deubiquitination by USP1-UAF1.
- The DNA-binding activity of USP1-associated factor 1 is required for efficient RAD51-mediated homologous DNA pairing and homology-directed DNA repair.
Liang, The Journal of biological chemistry 2020 - GeneRIF: The DNA-binding activity of USP1-associated factor 1 is required for efficient RAD51-mediated homologous DNA pairing and homology-directed DNA repair.
- ATAD5 suppresses centrosome over-duplication by regulating UAF1 and ID1.
Kim, Cell cycle (Georgetown, Tex.) 2020 - GeneRIF: ATAD5 suppresses centrosome over-duplication by regulating UAF1 and ID1.
- Interaction of the Human Papillomavirus E1 Helicase with UAF1-USP1 Promotes Unidirectional Theta Replication of Viral Genomes.
Orav, mBio 2019 - GeneRIF: In this report, the authors provide evidence that the previously described interaction between the viral E1 helicase and the cellular UAF1-USP1 deubiquitinating enzyme complex is required for the completion of the bidirectional theta replication of the human papilloma virus type 11 genome and the subsequent initiation of the unidirectional replication.
- The Role of the Complex USP1/WDR48 in Differentiation and Proliferation Processes in Cancer Stem Cells.
Goncalves, Current stem cell research & therapy 2017 (PubMed)- GeneRIF: There is evidence that USP1/WDR48 complex promotes cancer stem cell conservation and regulation of DNA damage repair. [REVIEW]
- USP1-UAF1 deubiquitinase complex stabilizes TBK1 and enhances antiviral responses.
Yu, The Journal of experimental medicine 2017 - GeneRIF: These results outline a novel mechanism for the control of TBK1 activity and suggest USP1-UAF1 complex as a potential target for the prevention of viral diseases.
- More
- Screening and identification of endometrial proteins as novel potential biomarkers for repeated implantation failure.
Wang, PeerJ 2021 - “...E3A 0.58 P43403 ZAP70 Tyrosine-protein kinase ZAP-70 0.59 P46781 RS9 40S ribosomal protein S9 0.59 Q8TAF3 WDR48 WD repeat-containing protein 48 0.60 Q8N4H5 TOM5 Mitochondrial import receptor subunit TOM5 homolog 0.60 P08729 K2C7 Keratin, type II cytoskeletal 7 0.61 Q07020 RL18 60S ribosomal protein L18 0.62...”
- Lysosomal perturbations in human dopaminergic neurons derived from induced pluripotent stem cells with PARK2 mutation.
Okarmus, Scientific reports 2020 - “...4A 0.83 0.036 8 P86790 CCZ1B Vacuolar fusion protein CCZ1 homolog B 0.82 0.020 3 Q8TAF3 WDR48 WD repeat-containing protein 48 0.81 0.042 8 O14964 HGS Hepatocyte growth factor-regulated tyrosine kinase substrate 0.79 0.015 5 P61073 CXCR4 C-X-C chemokine receptor type 4 0.79 0.016 3 O43237...”
- PTMs in conversation: activity and function of deubiquitinating enzymes regulated via post-translational modifications.
Kessler, Cell biochemistry and biophysics 2011 - “...86 , 92 , 93 ] Lys408 [ 114 ] Lys870 (Ub) [ 110 ] Q8TAF3 WDR48_HUMAN WD repeat-containing protein 48 (WD repeat endosomal protein) (USP1-associated factor 1) (p80) 677 Lys121, Lys214, Lys578 [ 114 ] Q9UGI0 ZRAN1_HUMAN Ubiquitin thioesterase ZRANB1 (zinc finger Ran-binding domain-containing protein...”
BU107_SCHPO / Q09731 UBP9-binding protein bun107; Binding ubp9 protein of 107 kDa from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see paper)
SPAC31A2.14 WD repeat protein, human WRDR48 family from Schizosaccharomyces pombe
Aligns to 798:945 / 962 (15.4%), covers 98.8% of PF11816, 151.8 bits
- function: Required for the ubp9 recruitment to septa and cell tips but also for its enzymatic activity at these specific locations.
subunit: Interacts with ubp9 and bun62. - A global census of fission yeast deubiquitinating enzyme localization and interaction networks reveals distinct compartmentalization profiles and overlapping functions in endocytosis and polarity
Kouranti, PLoS biology 2010 - “...105 kDa. Third, Ubp9 co-purifies two nonessential WD repeatcontaining proteins encoded by the chromosomal loci SPAC31A2.14 (8 WD repeats, 107 kDa) and SPAC12B10.03 (6 WD repeats, 62 kDa). We named these two proteins Bun107 and Bun62 for binding Ubp9 of 107 and 62 kDa, respectively. Lastly,...”
- “...http://old.genedb.org/genedb/pombe/ ) accession numbers for the previously unnamed proteins discussed in this paper are Bun107, SPAC31A2.14; Bun62, SPAC12B10.03, Ecm29, SPAC1782.01; Ftp105, SPAC17A5.16; Rpn1301, SPBC342.04; Rpn1302, SPCC16A11.16c; and Sfp47, SPAC7D4.02c. All the DUB UniProt accession numbers are provided in Table 1 , and all DUB and interactor...”
Q7PXD9 WD repeat-containing protein 48 homolog from Anopheles gambiae
Aligns to 537:706 / 709 (24.0%), covers 99.4% of PF11816, 146.9 bits
WDR48_CAEEL / Q20059 WD repeat-containing protein 48 homolog from Caenorhabditis elegans (see paper)
Aligns to 530:681 / 683 (22.3%), covers 99.4% of PF11816, 135.1 bits
- function: Together with wdr-20, binds to and stimulates the activity of the deubiquitinating enzyme usp-46, leading to deubiquitination and stabilization of the glr-1 glutamate receptor.
subunit: Interacts with usp-46; the interaction increases the catalytic activity of usp-46 in the presence of wdr-20.
disruption phenotype: Changed locomotion behavior with mutants displaying decreased reversal frequencies consistent with decreased glutamergic signaling.
NP_497931 WD repeat-containing protein 48 homolog from Caenorhabditis elegans
Aligns to 530:678 / 680 (21.9%), covers 99.4% of PF11816, 134.2 bits
DUF1_YEAST / Q99247 DUB-associated factor 1 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 4 papers)
YOL087C Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm; deletion mutant is sensitive to various chemicals including phenanthroline, sanguinarine, and nordihydroguaiaretic acid from Saccharomyces cerevisiae
Aligns to 876:1099 / 1116 (20.1%), covers 82.0% of PF11816, 109.7 bits
- function: Ubiquitin-binding protein involved in the resistance to phenanthroline, sanguinarine, nordihydroguaiaretic acid (NDGA), isopropyl (N-3-chloro-phenyl)-carbamate (IPCPC) and guanosine 5'-O-(2- thiodiphosphate).
subunit: Interacts (via its WD repeats) with ubiquitin. - Genome-Wide Identification of Cellular Pathways and Key Genes That Respond to Sodium Bicarbonate Stress in Saccharomyces cerevisiae
Cao, Frontiers in microbiology 2022 - “...0.49761 0.00015 0.48975 0.00015 0.54929 0.00015 PHO81 YGR233C 0.58694 0 0.4714 0.00003 0.44746 0.00003 DUF1 YOL087C 0.47937 0.00006 0.41218 0.00004 0.60865 0.00014 MNN10 YDR245W 0.51543 0.00096 0.46468 0.00194 0.51503 0.00096 SLT2 YHR030C 0.78787 0.00023 0.84749 0.00053 0.6906 0.00053 RVS161 YCR009C 0.73636 0.00133 0.74711 0.00002 0.81866 0.00002...”
- Comparative genomic analysis of clinical Candida glabrata isolates identifies multiple polymorphic loci that can improve existing multilocus sequence typing strategy
Arastehfar, Studies in mycology 2021 - “...CCW14 YLR390W-A H09053/ CAGL0H09152g 1 PTK1 YKL198C PIR2/ CAGL0I06182g SHP150 YJL159W I07645/ CAGL0I07821g 1 DUF1 YOL087C K01793/ CAGL0K01947g YER137C YER137C K06501/ CAGL0K06655g NGR1 YBR212W K09845/ CAGL0K10010g PRP8 YDR083W PIR3/ CAGL0M08492g 1 PIR1 YKL164C M09053/ CAGL0M09086g BUD4 YJR092W M09075/ CAGL0M09108g JSN1 YJR091C GVI51_A02255/ CAGL0A02486g 1 SEB2 YDR351W...”
- Heme, A Metabolic Sensor, Directly Regulates the Activity of the KDM4 Histone Demethylase Family and Their Interactions with Partner Proteins
Konduri, Cells 2020 - “...DDX19B, DDX25 + DLD3 YEL071W 6320764 D-2-hydroxyglutarate--pyruvate transhydrogenase AGPS, D2HGDH, LDHD + + + DUF1 YOL087C 6324485 Uncharacterized WD repeat-containing protein WDR48 ERG11 YHR007C 6321795 Lanosterol 14-alpha-demethylase CYP51A1 + + + GAL83 YER027C 6320865 One of three possible beta-subunits of the Snf1 kinase complex PRKAB1, PRKAB2...”
- The protein transportation pathway from Golgi to vacuoles via endosomes plays a role in enhancement of methylmercury toxicity
Hwang, Scientific reports 2014 - “...YJL120W YJL120W Unknown function 0.52 YLL014W YLL014W Unknown function 0.71 YLR111W YLR111W Unknown function 0.78 YOL087C YOL087C Unknown function 0.55...”
- Genome-wide identification of the Fermentome; genes required for successful and timely completion of wine-like fermentation by Saccharomyces cerevisiae
Walker, BMC genomics 2014 - “...absent in LIT_FRYG FEGs absent in SGD_FRYG FEGs absent in LIT_FRYG and SGD_FRYG DUF1 ( YOL087C ) HRK1 ( YOR267C ) CCZ1 ( YBR131W ) GPA2 ( YER020W ) CYK3 ( YDL117W ) ATG7 ( YHR171W ) NHX1 ( YDR456W ) HXK1 ( YFR053C ) OPI1...”
- The RNA polymerase II C-terminal domain-interacting domain of yeast Nrd1 contributes to the choice of termination pathway and couples to RNA processing by the nuclear exosome
Heo, The Journal of biological chemistry 2013 - “...MHF1 transcription level is as low as the adjacent YOL087C gene (42) and only a nearbackground Ser(P)-5 signal was detected (43). Instead, it is apparently due...”
- A deubiquitylating complex required for neosynthesis of a yeast mitochondrial ATP synthase subunit
Kanga, PloS one 2012 - “...days at 30C and 37C. Ubp9 and Ubp13 have both been reported to interact with Yol087c (Duf1, DUB-associated Factor 1) in large-scale proteome studies [31] , [32] . Duf1 is a 125 kDa protein, a homolog of Bun107 from S. pombe and a distant homolog of...”
- Diploid-specific [corrected] genome stability genes of S. cerevisiae: genomic screen reveals haploidization as an escape from persisting DNA rearrangement stress
Alabrudzinska, PloS one 2011 - “...YLR414C, YML079W, YML090W, YML131W, YMR111C, YMR185W, YMR194C-A, YMR206W, YMR279C, YNL046W, YNL086W, YNL140C, YNL143C, YNR065C, YOL079W, YOL087C, YOR139C, YOR304C-A, YPL238C genome integrity 42 cell cycle control: BFA1, CDC16, HSL7, MAD1, NDD1, VHS1 cell division: AKL1, BUD3, DDC1, DOM34, IML3, MCD1, LGE1, MPS3 chromatin maintenance: ELF1, RLF2, RSC4,...”
- More
Q93ZS6 AT3g05090/T12H1_5 from Arabidopsis thaliana
AT3G05090 transducin family protein / WD-40 repeat family protein from Arabidopsis thaliana
Aligns to 593:749 / 753 (20.8%), covers 77.9% of PF11816, 95.0 bits
- Selective autophagy: adding precision in plant immunity
Leong, Essays in biochemistry 2022 - “...proven + Q94JZ8 PUX7_ARATH Plant UBX domain-containing protein 7 (PUX7) PUX7 468 AT1G14570 UIM/UBA/UBX + Q93ZS6 Q93ZS6_ARATH AT3g05090/T12H1_5 (Transducin/WD40 repeat-like superfamily protein) (Uncharacterized protein At3g05090) LRS1 753 AT3G05090 WD40 Q8W4Q5 RIN3_ARATH E3 ubiquitin protein ligase RIN3 (EC 2.3.2.27) (RING-type E3 ubiquitin transferase RIN3) (RPM1-interacting protein 3)...”
- Identification of mitogen-activated protein kinases substrates in Arabidopsis using kinase client assay
Bahk, Plant signaling & behavior 2024 - “...AAEEEFS*TPPSSPVFHDAK 50 S(7): 88.4; T(8): 11.2 10 At3g19330 VASTSRNDASISSPTFNLS*R 48 T(15): 0.4; S(19): 95.3 11 At3g05090 KTVFQRGGS*FLAGNLS*F 38 S(9): 99.8; S(16): 100.0 12 At4g30480 IES*SES*EDEILIKNEPK 32 S(3): 79.4; S(6): 93.4 13 At4g39680 EAQITNSATPT*T*T*PRSTGL 28 T(11): 52.1; T(12): 63.5; T(13): 59.0 14 At1g73980 LS*LDDDTVSSPKEALSRASV 25 S(2): 87.4;...”
- “...9 At3g04470 Ankyrin repeat family protein + Plasma membrane 10 At3g19330 DUF677 + Nucleus 11 At3g05090 Lateral root stimulator + Nucleus 12 At4g30480 AtTPR1 + Cytosol 13 At4g39680 SAP domain-containing protein ++ Nucleus Hoehenwarter et al. 2013 18 14 At1g73980 Phosphoribulokinase ++ Cytosol 15 At2g21150 XAP5...”
- Genome-Wide Identification of WD40 Proteins in Cucurbita maxima Reveals Its Potential Functions in Fruit Development
Chen, Genes 2023 - “...defects in both embryo and seedling development [ 57 ]. The mutants of LRS1 ( AT3G05090 ) show defects in lateral root development and affect the auxin accumulation during lateral root primordium development and meristem emergence [ 58 ]. Interestingly, these genes were grouped in the...”
- Selective autophagy: adding precision in plant immunity
Leong, Essays in biochemistry 2022 - “...(PUX7) PUX7 468 AT1G14570 UIM/UBA/UBX + Q93ZS6 Q93ZS6_ARATH AT3g05090/T12H1_5 (Transducin/WD40 repeat-like superfamily protein) (Uncharacterized protein At3g05090) LRS1 753 AT3G05090 WD40 Q8W4Q5 RIN3_ARATH E3 ubiquitin protein ligase RIN3 (EC 2.3.2.27) (RING-type E3 ubiquitin transferase RIN3) (RPM1-interacting protein 3) RIN3 577 AT5G51450 CUE Q8W4F0 DAR1_ARATH Protein DA1-related 1...”
- Unraveling Reticulate Evolution in Opuntia (Cactaceae) From Southern Mexico
Granados-Aguilar, Frontiers in plant science 2020 - “...Caryophyllales genes that matched with at least two Cactaceae genomes. Five candidate genes were recovered, AT3G05090 , AT4G24040 , AT3G48380 , AT1G18270 , and AT1G36980 (names based on the A. thaliana annotation). Additional Cactaceae species coding sequences from these five genes were mined from oneKP 2...”
- “...intron-flanking exons from selected genes. Gene Primer ID Forward sequence 53 Reverse sequence 53 Tested AT3G05090 a TGACGGGACATTGAAGAGG GTGGCTCCAGTTTCTAAGTC Yes b TAGCTACTTGCTCCGCTAC GTCTAGGTGGGGAGGTTTT No c GGGCTTCTCTTGAAGGATCTAC GTGGTGATTCAAGATTATGGCG No AT4G24040 a AGAAATCTCTTCCTGCTCTAC GACAACATTGGCTACTACATC Yes b AATGGTGCCAGAGCTTATTAC AGAAATCTCTTCCTGCTCTAC No c GACAACATTGGCTACTACATC GTTTGTGCTGCTGGGATTGC No AT3G48380 a GTCTTACACCCRGTATCARTT TATTGCATCTCTGGTTCAAGG Yes...”
- Rational association of genes with traits using a genome-scale gene network for Arabidopsis thaliana
Lee, Nature biotechnology 2010 - “...development genes. By interrogating network neighborhoods, we identify At1g80710 (now Drought sensitive 1; Drs1) and At3g05090 (now Lateral root stimulator 1; Lrs1) as novel regulators of drought sensitivity and lateral root development, respectively. AraNet ( http://www.functionalnet.org/aranet/ ) provides a global resource for plant gene function identification...”
- “...biological roles for 4,479 previously uncharacterized genes. We selected three uncharacterized genes (At1g80710, At2g17900, and At3g05090) based on several criteria: 1) no known biological process assigned; 2) predicted by AraNet to be involved in developmental regulatory processes; and 3) exist as single copy genes. These represent...”
F6HTW0 Uncharacterized protein from Vitis vinifera
Aligns to 607:763 / 802 (19.6%), covers 75.6% of PF11816, 89.6 bits
- Relative quantification of phosphoproteomic changes in grapevine (Vitis vinifera L.) leaves in response to abscisic acid
Rattanakan, Horticulture research 2016 - “...pyruvate dehydrogenase complex (D7TZW9), a Nck-associated protein 1 (D7T9L3) involved in actin remodeling, a component (F6HTW0) of the Cul4-RING E3 ubiquitin ligase complex, a DNA/RNA helicase (F6GT26), a protein involved in stability of Photosystem II (F6HVA4), a eukaryotic translation initiation factor (F6I2I6) and a ribosomal protein...”
- “...P value Peptide sequence Variable modification VIT_14s0066g01120 F6HUY8 Tudor/PWWP/MBTsuperfamilyprotein 1.59 1.12E04 GNEAESHVVNSNLAsPR S526 Phospho VIT_14s0030g01350 F6HTW0 Transducin/WD40 repeat-like superfamily protein 1.66 6.69E04 VGSAGNTSNsTRPR S18 Phospho VGSAGNTSNsTRPR S20 Phospho VIT_17s0000g06950 F6GT26 RNA helicase family protein 1.24 6.51E03 TSQDEDDDsELEEESLRDR S173 Phospho VITISV_031115 A5AI30 Ribosomal protein S21 family protein...”
Or search for genetic data about PF11816 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory