Family Search for PF11938 (DUF3456)
PF11938 hits 33 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
CNPY1_DANRE / Q2L6L1 Protein canopy-1; Protein D121 from Danio rerio (Zebrafish) (Brachydanio rerio) (see paper)
NP_001034586 protein canopy-1 precursor from Danio rerio
Aligns to 31:177 / 187 (78.6%), covers 100.0% of PF11938, 161.0 bits
Q1LZ72 Canopy 2 homolog (Zebrafish) from Bos taurus
Aligns to 27:171 / 182 (79.7%), covers 100.0% of PF11938, 160.1 bits
CNPY2_HUMAN / Q9Y2B0 Protein canopy homolog 2; MIR-interacting saposin-like protein; Putative secreted protein Zsig9; Transmembrane protein 4 from Homo sapiens (Human) (see paper)
NP_055070 protein canopy homolog 2 isoform 1 precursor from Homo sapiens
Aligns to 27:171 / 182 (79.7%), covers 100.0% of PF11938, 159.8 bits
- function: Positive regulator of neurite outgrowth by stabilizing myosin regulatory light chain (MRLC). It prevents MIR-mediated MRLC ubiquitination and its subsequent proteasomal degradation
subunit: Interacts with MYLIP/MIR. - Proteomic analysis of the umbilical cord in fetal growth restriction and preeclampsia.
Conrad, PloS one 2022 - “...Cadherin-1 3.05 Q99542 Matrix metalloproteinase-19 3.20 Q8IVL6 Prolyl 3-hydroxylase 3 3.35 P16144 Integrin beta-4; 3.36 Q9Y2B0 Protein canopy homolog 2 3.41 Q9Y240 C-type lectin domain family 11 member A; 3.47 Q16787 Laminin subunit alpha-3 3.50 Q02487 Desmocollin-2 3.69 P32926 Desmoglein-3 4.39 P47929 Lectin, galactoside-binding, soluble, 7B;...”
- Proteins involved in the endoplasmic reticulum stress are modulated in synovitis of osteoarthritis, chronic pyrophosphate arthropathy and rheumatoid arthritis, and correlate with the histological inflammatory score.
de, Scientific reports 2020 - “...P68366 Tubulin alpha-4A chain 24 0.68 0.0002 PMM2 O15305 Phosphomannomutase 2 20 0.68 0.0009 CNPY2 Q9Y2B0 Protein canopy homolog 2 24 0.68 0.0003 PTPRC P08575 Receptor-type tyrosine-protein phosphatase C 23 0.68 0.0004 S100A9 P06702 Protein S100-A9 24 0.68 0.0003 LMAN1 P49257 Protein ERGIC-53 24 0.68 0.0003...”
- Proteomic analysis reveals dysregulated cell signaling in ejaculated spermatozoa from infertile men.
Samanta, Asian journal of andrology 2019 - “...isoform 1 P62913 20 15.7 7.3 0.0 0.0 Protein canopy homolog 2 isoform 1 precursor Q9Y2B0 21 15.3 7.3 4.0 0.0 Translocon-zassociated protein subunit alpha precursor P43307 32 15.3 12.0 8.0 7.7 60S ribosomal protein L22 proprotein P35268 15 15.0 8.3 4.0 1.3 Cysteinyl-tRNA synthetase, cytoplasmic...”
- Comparative proteomic analysis of normal and gliotic PVR retina and contribution of Müller glia to this profile
Eastlake, Experimental eye research 2018 - “...75 MISC Translocon associated protein subunit delta P51571 4 2.17 256 Protein canopy homolog 2 Q9Y2B0 2 6.83 354 Fig. 2 Proteins upregulated in the gliotic retina are among the 30 most abundant proteins expressed by Muller glia . Venn diagram shows the proteins upregulated in...”
- A novel liver metastasis-correlated protein of pancreatic neuroendocrine neoplasm (PanNEN) discovered by proteomic analysis.
Shimura, Oncotarget 2018 - “...tumor P08133 ANXA6 2.2 GTP binding; calcium-dependent phospholipid binding; calcium-dependent protein binding etc. No hits Q9Y2B0 CNPY2 2.2 Protein binding No hits P68431 HIST1H3A 2.1 Cadherin binding; histone binding; nucleosomal DNA binding; protein binding Transcriptional misregulation in cancer; Alcoholism; Systemic lupus erythematosus Q15691 MAPRE1 2.3 RNA...”
- Annexin A2 and FTH1 are potential biomarkers for lupus nephritis.
Zhou, Experimental and therapeutic medicine 2018 - “...protein subunit delta P51571 19157.7 5.76 99.996 1.19 1.67 1.4 3167 Protein canopy homolog 2 Q9Y2B0 20981.3 4.81 99.932 1.84 1.6 1.15 3288 Eukaryotic translation initiation factor 5A-1 P63241 17291.9 5.76 95.725 2.26 2.5 1.1 3294 Stathmin P16949 17291.9 5.76 95.725 2.26 2.5 1.1 3411 Mucin-16...”
- All-Trans-Retinoic Acid Enhances Mitochondrial Function in Models of Human Liver.
Tripathy, Molecular pharmacology 2016 - Quantitative Proteomics and Lipidomics Analysis of Endoplasmic Reticulum of Macrophage Infected with Mycobacterium tuberculosis
Saquib, International journal of proteomics 2015 - “...Unfold protein response 14 Q6PJF5 RHBDF2 Inactive rhomboid protein 2 0.0121 0.3839 TNF- signaling 15 Q9Y2B0 CNPY2 Protein canopy homolog 2 0.0121 0.3839 Cholesterol homeostasis 16 Q9Y4L1 HYOU1 Hypoxia upregulated protein 1 0.1393 0.3839 Cytoprotective role 17 Q15436 SC23A Protein transport protein Sec23A 0.0121 0.3839 Transportation...”
- More
- Sleeping Beauty insertional mutagenesis screen identifies the pro-metastatic roles of CNPY2 and ACTN2 in hepatocellular carcinoma tumor progression.
Lo, Biochemical and biophysical research communications 2021 (PubMed)- GeneRIF: Sleeping Beauty insertional mutagenesis screen identifies the pro-metastatic roles of CNPY2 and ACTN2 in hepatocellular carcinoma tumor progression.
- Hypoxia-induced CNPY2 upregulation promotes glycolysis in cervical cancer through activation of AKT pathway.
Tian, Biochemical and biophysical research communications 2021 (PubMed)- GeneRIF: Hypoxia-induced CNPY2 upregulation promotes glycolysis in cervical cancer through activation of AKT pathway.
- miR‑30a‑3p suppresses the proliferation and migration of lung adenocarcinoma cells by downregulating CNPY2.
Wang, Oncology reports 2020 (PubMed)- GeneRIF: miR30a3p suppresses the proliferation and migration of lung adenocarcinoma cells by downregulating CNPY2.
- Knockout of Canopy 2 activates p16INK4a pathway to impair cardiac repair.
Yin, Journal of molecular and cellular cardiology 2019 (PubMed)- GeneRIF: Knockout of Cnpy2 resulted in up-regulation of p16(INK4a).
- The CNPY2 enhances epithelial-mesenchymal transition via activating the AKT/GSK3β pathway in non-small cell lung cancer.
Dou, Cell biology international 2018 (PubMed)- GeneRIF: Overexpression of CNPY2 can activate the AKT/GSK3beta pathway, which leads to the inactivation of GSK-3beta. The inactivation of GSK-3beta increases the level of Snail, and then decreases the expression of E-cadherin to promote EMT.
- CNPY2 enhances resistance to apoptosis induced by cisplatin via activation of NF-κB pathway in human non-small cell lung cancer.
Yu, Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 2018 (PubMed)- GeneRIF: CNPY2 can serve as a therapeutic target to promote the effect of chemotherapy in non-small cell lung cancer.
- Serum CNPY2 isoform 2 represents a novel biomarker for early detection of colorectal cancer.
Peng, Aging 2018 - GeneRIF: This study showed that serum CNPY2 isoform 2 may be a valuable biomarker for the early detection of colorectal cancer and presents an improvement in the diagnostic efficiency by combination of CEA and CA19-9.
- Canopy Homolog 2 Expression Predicts Poor Prognosis in Hepatocellular Carcinoma with Tumor Hemorrhage.
Wang, Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 2018 (PubMed)- GeneRIF: CNPY2 knockout resulted in the significant suppression of MHCC97H cell proliferation, tumor growth, and hemorrhage.
- More
XP_006513965 protein canopy homolog 2 isoform X2 from Mus musculus
Q9QXT0 Protein canopy homolog 2 from Mus musculus
Aligns to 27:171 / 182 (79.7%), covers 100.0% of PF11938, 159.5 bits
- The role of CNPY2 in endothelial injury and inflammation during the progress of atherosclerosis.
Huang, Journal of molecular histology 2023 (PubMed)- GeneRIF: The role of CNPY2 in endothelial injury and inflammation during the progress of atherosclerosis.
- Canopy Homolog 2 contributes to liver oncogenesis by promoting unfolded protein response-dependent destabilization of tumor protein P53.
Hong, Hepatology (Baltimore, Md.) 2022 (PubMed)- GeneRIF: Canopy Homolog 2 contributes to liver oncogenesis by promoting unfolded protein response-dependent destabilization of tumor protein P53.
- CNPY2 is a key initiator of the PERK-CHOP pathway of the unfolded protein response.
Hong, Nature structural & molecular biology 2017 - GeneRIF: Free CNPY2 then engages protein kinase R-like endoplasmic reticulum kinase (PERK) to induce expression of the transcription factor C/EBP homologous protein (CHOP), thereby initiating the unfolded protein response.
- Fine-tuning PERK signaling to control cell fate under stress.
Urra, Nature structural & molecular biology 2017 (PubMed)- GeneRIF: Sustained PERK activation can amplify PERK signaling by further enhancing CNPY2 expression via direct transactivation through CHOP.
- Decreasing CNPY2 Expression Diminishes Colorectal Tumor Growth and Development through Activation of p53 Pathway.
Yan, The American journal of pathology 2016 (PubMed)- GeneRIF: CNPY2 may play a critical role in colorectal cancer development by enhancing cell proliferation, migration, and angiogenesis and by inhibiting apoptosis through negative regulation of the p53 pathway
- A secreted protein (Canopy 2, CNPY2) enhances angiogenesis and promotes smooth muscle cell migration and proliferation.
Guo, Cardiovascular research 2015 (PubMed)- GeneRIF: CNPY2 is a HIF-1alpha-regulated, secreted angiogenic growth factor that promotes smooth muscle cell migration, proliferation, and tissue revascularization.
- Expression of CNPY2 in mouse tissues: quantification and localization.
Hatta, PloS one 2014 - GeneRIF: The data demonstrate CNPY2 is widely distributed in tissues and suggest the protein has biological functions that have yet to be identified.
- The amyloid peptide β disrupts intercellular junctions and increases endothelial permeability in a NADPH oxidase 1-dependent manner.
Tarafdar, Redox biology 2022 - “...Plxna1 0.001259489 Q3UHB8 Coiled-coil domain-containing protein 177 Ccdc177 0.002273706 Q60598 Src substrate cortactin Cttn 0.002443861 Q9QXT0 Protein canopy homolog 2 Cnpy2 0.00260753 P61027 Ras-related protein Rab-10 Rab10 0.003205837 Q9D1D4 Transmembrane emp24 domain-containing protein 10 Tmed10 0.003931995 Q7TQD2 Tubulin polymerization-promoting protein Tppp 0.003942978 O35382 Exocyst complex component...”
- Characterization of hyperglycemia due to sub-chronic administration of red ginseng extract via comparative global proteomic analysis.
Na, Scientific reports 2021 - “...0.013 4 Q9JK38 Glucosamine 6-phosphate N -acetyltransferase Gnpnat1 2 7.1 1.58 1.74 2.01 0.015 5 Q9QXT0 Protein canopy homolog 2 Cnpy2 2 14.3 1.55 1.88 1.92 0.014 6 Q7JCZ0 ATP synthase protein 8 mt-Atp8 2 34.3 1.39 2.00 1.65 0.040 7 P19157 Glutathione S -transferase P...”
- Protein expression alteration in hippocampus upon genetic repression of AMPKα isoforms.
Yang, Hippocampus 2021 - “...NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 13 Q9ERS2 0.415 Protein canopy homolog 2 + Q9QXT0 0.467 Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1 Q9QUR7 0.500 Aldose reductase + P45376 0.505 Transcription elongation factor A protein-like 5 Q8CCT4 0.564 Transcription elongation factor B polypeptide 2 P62869 0.567 Tumor...”
- “...Q3UHB1 0.308 Destrin Q8R191 0.322 Protein canopy homolog 2 + Q9R0P5 0.333 Kinesin-like protein KIF2A Q9QXT0 0.333 Glutaredoxin-3 + P28740 0.350 Cation-dependent mannose-6-phosphate receptor Q9CQM9 0.356 Aldose reductase + P24668 0.389 60S ribosomal protein L4 P45376 0.394 Clathrin interactor 1 Q9D8E6 0.400 Neurogranin Q99KN9 0.400 Stromal...”
- Thymic Microenvironment Is Modified by Malnutrition and Leishmania infantum Infection
Losada-Barragán, Frontiers in cellular and infection microbiology 2019 - “...member 1 Wipf1 Down P17751 32153.25 1 4 0.439 1.6 0.012 Triosephosphate isomerase Tpi1 Down Q9QXT0 20736.25 1 4 0.429 1.5 0.026 Protein canopy homolog 2 Cnpy2 Down Q9DBP5 22133.28 1 4 0.504 1.7 0.010 UMP-CMP kinase Cmpk1 Down O08553 62220.58 1 4 0.443 1.6 0.026...”
- Proteomic Analysis of Hippocampus in a Mouse Model of Depression Reveals Neuroprotective Function of Ubiquitin C-terminal Hydrolase L1 (UCH-L1) via Stress-induced Cysteine Oxidative Modifications
Choi, Molecular & cellular proteomics : MCP 2018 - “...40 P61161 ARP2 Actin-related protein 2 6.29 44732 486 17 32 1.89 1.47 4.540E-02 61 Q9QXT0 CNPY2 Protein canopy homolog 2 4.95 20754 46 2 16 1.81 1.55 4.251E-04 Calcium dependent regulation of neural plasticity 4 Q04447 KCRB Creatine kinase B-type 5.4 42686 1645 58 70...”
- Protein profile of mouse ovarian follicles grown in vitro
Anastácio, Molecular human reproduction 2017 - “...AF SF P3 Q60715 Prolyl 4-hydroxylase subunit alpha-1 P4ha1 271.1 7.0E-05 2.2 AF SF P3 Q9QXT0 Protein canopy homolog 2 Cnpy2 254.6 3.8E-03 2.3 SMR SF P3 A2A7Q5 Prolyl 3-hydroxylase 1 Lepre1 225.9 2.7E-03 2.3 AF SF P3 G5E850 Cytochrome b-5, isoform CRA_a Cyb5 222.6 4.9E-05...”
- Hepatic lipase maturation: a partial proteome of interacting factors
Doolittle, Journal of lipid research 2009 - “...50,020 49,742 41,738 70,871 Q8K3H7 Q9Z1W7 Q2M2S1 Q9QXT0 Q3TVJ8 Q5VLK2 Q60454 P48975 P63017 Protein folding, ERAD Protein folding Protein folding Cytoskeletal...”
- “...Sequence m/z (Observed) Mass Errore P Value f Q3UE86 Q8K3H8 Q91Z81 Q9Z1W7 Q9QXT0 P24369 Q8VC94 Q3TVJ8 84 49 63 80 55 70 78 70 1 2 2 2 5 6 7 6 K.VLLVLELQGLQK.N...”
- Secretome from mesenchymal stem cells induces angiogenesis via Cyr61.
Estrada, Journal of cellular physiology 2009 - “...24 Q03265 ATP synthase subunit alpha, mitochondrial precursor 25 Q60847 Collagen alpha-1(XII) chain precursor 26 Q9QXT0 Protein canopy homolog 2 precursor 27 Q9ERE7 Mesoderm development candidate 2 28 Q01149 Collagen alpha-2(I) chain precursor 29 P37889 Fibulin-2 precursor 30 P55302 Alpha-2-macroglobulin receptor-associated protein precursor 31 P70180 Atrial...”
- More
M3XQK4 Canopy FGF signaling regulator 2 from Mustela putorius furo
Aligns to 99:243 / 254 (57.1%), covers 100.0% of PF11938, 158.8 bits
- Developmental alcohol exposure leads to a persistent change on astrocyte secretome.
Trindade, Journal of neurochemistry 2016 - “...codes in order of appearance: M3YHX2, M3XP98, M3YNK3, M3Y8S2, M3YZ28, M3YD29, M3YTA9, M3XRN5, M3YM11, M3YNY2, M3XQK4, M3Z3F9. Fig. 4 Long-term changes in ACM induced by early ethanol exposure - Proteins with annotated biological activity predominately related to extracellular matrix & cell adhesion. Protein content ratios were...”
A0JN30 Canopy FGF signaling regulator 2 from Rattus norvegicus
Aligns to 27:171 / 182 (79.7%), covers 100.0% of PF11938, 158.3 bits
F8W031 DUF3456 domain-containing protein (Fragment) from Homo sapiens
Aligns to 27:176 / 263 (57.0%), covers 98.7% of PF11938, 155.8 bits
- Proteomics analyses for the global proteins in the brain tissues of different human prion diseases
Shi, Molecular & cellular proteomics : MCP 2015 - “...P01024, P00488, P02679, H7C5H1, P02671, P02675, P01009 5 Citrate cycle (TCA cycle) a 0.0342 22 F8W031, F8VWE3, P21399, F5GXC8, E9PB14, P40925, P31040, E9PIC0, P40926, P53396, E9PF84, P21912, O43837, P48735, P50213, P10515, F5H801, P07954, P08559, P11177, Q99798, B4DJV2 FFI vs. Ctrl 1 Huntington's disease 0.0017 71 B3KUK2,...”
B5XA82 Canopy homolog 2 from Salmo salar
Aligns to 33:175 / 186 (76.9%), covers 100.0% of PF11938, 155.0 bits
CNPY4_DANRE / Q2L6K8 Protein canopy 4 from Danio rerio (Zebrafish) (Brachydanio rerio) (see paper)
Aligns to 26:185 / 217 (73.7%), covers 100.0% of PF11938, 151.4 bits
CNPY4_MOUSE / Q8BQ47 Protein canopy homolog 4; Protein associated with Tlr4 from Mus musculus (Mouse) (see paper)
Aligns to 43:202 / 245 (65.3%), covers 98.0% of PF11938, 150.1 bits
- function: Plays a role in the regulation of the cell surface expression of TLR4.
subunit: Interacts with TLR4.
CNPY3_MOUSE / Q9DAU1 Protein canopy homolog 3; Protein associated with Tlr4; Trinucleotide repeat-containing gene 5 protein from Mus musculus (Mouse) (see 6 papers)
Aligns to 48:206 / 276 (57.6%), covers 98.0% of PF11938, 148.8 bits
- function: Toll-like receptor (TLR)-specific co-chaperone for HSP90B1. Required for proper TLR folding, except that of TLR3, and hence controls TLR exit from the endoplasmic reticulum. Consequently, required for both innate and adaptive immune responses.
subunit: Interacts with HSP90B1; this interaction is disrupted in the presence of ATP. Interacts with TLR1, TLR2, TLR4 and TLR9. Strongest interaction with TLR4.
disruption phenotype: The birth rate of knockout mice on a C57BL/6 background is very low (approximately 10% of pups). The animals appear normal, but their growth after birth is severely retarded. Half of them die by the end of the weaning period. Mutant mice have profoundly impaired T-helper type 1 lymphocyte (Th1)-mediated responses (PubMed:17998391). On a BALB/c background, under resting conditions, they show spastic or dystonic features and, during the open field test, they exhibit hyperactivity and anxiety. Their resting electroencephalography show enhanced activity in the fast beta frequency band (20-35 Hz). They do not show any apparent structural brain anomaly (PubMed:29394991). - Folding of Toll-like receptors by the HSP90 paralogue gp96 requires a substrate-specific cochaperone.
Liu, Nature communications 2010 - “...depends exclusively on the cytosolic adaptor molecule TRIF 24 . Murine canopy3 (CNPY3) (UniProt accession: Q9DAU1 ) is a ubiquitous ER luminal protein of 35 kDa 25 . CNPY3 has a unique pattern of six cysteine residues 26 , which is characteristic of the saposin-like proteins...”
CNPY4_HUMAN / Q8N129 Protein canopy homolog 4 from Homo sapiens (Human) (see paper)
NP_689968 protein canopy homolog 4 precursor from Homo sapiens
Aligns to 37:196 / 248 (64.5%), covers 97.3% of PF11938, 148.6 bits
- function: Plays a role in the regulation of the cell surface expression of TLR4.
subunit: Interacts with TLR4. - Cell surface trafficking of TLR1 is differentially regulated by the chaperones PRAT4A and PRAT4B.
Hart, The Journal of biological chemistry 2012 - GeneRIF: a mechanism for the differential trafficking of TLR1 I602S variants, and highlight the distinct roles for PRAT4A and PRAT4B in the regulation of TLR1 surface expression.
- A molecule that is associated with Toll-like receptor 4 and regulates its cell surface expression.
Konno, Biochemical and biophysical research communications 2006 (PubMed)- GeneRIF: A PRotein Associated with Tlr4 (PRAT4B), regulates cell surface expression of TLR4. PRAT4B has a signal peptide followed by a mature peptide. PRAT4B is associated with the hypoglycosylated, immature form of TLR4 but not with MD-2 or TLR2.
- Proteomics analysis of carotid body tumor revealed potential mechanisms and molecular differences among Shamblin classifications.
Lv, Experimental biology and medicine (Maywood, N.J.) 2023 - The role of extracellular vesicle miRNAs and tRNAs in synovial fibroblast senescence
Wijesinghe, Frontiers in molecular biosciences 2022 - “...9606GN = CLTB PE = 1 SV = 1 1 1 0.04 3.1 control senescence Q8N129 Protein canopy homolog 4 OS = Homo sapiens OX = 9606GN = CNPY4 PE = 1 SV = 1 5 5 0.05 3.4 control senescence Q02742 Beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase OS =...”
- Quantification of FAM20A in human milk and identification of calcium metabolism proteins
Patel, Physiological reports 2021 - “...subunit MIC19 [MIC19_HUMAN] MFGM CID CNPY3 Q9BT09 Protein canopy homolog 3 [CNPY3_HUMAN] MFGM CID CNPY4 Q8N129 Protein canopy homolog 4 [CNPY4_HUMAN] MFGM CID COX5A P20674 Cytochrome c oxidase subunit 5A, mitochondrial [COX5A_HUMAN] MFGM CID COX5B P10606 Cytochrome c oxidase subunit 5B, mitochondrial [COX5B_HUMAN] MFGM CID COX6B1...”
- Comparison of a human neuronal model proteome upon Japanese encephalitis or West Nile Virus infection and potential role of mosquito saliva in neuropathogenesis.
Besson, PloS one 2020 - “...IA Glycoprotein, Transmembrane 4.52 (4.01E-02) B4DWB0 80224 NUBPL Iron-sulfur protein NUBPL Glycoprotein, Nucleotide-binding 4.30 (3.39E-02) Q8N129 245812 CNPY4 Protein canopy homolog 4 Glycoprotein 3.65 (2.81E-02) H3BQR0 10073 SNUPN Snurportin-1 3.10 (4.33E-02) Q16706 4124 MAN2A1 Alpha-mannosidase 2 Glycoprotein, Transmembrane 2.98 (3.58E-02) Q9Y294 25842 ASF1A Histone chaperone ASF1A...”
G3V828 Canopy FGF signaling regulator 3 from Rattus norvegicus
Aligns to 47:208 / 279 (58.1%), covers 98.0% of PF11938, 148.2 bits
- The mitochondrial proteomic changes of rat hippocampus induced by 28-day simulated microgravity.
Ji, PloS one 2022 - “...mitochondrial 1.51 0.003601 COX5B_RAT P12075 Cox5b Cytochrome c oxidase subunit 5B, mitochondrial 1.51 0.034268 G3V828_RAT G3V828 Cnpy3 Canopy FGF-signaling regulator 3 1.50 0.011124 M0R7R2_RAT M0R7R2 LOC683897 Similar to Protein C6orf203 1.50 0.008352 FRDA_RAT D3ZYW7 Fxn Frataxin, mitochondrial 1.50 0.005993 A0A0G2JTL5_RAT A0A0G2JTL5 Pc Pyruvate carboxylase, mitochondrial 1.50...”
A5GFQ5 Protein canopy homolog 3 from Sus scrofa
Aligns to 56:214 / 283 (56.2%), covers 98.0% of PF11938, 147.5 bits
CNPY3_HUMAN / Q9BT09 Protein canopy homolog 3; CTG repeat protein 4a; Expanded repeat-domain protein CAG/CTG 5; Protein associated with TLR4; Trinucleotide repeat-containing gene 5 protein from Homo sapiens (Human) (see paper)
Aligns to 48:206 / 278 (57.2%), covers 98.0% of PF11938, 147.3 bits
- function: Toll-like receptor (TLR)-specific co-chaperone for HSP90B1. Required for proper TLR folding, except that of TLR3, and hence controls TLR exit from the endoplasmic reticulum. Consequently, required for both innate and adaptive immune responses (By similarity).
subunit: Interacts with HSP90B1; this interaction is disrupted in the presence of ATP. Interacts with TLR1, TLR2, TLR4 and TLR9 (By similarity). Strongest interaction with TLR4 (By similarity). - Quantification of FAM20A in human milk and identification of calcium metabolism proteins
Patel, Physiological reports 2021 - “...neurotrophic factor [CDNF_HUMAN] MFGM CID CHCHD3 Q9NX63 MICOS complex subunit MIC19 [MIC19_HUMAN] MFGM CID CNPY3 Q9BT09 Protein canopy homolog 3 [CNPY3_HUMAN] MFGM CID CNPY4 Q8N129 Protein canopy homolog 4 [CNPY4_HUMAN] MFGM CID COX5A P20674 Cytochrome c oxidase subunit 5A, mitochondrial [COX5A_HUMAN] MFGM CID COX5B P10606 Cytochrome...”
- Glycoproteins in Claudin-Low Breast Cancer Cell Lines Have a Unique Expression Profile
Yen, Journal of proteome research 2017 - “...seven proteins in the LTQ data set with the lowest coefficient of variation were P20645, Q9BT09, P62937, Q16563, Q9BVK6, Q08722, and P07602. The Euclidean length of the means of the spectral counts for these seven glycoproteins over all the LTQ samples was calculated. For each sample...”
- Autologous chondrocyte implantation-derived synovial fluids display distinct responder and non-responder proteomic profiles.
Hulme, Arthritis research & therapy 2017 - “...protein, adipocyte P15090 2.6 Insulin-like growth factor-binding protein 6 P24592 2.6 Protein canopy homolog 3 Q9BT09 2.6 Tripeptidyl-peptidase 1 O14773 2.5 PDZ and LIM domain protein 3 Q53GG5 2.5 Cellular nucleic acid-binding protein P62633 2.5 Bifunctional glutamate/proline-tRNA ligase P07814 2.5 Protein disulfide-isomerase A3 P30101 2.4 Peroxiredoxin-6...”
- “...beta Q9Y5P6 2.7 Peroxiredoxin-4 Q13162 2.5 Oxysterol-binding protein 1 P22059 2.4 Protein canopy homolog 3 Q9BT09 2.1 Spermatid perinuclear RNA-binding protein Q96SI9 2.0 Ferritin light chain P02792 2.2 Secreted phosphoprotein 24 Q13103 2.2 Chondroitin sulfate proteoglycan 4 Q6UVK1 2.3 Collagen alpha-2(I) chain P08123 2.3 Collagen alpha-1(V)...”
- Mining the Breast Cancer Proteome for Predictors of Drug Sensitivity.
Timpe, Journal of proteomics & bioinformatics 2015 - “...The seven proteins in the LTQ dataset with the lowest coefficient of variation were P20645, Q9BT09, P62937, Q16563, Q9BVK6 Q08722 and P07602. The Euclidean length of the spectral counts for these seven glycoproteins was calculated for both the LTQ data and the Q Exactive data, and...”
- A screen for novel phosphoinositide 3-kinase effector proteins.
Dixon, Molecular & cellular proteomics : MCP 2011 - A molecular specificity code for the three mammalian KDEL receptors.
Raykhel, The Journal of cell biology 2007
CNPY3_DANRE / A3KNS2 Protein canopy homolog 3; Trinucleotide repeat-containing gene 5 protein from Danio rerio (Zebrafish) (Brachydanio rerio) (see paper)
Aligns to 31:190 / 276 (58.0%), covers 97.3% of PF11938, 145.0 bits
- function: Toll-like receptor (TLR)-specific co-chaperone for HSP90B1. Required for proper TLR folding and hence controls TLR exit from the endoplasmic reticulum. Consequently, required for immune responses (By similarity).
SEELE_DROME / Q7JXF7 Protein seele from Drosophila melanogaster (Fruit fly) (see paper)
NP_610547 seele from Drosophila melanogaster
Aligns to 26:172 / 189 (77.8%), covers 100.0% of PF11938, 130.1 bits
- function: Involved in embryonic dorsal-ventral patterning which is generated by a series of serine protease processing events where gd processes snk which cleaves ea which then processes spz into the activating ligand for the Toll receptor. Required during this process for the secretion of ea from the developing embryo into the perivitelline space and for ea processing.
disruption phenotype: Formation of embryos with altered dorsal-ventral patterning, dramatically decreased levels of ea in the perivitelline space and reduced processing of ea. - Localization and activation of the Drosophila protease easter require the ER-resident saposin-like protein seele.
Stein, Current biology : CB 2010 (PubMed)- GeneRIF: Seele has a role in the trafficking of Easter to the perivitelline space.
F7CNK7 Canopy FGF signaling regulator 3 from Equus caballus
2 alignments in 56:232 / 301 (57.5%), covering up to 66.0% of PF11938, 130.1 bits
NP_001305771 protein canopy homolog 3 isoform 3 precursor from Homo sapiens
2 alignments in 48:239 / 311 (55.0%), covering up to 66.0% of PF11938, 126.8 bits
AT1G42480 hypothetical protein from Arabidopsis thaliana
Aligns to 24:163 / 182 (76.9%), covers 100.0% of PF11938, 120.8 bits
- Full-length messenger RNA sequences greatly improve genome annotation
Haas, Genome biology 2002 - “...10 25 AG<CCACAACTTGAAAGTGGTGACAAGA>GT At3g10330 Transcription initiation factor IIB (TFIIB) Ceres:38950. 2 of 7 25 AG<GTTGGGACTTGTTGCGACCATCAAG>GT At1g42480 Expressed protein Ceres:42677. 7 of 9 25 AG<ATTGCTGGAGGAAACTGAAGATGAG>GT At2g23985 Expressed protein Ceres:252843. 2 of 4 25 AG<TGTCTTGTTCAGGTGAACAAAAAAG>GT * At4g23470 contains two micro-exons. Table 5 Alternative acceptor and donor splice sites,...”
F8W1K5 Canopy FGF signaling regulator 2 (Fragment) from Homo sapiens
Aligns to 1:102 / 102 (100.0%), covers 69.3% of PF11938, 99.2 bits
NP_001292919 protein canopy homolog 3 isoform 3 from Mus musculus
Aligns to 1:81 / 151 (53.6%), covers 46.7% of PF11938, 70.5 bits
- A novel rare variant of CNPY3 from familial NMOSD impairs the TLR-mediated immune response.
Mo, Journal of neuroimmunology 2023 (PubMed)- GeneRIF: A novel rare variant of CNPY3 from familial NMOSD impairs the TLR-mediated immune response.
- The SLITRK4-CNPY3 axis promotes liver metastasis of gastric cancer by enhancing the endocytosis and recycling of TrkB in tumour cells.
Zhou, Cellular oncology (Dordrecht, Netherlands) 2023 (PubMed)- GeneRIF: The SLITRK4-CNPY3 axis promotes liver metastasis of gastric cancer by enhancing the endocytosis and recycling of TrkB in tumour cells.
- RNA-Binding Protein HuR Regulates Paneth Cell Function by Altering Membrane Localization of TLR2 via Post-transcriptional Control of CNPY3.
Xiao, Gastroenterology 2019 - GeneRIF: HuR regulates Paneth cell function by modulating TLR2 localization via posttranscriptional control of CNPY3 expression.
- PRAT4A-dependent expression of cell surface TLR5 on neutrophils, classical monocytes and dendritic cells.
Shibata, International immunology 2012 (PubMed)- GeneRIF: Cell surface expression of TLR5 is dependent on PRAT4A and restricted to neutrophils, classical monocytes and specific DC subsets.
- Folding of Toll-like receptors by the HSP90 paralogue gp96 requires a substrate-specific cochaperone.
Liu, Nature communications 2010 - GeneRIF: Data suggest that CNPY3 interacts with the ATP-sensitive conformation of gp96 to promote substrate loading. Our study has thus established CNPY3 as a TLR-specific cochaperone for gp96.
- Regulatory molecules required for nucleotide-sensing Toll-like receptors.
Saitoh, Immunological reviews 2009 (PubMed)- GeneRIF: association with PRAT4A is required for ligand-induced trafficking of TLR9 to endolysosomes
- A single base mutation in the PRAT4A gene reveals differential interaction of PRAT4A with Toll-like receptors.
Kiyokawa, International immunology 2008 (PubMed)- GeneRIF: single base mutant associates preferentially with TLR9, and differentially interacts with TLR2, 4 and 9
- A protein associated with Toll-like receptor (TLR) 4 (PRAT4A) is required for TLR-dependent immune responses.
Takahashi, The Journal of experimental medicine 2007 - GeneRIF: PRAT4A regulates the subcellular distribution and response of multiple toll-like recaptors and is required for both innate and adaptive immune responses
- More
NP_001379479 Protein disulfide isomerase crld-1 from Caenorhabditis elegans
2 alignments in 26:135 / 310 (35.5%), covering up to 42.0% of PF11938, 51.2 bits
CREL1_CAEEL / Q19267 Protein disulfide isomerase crld-1; Cysteine-rich with EGF-like domain protein crld-1; EC 5.3.4.1 from Caenorhabditis elegans (see paper)
2 alignments in 26:135 / 356 (30.9%), covering up to 42.0% of PF11938, 50.3 bits
- function: Protein disulfide isomerase which associates with the unc-29 subunit of levamisole-sensitive nicotinic acetylcholine receptors (L- nAChR) to promote L-nAChR assembly in the endoplasmic reticulum at neuromuscular junctions.
function: [Isoform a]: Promotes L-nAChR assembly in the endoplasmic reticulum at neuromuscular junctions.
catalytic activity: Catalyzes the rearrangement of -S-S- bonds in proteins.
subunit: Interacts with unc-29.
disruption phenotype: Viable, with no defects in coordination (PubMed:30407909). Decreased number of synaptic nicotinic acetylcholine receptors (nAChRs) at neuromuscular junctions (PubMed:30407909). Isoform a: Deletion leads to reduced sensitivity to the nAChR agonist levamisole (PubMed:30407909). Isoform b: Deletion leads to sensitivity to levamisole as in wild-type (PubMed:30407909).
CREL1_MOUSE / Q91XD7 Protein disulfide isomerase Creld1; Cysteine-rich with EGF-like domain protein 1; EC 5.3.4.1 from Mus musculus (Mouse) (see paper)
NP_598691 protein disulfide isomerase Creld1 precursor from Mus musculus
Aligns to 45:103 / 420 (14.0%), covers 41.3% of PF11938, 49.1 bits
Q4V7F2 Protein disulfide isomerase Creld1 from Rattus norvegicus
Aligns to 45:103 / 420 (14.0%), covers 41.3% of PF11938, 48.7 bits
XP_011532410 protein disulfide isomerase CRELD1 isoform X2 from Homo sapiens
2 alignments in 45:142 / 426 (23.0%), covering up to 41.3% of PF11938, 46.0 bits
- Biallelic CRELD1 variants cause a multisystem syndrome, including neurodevelopmental phenotypes, cardiac dysrhythmias, and frequent infections.
Jeffries, Genetics in medicine : official journal of the American College of Medical Genetics 2024 - GeneRIF: Biallelic CRELD1 variants cause a multisystem syndrome, including neurodevelopmental phenotypes, cardiac dysrhythmias, and frequent infections.
- CRELD1 variants are associated with bicuspid aortic valve in Turner syndrome.
Pinnaro, Human genetics 2023 - GeneRIF: CRELD1 variants are associated with bicuspid aortic valve in Turner syndrome.
- CRELD1 gene variants and atrioventricular septal defects in Down syndrome.
Asim, Gene 2018 (PubMed)- GeneRIF: The CRELD1 gene is likely to have a major role in causation of AVSD phenotype in selected DS patients.
- Germline mutations in NKX2-5, GATA4, and CRELD1 are rare in a Mexican sample of Down syndrome patients with endocardial cushion and septal heart defects.
Alcántara-Ortigoza, Pediatric cardiology 2015 (PubMed)- GeneRIF: Germline mutations in the NKX2-5, GATA4, and CRELD1 genes do not appear to be associated with CHD in Mexican DS patients.
- [Potential role of CRELD1 gene in the pathogenesis of atrioventricular septal defect].
Guo, Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics 2014 (PubMed)- GeneRIF: Mutation of the CRELD1 gene increased the risk for atrioventricular septal defect.
- Specific association of missense mutations in CRELD1 with cardiac atrioventricular septal defects in heterotaxy syndrome.
Zhian, American journal of medical genetics. Part A 2012 - GeneRIF: study indicates that deleterious CRELD1 missense mutations are specifically associated with AVSD and are not correlated with other aspects of the heterotaxy phenotype
- Polymorphic haplotypes of CRELD1 differentially predispose Down syndrome and euploids individuals to atrioventricular septal defect.
Ghosh, American journal of medical genetics. Part A 2012 (PubMed)- GeneRIF: we identified two CRELD1 haplotypes associated with AVSD phenotype among DS and euploid individuals.
- Maternal genes and facial clefts in offspring: a comprehensive search for genetic associations in two population-based cleft studies from Scandinavia.
Jugessur, PloS one 2010 - GeneRIF: Observational study of gene-disease association. (HuGE Navigator)
- More
CREL1_HUMAN / Q96HD1 Protein disulfide isomerase CRELD1; Cysteine-rich with EGF-like domain protein 1; EC 5.3.4.1 from Homo sapiens (Human) (see 5 papers)
2 alignments in 45:142 / 420 (23.3%), covering up to 41.3% of PF11938, 46.0 bits
- function: Protein disulfide isomerase (By similarity). Promotes the localization of acetylcholine receptors (AChRs) to the plasma membrane (By similarity).
catalytic activity: Catalyzes the rearrangement of -S-S- bonds in proteins. - Epigenetic Mechanisms Histone Deacetylase-Dependent Regulate the Glioblastoma Angiogenic Matrisome and Disrupt Endothelial Cell Behavior In Vitro
Menezes, Molecular & cellular proteomics : MCP 2024 - “...HAPLN3, Q96S86; 6 ECM Glycoproteins: Isoform 2 of Cysteine-rich with EGF-like domain protein 1, CRELD1, Q96HD1; Cysteine-rich motor neuron 1 protein, CRIM1, Q9NZV1; Fibulin-7, FBLN7, Q53RD9; Growth arrest-specific protein 6, GAS6, Q14393; Isoform 4 of Latent-transforming growth factor beta-binding protein 1, LTBP1, Q14766; Netrin-G1, NTNG1, Q9Y2I2;...”
- Decellularized adipose-derived matrix from Superficial layers of abdominal adipose tissue exhibits superior capacity of adipogenesis compared to deep layers.
Ma, Materials today. Bio 2024 - “...5 Q7Z7G0 ABI3BP Target of Nesh-SH3 Q8N474 SFRP1 Secreted frizzled-related protein 1 P35556 FBN2 Fibrillin-2 Q96HD1 CRELD1 Protein disulfide isomerase CRELD1 Q99969 RARRES2 Retinoic acid receptor responder protein 2 Q99972 MYOC Myocilin Q9UBX5 FBLN5 Fibulin-5 Q9UKU9 ANGPTL2 Angiopoietin-related protein 2 Table 3 Extracellular matrix-associated terms that...”
- BALDR: A Web-based platform for informed comparison and prioritization of biomarker candidates for type 2 diabetes mellitus.
Lundgaard, PLoS computational biology 2023 - “...Source Gene name Protein name UniProt ID [ 11 ] CRELD1 Protein disulfide isomerase CRELD1 Q96HD1 ENPP7 Ectonucleotide pyrophosphatase/phosphodiesterase family member 7 Q6UWV6 FAS Tumor necrosis factor receptor superfamily member 6 P25445 GDF15 Growth/differentiation factor 15 Q99988 IL18R1 Interleukin-18 receptor 1 Q13478 RTN4R Reticulon-4 receptor Q9BZR6...”
- Proteomic analysis of human follicular fluid from fertile women
Zamah, Clinical proteomics 2015 - “...Calsyntenin-1 Q16627 CCL14 C-C motif chemokine 14 P26992 CNTFR Ciliary neurotrophic factor receptor subunit alpha Q96HD1 CRELD1 Cysteine-rich with EGF-like domain protein 1 Q9UBP4 DKK3 Dickkopf-related protein 3 Q13822 ENPP2 Ectonucleotide pyrophosphatase/phosphodiesterase family member 2 Q8N441 FGFRL1 Fibroblast growth factor receptor-like 1 Q9Y625 GPC6 Glypican-6 P10912...”
- Elucidation of functional consequences of signalling pathway interactions.
Ihekwaba, BMC bioinformatics 2009 - “...Q14164 IKKE_HUMAN Inhibitor of nuclear factor B kinase subunit epsilon Q15653 IKBB_HUMAN NF-kappa-B inhibitor beta Q96HD1 CREL1_HUMAN Crel1 Q6UXH1 CREL2_HUMAN Crel2 Q9Y6K9 NEMO_HUMAN IKK G1/S phase cell P24385 CCND1_HUMAN Cyclin D1 cycle proteins Q01094 E2F1_HUMAN E2F-1 P06400 RB_HUMAN Rb P46527 CDN1B_HUMAN P27 The proteins have been...”
- “...IKBE_HUMAN 48 0.11702 P51959 CCNG1_HUMAN 3 0.66667 Q04864 REL_HUMAN 38 0.14794 Q92793 CBP_HUMAN 3 0.66667 Q96HD1 CREL1_HUMAN 12 0.68182 P62081 RS7_HUMAN 3 0.66667 P07437 TBB5_HUMAN 12 0.68182 Q99816 TS101_HUMAN 3 0.66667 P62158 CALM_HUMAN 12 0.68182 The table is arranged in descending order. Only the first fifteen...”
LOC105559782 cysteine-rich with EGF-like domain protein 2 from Vollenhovia emeryi
Aligns to 42:100 / 379 (15.6%), covers 41.3% of PF11938, 42.5 bits
- QTL Mapping of Sex Determination Loci Supports an Ancient Pathway in Ants and Honey Bees
Miyakawa, PLoS genetics 2015 - “...protein LOC105559779 BET1 homolog LOC105559781 probable ribosome production factor 1 LOC105559780 THUMP domain-containing protein 3-like LOC105559782 cysteine-rich with EGF-like domain protein 2 LOC105559784 coatomer subunit alpha LOC105559783 uncharacterized LOC105559785 host cell factor LOC105559786 probable myosin heavy chain ECU04_1000 LOC105559787 GTP-binding protein Rit2 LOC105559788 ero1-like protein LOC105559790...”
CREL1_XENTR / A0A6I8RMG7 Protein disulfide isomerase CRELD1; Cysteine-rich with EGF-like domain protein 1; EC 5.3.4.1 from Xenopus tropicalis (Western clawed frog) (Silurana tropicalis) (see paper)
XP_012817147 protein disulfide isomerase CRELD1 from Xenopus tropicalis
Aligns to 86:128 / 410 (10.5%), covers 26.0% of PF11938, 38.5 bits
- function: Protein disulfide isomerase (By similarity). Promotes the localization of acetylcholine receptors (AChRs) to the plasma membrane (By similarity).
catalytic activity: Catalyzes the rearrangement of -S-S- bonds in proteins.
disruption phenotype: About half of the knockdown tadpoles exhibit severe defects of either early gastrulation disruption or edema and late embryonic lethality. Some also have tail defects. Surviving tadpoles show more robust seizure behaviors than wild-type in response to pilocarpine treatment. - Biallelic CRELD1 variants cause a multisystem syndrome, including neurodevelopmental phenotypes, cardiac dysrhythmias, and frequent infections.
Jeffries, Genetics in medicine : official journal of the American College of Medical Genetics 2024 - GeneRIF: Biallelic CRELD1 variants cause a multisystem syndrome, including neurodevelopmental phenotypes, cardiac dysrhythmias, and frequent infections.
MZB1_MOUSE / Q9D8I1 Marginal zone B- and B1-cell-specific protein; Plasma cell-induced resident endoplasmic reticulum protein; Plasma cell-induced resident ER protein; pERp1; Proapoptotic caspase adapter protein from Mus musculus (Mouse) (see 4 papers)
Aligns to 48:177 / 188 (69.1%), covers 99.3% of PF11938, 35.2 bits
NP_001019411 marginal zone B- and B1-cell-specific protein precursor from Rattus norvegicus
Aligns to 48:177 / 188 (69.1%), covers 100.0% of PF11938, 33.1 bits
- Cerulein-induced acute pancreatitis in PACAP knockout mice.
Sakurai, Journal of molecular neuroscience : MN 2011 (PubMed)- GeneRIF: Results indicate that lack of pancreatic PACAP did not aggravate, but rather ameliorated, cerulein-induced pancreatitis.
- VIP, CRF, and PACAP act at distinct receptors to elicit different cAMP/PKA dynamics in the neocortex.
Hu, Cerebral cortex (New York, N.Y. : 1991) 2011 - GeneRIF: VIP and CRF, originating from interneurons, and PACAP, expressed mainly by pyramidal cells, finely tune the excitability and gene expression in the neocortical network
- Neuroprotective effect of PACAP against NMDA-induced retinal damage in the mouse.
Endo, Journal of molecular neuroscience : MN 2011 (PubMed)- GeneRIF: Data suggest that exogenous PACAP is able to counteract NMDA-induced toxicity, and that endogenous PACAP exerts a neuroprotective effect in the retina.
- Presence of endogenous PACAP-38 ameliorated intestinal cold preservation tissue injury.
Ferencz, Journal of molecular neuroscience : MN 2010 (PubMed)- GeneRIF: Data show that the presence of PACAP-38 in the small bowel tissue has a key role in the protection against intestinal cold preservation injury.
- Comparison of intestinal warm ischemic injury in PACAP knockout and wild-type mice.
Ferencz, Journal of molecular neuroscience : MN 2010 (PubMed)- GeneRIF: Results propose an important protective effect of endogenous PACAP-38 against intestinal warm ischemia, which provides basis for further investigation to elucidate the mechanism of this protective effect.
- Regulation of oxidative stress by pituitary adenylate cyclase-activating polypeptide (PACAP) mediated by PACAP receptor.
Ohtaki, Journal of molecular neuroscience : MN 2010 (PubMed)- GeneRIF: Results suggest that PACAP plays an important role in the physiological regulation of oxidative stress.
- PACAP expression in explant cultured mouse major pelvic ganglia.
Girard, Journal of molecular neuroscience : MN 2010 - GeneRIF: Results demonstrate that, although only the parasympathetic neurons in explant cultured MPGs increase expression of PACAP, both sympathetic and parasympathetic postganglionic neurons in the cultured MPG whole-mount increase expression of ATF-3.
- Pituitary adenylate cyclase-activating polypeptide deficiency enhances oxazolone-induced allergic contact dermatitis in mice.
Kemény, Journal of molecular neuroscience : MN 2010 (PubMed)- GeneRIF: These results suggest that PACAP exerts anti-inflammatory, particularly edema-inhibiting effects in allergic contact dermatitis.
- More
MZB1_HUMAN / Q8WU39 Marginal zone B- and B1-cell-specific protein; Mesenteric estrogen-dependent adipose 7; MEDA-7; Plasma cell-induced resident endoplasmic reticulum protein; Plasma cell-induced resident ER protein; pERp1; Proapoptotic caspase adapter protein from Homo sapiens (Human) (see 4 papers)
NP_057543 marginal zone B- and B1-cell-specific protein precursor from Homo sapiens
Aligns to 49:178 / 189 (68.8%), covers 100.0% of PF11938, 28.4 bits
- function: Associates with immunoglobulin M (IgM) heavy and light chains and promotes IgM assembly and secretion. May exert its effect by acting as a molecular chaperone or as an oxidoreductase as it displays a low level of oxidoreductase activity (By similarity). Isoform 2 may be involved in regulation of apoptosis. Helps to diversify peripheral B- cell functions by regulating Ca(2+) stores, antibody secretion and integrin activation.
function: Acts as a hormone-regulated adipokine/pro-inflammatory cytokine that is implicated in causing chronic inflammation, affecting cellular expansion and blunting insulin response in adipocytes. May have a role in the onset of insulin resistance
subunit: Part of the ER chaperone complex, a multi-protein complex in the endoplasmic reticulum containing a large number of molecular chaperones which associates with unassembled incompletely folded immunoglobulin heavy chains (By similarity). Isoform 2 interacts with CASP2 and CASP9. Interacts with HSP90B1 and PDIA3 in a calcium- dependent manner (By similarity). - Epstein-Barr Virus miR-BARTs 7 and 9 modulate viral cycle, cell proliferation, and proteomic profiles in Burkitt lymphoma
Caetano, Tumour virus research 2024 - “...DNA mismatch repair protein Msh6 2.10 0.951 U3KQV3 PSAT1 PPM-type phosphatase domain-containing protein 1.68 0.828 Q8WU39 HM13 Marginal zone B- and B1-cell-specific protein 1.64 0.828 Q58FF6 ACSF3 Putative heat shock protein HSP 90-beta 4 1.57 0.414 A0A7P0Z4P5 SLC3A2 4F2 cell-surface antigen heavy chain 1.50 0.233 P55327...”
- Proteome profiling of cutaneous leishmaniasis lesions due to dermotropic Leishmania donovani in Sri Lanka.
Manamperi, Clinical proteomics 2024 - “...protein A9 P06702 Up-regulated 2.918428 0.00078 19 MZB1 Marginal zone B and B1 cell-specific protein Q8WU39 Up-regulated 3.95914 0.00087 20 CORO1A Coronin, actin-binding protein, 1A P31146 Up-regulated 2.772258 0.00131 21 TNC Tenascin C P24821 Up- regulated 2.962339 0.00131 22 KRT17 Keratin 17 Q04695 Up-regulated 3.426447 0.00140...”
- Proteome profiling of cutaneous leishmaniasis lesions due to dermotropic Leishmania donovani in Sri Lanka.
Manamperi, bioRxiv : the preprint server for biology 2024 - “...calcium-binding protein A9 P06702 Up-regulated 0.00078 19. MZB1 Marginal zone B and B1 cell-specific protein Q8WU39 Up-regulated 0.00087 20. CORO1A Coronin, actin-binding protein, 1A P31146 Up-regulated 0.00131 21. TNC Tenascin C P24821 Up- regulated 0.00131 22. KRT17 Keratin 17 Q04695 Up-regulated 0.00140 23. HNRNPM Heterogeneous nuclear...”
- Proteomics Analysis of Gastric Cancer Patients with Diabetes Mellitus
Osório, Journal of clinical medicine 2021 - “...GKN2 1.654 6 Eosinophil peroxidase P11678 EPX 1.629 15 Marginal zone B- and B1-cell-specific protein Q8WU39 MZB1 1.586 11 Annexin A10 Q9UJ72 ANXA10 1.578 16 Protein S100-A8 P05109 S100A8 1.523 12 Immunoglobulin kappa variable 4-1 P06312 IGKV4-1 1.517 2 Carboxymethylenebutenolidase homolog Q96DG6 CMBL 1.510 10 High...”
- Inflect: Optimizing Computational Workflows for Thermal Proteome Profiling Data Analysis
McCracken, Journal of proteome research 2021 - “...disintegrin and metalloproteinase domain-containing protein8 ADAM8MS2 Q96LC7 sialic acid-binding Ig-like lectin 10 SIGLEC10 SLG2 UNQ477/PRO940 Q8WU39 marginal zone B- and B1-cell-specific protein MZB1MEDA7 PACAP HSPC190 Q9NR28 diablo homologue, mitochondrial DIABLO SMAC Q9NP99 triggering receptor expressed on myeloid cells1 TREM1 Q15631 translin TSN O76031 ATP-dependent Clp protease...”
- Characterization of Novel Progression Factors in Castration-Resistant Prostate Cancer Based on Global Comparative Proteome Analysis.
Na, Cancers 2021 - “...protein 1 LSP1 2.4 2.1 5.0 P05114 Non-histone chromosomal protein HMG-14 HMGN1 2.4 2.7 6.5 Q8WU39 Marginal zone B- and B1-cell-specific protein MZB1 2.2 2.1 4.5 Q6RW13 Type-1 angiotensin II receptor-associated protein AGTRAP 2.1 4.0 8.5 P12107 Collagen alpha-1(XI) chain COL11A1 2.0 4.2 8.4 Q9H7N4 Splicing...”
- Lung proteomic biomarkers associated with chronic obstructive pulmonary disease.
Zhang, American journal of physiology. Lung cellular and molecular physiology 2021 - Identification of HO-1 as a novel biomarker for graft acute cellular rejection and prognosis prediction after liver transplantation
Jia, Annals of translational medicine 2020 - “...activating enzyme 6 UBA6 1.307 P10644 cAMP-dependent protein kinase type I-alpha regulatory subunit PRKAR1A 1.304 Q8WU39 Marginal zone B and B1 cell specific protein MZB1 1.299 P62736 Actin, aortic smooth muscle ACTA2 1.297 P62424 60S ribosomal protein L7a RPL7A 1.297 O75431 Metaxin 2 MTX2 1.290 P47755...”
- More
- MZB1-expressing cells are essential for local immunoglobulin production in chronic rhinosinusitis with nasal polyps.
Huang, Annals of allergy, asthma & immunology : official publication of the American College of Allergy, Asthma, & Immunology 2024 (PubMed)- GeneRIF: MZB1-expressing cells are essential for local immunoglobulin production in chronic rhinosinusitis with nasal polyps.
- MZB1 regulates cellular proliferation, mitochondrial dysfunction, and inflammation and targets the PI3K-Akt signaling pathway in acute pancreatitis.
Xu, Cellular signalling 2024 (PubMed)- GeneRIF: MZB1 regulates cellular proliferation, mitochondrial dysfunction, and inflammation and targets the PI3K-Akt signaling pathway in acute pancreatitis.
- Altered expression of MZB1 in periodontitis: A possible link to disease pathogenesis.
Sunnetci-Akkoyunlu, Journal of periodontology 2023 (PubMed)- GeneRIF: Altered expression of MZB1 in periodontitis: A possible link to disease pathogenesis.
- MZB1 targeted by miR-185-5p inhibits the migration of human periodontal ligament cells through NF-κB signaling and promotes alveolar bone loss.
Li, Journal of periodontal research 2022 (PubMed)- GeneRIF: MZB1 targeted by miR-185-5p inhibits the migration of human periodontal ligament cells through NF-kappaB signaling and promotes alveolar bone loss.
- High-resolution Crystal Structure of Human pERp1, A Saposin-like Protein Involved in IgA, IgM and Integrin Maturation in the Endoplasmic Reticulum.
Sowa, Journal of molecular biology 2021 (PubMed)- GeneRIF: High-resolution Crystal Structure of Human pERp1, A Saposin-like Protein Involved in IgA, IgM and Integrin Maturation in the Endoplasmic Reticulum.
- COL1A1 and MZB1 as the hub genes influenced the proliferation, invasion, migration and apoptosis of rectum adenocarcinoma cells by weighted correlation network analysis.
Wu, Bioorganic chemistry 2020 (PubMed)- GeneRIF: COL1A1 and MZB1 as the hub genes influenced the proliferation, invasion, migration and apoptosis of rectum adenocarcinoma cells by weighted correlation network analysis.
- Proteomics and functional study reveal marginal zone B and B1 cell specific protein as a candidate marker of multiple myeloma.
Chanukuppa, International journal of oncology 2020 (PubMed)- GeneRIF: Proteomics and functional study reveal marginal zone B and B1 cell specific protein as a candidate marker of multiple myeloma.
- Increase of MZB1 in B cells in systemic lupus erythematosus: proteomic analysis of biopsied lymph nodes.
Miyagawa-Hayashino, Arthritis research & therapy 2018 - GeneRIF: Data suggest that marginal zone B and B1 cell specific protein (MZB1) may be a potential therapeutic target in excessive antibody-secreting cells in systemic lupus erythematosus (SLE).
- More
Or search for genetic data about PF11938 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory