Family Search for PF13503 (DUF4123)
Running HMMer for PF13503
PF13503 hits 23 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
PSPTO_3850 hypothetical protein from Pseudomonas syringae pv. tomato str. DC3000
Aligns to 4:124 / 283 (42.8%), covers 98.4% of PF13503, 113.7 bits
PSPTO_5437 hypothetical protein from Pseudomonas syringae pv. tomato str. DC3000
Aligns to 5:124 / 227 (52.9%), covers 96.7% of PF13503, 103.1 bits
PA3905 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 17:144 / 175 (73.1%), covers 100.0% of PF13503, 97.5 bits
- The phage-encoded protein PIT2 impacts Pseudomonas aeruginosa quorum sensing by direct interaction with LasR
Schroven, iScience 2023 - “...PAAR4 6.49 1,16E-12 PA1432 lasI 6.41 2,00E-75 PA3907 tseT 6.08 2,99E-22 PA2939 pepB 5.54 9,09E-65 PA3905 tectT 5.45 4,81E-12 PA2591 vqsR 5.29 2,18E-30 PA3535 eprS 4.82 5,85E-14 PA0852 cbpD 4.75 8,59E-40 PA2587 pqsH 4.70 2,57E-40 PA4677 hp 4.61 4,81E-28 Log2FoldChange>|2| and p adj <0.0001. With hp=...”
- Pseudomonas aeruginosa modulates alginate biosynthesis and type VI secretion system in two critically ill COVID-19 patients
Qu, Cell & bioscience 2022 - “...), PA2774 ( tse4 ), PA2775 ( tsi4 ), vgrG1 , PA0093 ( tse6 ), PA3905 ( tecT ), PA0082 ( tssA1 ), PA2703 ( tsi2 ), PA0094 ( eagT6 ), PA3484 ( tse3 ), PA5266 ( vgrG6 ), hcpA and hcpB (Table 3 ). P....”
- “...52.33 vgrG1 VgrG1 2637.35 4.74 1.56E50 3969.33 1016.67 PA0093 Tse6 947.79 4.91 3.88E-46 1469.00 360.00 PA3905 Type VI effector chaperone for Tox-Rease, TecT 1073.56 4.95 1.10E53 1671.00 403.00 PA0082 TssA1 1449.46 5.32 1.76E55 2265.00 515.00 PA2703 Tsi2 98.26 5.56 5.99E24 156.67 33.00 PA0094 EagT6 251.06 5.79...”
- Virulence Induction in Pseudomonas aeruginosa under Inorganic Phosphate Limitation: a Proteomics Perspective
Matilla, Microbiology spectrum 2022 - “...hsiB3 Type VI secretion system H3 ON/OFF PA2366 hsiC3 Type VI secretion system H3 ON/OFF PA3905 tecT Type VI effector chaperone for Tox-Release 1.46 PA0263 b PA5267 b PA1512 b hcpC hcpB hcpA Type VI secretion system (protein of the spear) Type VI secretion system (protein...”
- NosocomialPseudomonas aeruginosaregulates alginate biosynthesis and Type VI secretion system during adaptive and convergent evolution for coinfection in critically ill COVID-19 patients
Qu, 2021 - Additive Effects of Quorum Sensing Anti-Activators on Pseudomonas aeruginosa Virulence Traits and Transcriptome
Asfahl, Frontiers in microbiology 2017 - “...6.0 PA3615 hypothetical protein 1.6 NC NC 1.5 PA3904 hypothetical protein 15.0 2.6 3.3 2.5 PA3905 hypothetical protein 10.5 2.4 3.0 1.6 PA3906 hypothetical protein 17.4 NC 3.1 NC PA3907 hypothetical protein 8.4 2.7 4.1 NC PA3908 hypothetical protein 5.8 2.9 4.3 2.4 PA4117 bphP bacterial...”
- Early activation of quorum sensing in Pseudomonas aeruginosa reveals the architecture of a complex regulon
Schuster, BMC genomics 2007 - “...Both lasA and rhlA possess a las-rhl box [ 7 , 8 , 25 ]. PA3905 is an example of one of the few early genes that are induced fully in the wildtype strain in logarithmic phase. Ectopic expression of lasR resulted in a similar level...”
- Transcriptome analysis reveals that multidrug efflux genes are upregulated to protect Pseudomonas aeruginosa from pentachlorophenol stress
Muller, Applied and environmental microbiology 2007 - “...PA2658 PA2808 PA3287 PA3552 PA3815 PA3904 PA3905 PA5212 PA5369 Hypothetical protein Conserved hypothetical Hypothetical protein Conserved hypothetical Conserved...”
- Effect of anaerobiosis and nitrate on gene expression in Pseudomonas aeruginosa
Filiatrault, Infection and immunity 2005 - “...February 12, 2017 by University of California, Berkeley PA3905 PA3907 PA3912 PA3913 PA3914 PA3915 PA3916 PA3917 PA3918 PA3979 PA4055 PA4063 PA4142 PA4170 PA4210...”
- More
PA14_13380 hypothetical protein from Pseudomonas aeruginosa UCBPP-PA14
Aligns to 17:144 / 175 (73.1%), covers 100.0% of PF13503, 96.6 bits
- BosR: A novel biofilm-specific regulator in Pseudomonas aeruginosa
Dostert, Frontiers in microbiology 2022 - “...PA14_00980 fha1 Type VI secretion system, forkhead associated domain 5.0 PA14_09400 phzS Flavin-containing monooxygenase 5.8 PA14_13380 (tecT) Type VI effector chaperone for Tox-Rease 110.9 PA14_19990 (hasI) RNA polymerase ECF-subfamily sigma-70 factor 47.7 PA14_20270 rhlG Beta-ketoacyl reductase 4.6 PA14_20870 (plpD) Patatin-like protein 4.2 PA14_24040 xcpU Type II...”
- Evolution of biofilm-adapted gene expression profiles in lasR-deficient clinical Pseudomonas aeruginosa isolates
Jeske, NPJ biofilms and microbiomes 2022 - “...PA14_10560 PA14_34870 chiC PA14_48060 aprA PA14_13360 PA14_36310 hcnC PA14_48090 aprF PA14_13370 PA14_36320 hcnB PA14_48100 aprE PA14_13380 PA14_36330 hcnA PA14_48115 aprD PA14_13390 PA14_36530 PA14_48140 aprX PA14_15090 - PA14_36620 PA14_49260 napB PA14_16250 lasB PA14_36820 PA14_49310 PA14_18630 eprS PA14_37745 PA14_51350 phnB PA14_19100 rhlA PA14_37760 PA14_51380 pqsE PA14_19110 rhlB PA14_37770...”
PSPTO_2537 conserved domain protein from Pseudomonas syringae pv. tomato str. DC3000
Aligns to 5:126 / 155 (78.7%), covers 99.2% of PF13503, 95.6 bits
A1X1P7 Uncharacterized protein from Janthinobacterium lividum
Aligns to 21:141 / 168 (72.0%), covers 99.2% of PF13503, 94.0 bits
PA14_43090 hypothetical protein from Pseudomonas aeruginosa UCBPP-PA14
Aligns to 23:142 / 246 (48.8%), covers 96.7% of PF13503, 88.9 bits
- Initiation of H1-T6SS dueling between Pseudomonas aeruginosa
George, mBio 2024 - “...be triggered by PAO1 H2-T6SS. PA14 H2-T6SS encodes additional genes, namely, hcp2 , vgrG2 , PA14_43090 encoding a homolog of Aeromonas hydrophila T3SS effector, and PA14_43100 encoding a putative Rhs family protein ( 37 , 38 ) to which PAO1 has no dedicated immunity proteins. To...”
- Evolution of biofilm-adapted gene expression profiles in lasR-deficient clinical Pseudomonas aeruginosa isolates
Jeske, NPJ biofilms and microbiomes 2022 - “...PA14_31360 PA14_43030 PA14_09480 phzA1 PA14_32590 dipZ2 PA14_43040 PA14_09490 phzM PA14_32600 PA14_43050 PA14_09700 pqsL PA14_32610 dsbG PA14_43090 PA14_09900 prpL PA14_33290 PA14_45940 lasI PA14_10360 PA14_33450 treA PA14_45950 rsaL PA14_10380 PA14_34020 PA14_46510 PA14_10490 PA14_34330 PA14_46520 PA14_10500 ccoN PA14_34810 mxaA PA14_46530 PA14_10530 PA14_34820 PA14_46540 PA14_10540 fixG PA14_34830 PA14_46550 PA14_10550 cysI...”
- An rhs gene linked to the second type VI secretion cluster is a feature of the Pseudomonas aeruginosa strain PA14
Jones, Journal of bacteriology 2014 - “...Rhs element (PA14_43100 or RhsP2), and a protein with no homologies with previously characterized proteins (PA14_43090). In this study, we engineered a P. aeruginosa PA14 strain carrying an arabinose-inducible H2-T6SS on the chromosome. We showed that arabinose induction readily promotes assembly of the H2-T6SS, as seen...”
- “...vgrG14-rhsP2 PA14 pscC strain carrying a clean deletion of the region carrying vgrG14 and rhsP2 (PA14_43090 and PA14_43100) This study PA14-DP stp2 vgrG14-v5 PA14-DP producing a V5-His 6 -tagged version of VgrG14 in a stp2 background This study PA14-DP stp2 rhsP2-v5 PA14-DP producing a V5-His 6...”
- The VgrG proteins are "à la carte" delivery systems for bacterial type VI effectors
Hachani, The Journal of biological chemistry 2014 - “...encodes a Hcp protein (Hcp2), a VgrG protein (VgrG14), a putative protein of unknown function (PA14_43090), and a Rhs element (PA14_43100) named RhsP2 ( Fig. 9 B ) ( 49 ) and also carries a C-terminal domain (RhsP2-CT). The toxic activity observed for RhsP1-CT led us...”
- “...vgrG14 cluster showing hcp2 (PA14_43070), vgrG14 (PA14_43080), a gene encoding a protein of unknown function PA14_43090, rhsP2 (PA14_43100), and a small non-annotated ORF rhsI2 encoding for a putative immunity protein. B , schematic representation of RhsP2 displaying the N-terminal region, RV XXXXXXXX G motif, conserved Rhs...”
- The second type VI secretion system of Pseudomonas aeruginosa strain PAO1 is regulated by quorum sensing and Fur and modulates internalization in epithelial cells
Sana, The Journal of biological chemistry 2012 - “...PAO1 locus, and the PA14 locus contains also three other putative substrate genes, vgrG2 , PA14_43090 encoding an homologue of an A. hydrophila type III secretion system (T3SS) effector and PA14_43100 encoding a putative Rhs family protein ( 19 ). From our observation, it thus stands...”
- Genetic determinants involved in the susceptibility of Pseudomonas aeruginosa to beta-lactam antibiotics
Alvarez-Ortega, Antimicrobial agents and chemotherapy 2010 - “...PA0807 PA0908 PA0958 PA1348 PA14_15600 PA14_23420 PA14_23430 PA14_43090 PA14_06490 PA1553 PA2023 PA2487 PA2621 PA2797 PA3141 PA3145 PA3247 PA3259 PA3520 PA3589...”
- Quorum sensing differentially regulates Pseudomonas aeruginosa type VI secretion locus I and homologous loci II and III, which are required for pathogenesis
Lesic, Microbiology (Reading, England) 2009 - “...T6SS loci (Fig. 1). The HSI-II locus2848 specific gene PA14_43090 encodes a hypothetical conserved protein with 32 % identity to a putative type III effector...”
- “...is worth noting that two of these genes, PA14_43100 and PA14_43090, are specific to HSI-II and -III of PA14, as no orthologues were found within the other three...”
- Genomewide identification of genetic determinants of antimicrobial drug resistance in Pseudomonas aeruginosa
Dötsch, Antimicrobial agents and chemotherapy 2009 - “...PA14_18070 PA14_23420 PA14_23430 PA14_23460 PA14_28520 PA14_43090 PA14_44230 PA14_51950 PA14_54750 PA14_58760 PA14_66100 PA14_30210d PA14_30210d PA14_60280d...”
ECUMN_0231 hypothetical protein from Escherichia coli UMN026
Aligns to 8:124 / 280 (41.8%), covers 97.6% of PF13503, 87.8 bits
- A novel chaperone-effector-immunity system identified in uropathogenic Escherichia coli UMN026
Casiano, PeerJ 2024 - “...can participate in bacterial competition and in bacterial pathogenicity. UPEC UMN026 carries three genes, namely, ECUMN_0231, ECUMN_0232, and ECUMN_0233, which encode three uncharacterized proteins related to the T6SS that are conserved in strains from phylogroups B2 and D and have been proposed as biomarkers of UTIs....”
- “...suggested that these genes could be predictor biomarkers for UTIs. These genes are annotated as ECUMN_0231, ECUMN_0232, and ECUMN_0233 in the genome of UPEC UMN026, and the T6SS cluster is type 2 ( Journet & Cascales, 2016 ; Nielsen et al., 2017 ). The aim of...”
- Whole-genome comparison of urinary pathogenic Escherichia coli and faecal isolates of UTI patients and healthy controls
Nielsen, International journal of medical microbiology : IJMM 2017 - “...14 (0.13) 20 (0.42) 24 putative type VI secretion system protein 3, T6SS2 gene locus ECUMN_0231 264,515265,356 0.035 0.18 12 (0.11) 20 (0.42) 25 Hypothetical protein C1209 1,166,2021,166,597 0.035 0.16 9 (0.08) 18 (0.38) 26 HNH nuclease + S-type Pyocin UTI89_C4900 4,800,1114,800,587 0.035 0.17 9 (0.08)...”
VFFQA001_16790 DUF4123 domain-containing protein from Aliivibrio fischeri
Aligns to 5:119 / 266 (43.2%), covers 98.4% of PF13503, 83.3 bits
- The type-VI secretion system of the beneficial symbiont Vibrio fischeri
Guckes, Microbiology (Reading, England) 2023 - “...3 Predicated Function PAAR VFFQA001_15490 Sharpens spiked tip [ 112 ] DUF4123 Tap-1 VFFQA001_06835 VFFQA001_07830 VFFQA001_16790 Loads effector onto spike [ 113 ] VasH VFFQA001_15615 Promotes transcription of hcp [ 72 ] TasR VFFQA001_15540 Promotes transcription of hcp [ 97 ] TasL VFFQA001_15520 Promotes cell-cell contact...”
A4U42_RS15880 DUF4123 domain-containing protein from Dickeya solani IPO 2222
Aligns to 19:146 / 322 (39.8%), covers 99.2% of PF13503, 82.1 bits
PAKAF_03768 DUF4123 domain-containing protein from Pseudomonas aeruginosa PAK
Aligns to 18:139 / 282 (43.3%), covers 99.2% of PF13503, 79.4 bits
VASW_VIBCH / Q9KNE6 Accessory protein VasW from Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) (see paper)
VCA0019 hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 27:142 / 295 (39.3%), covers 93.5% of PF13503, 78.1 bits
- function: Plays an accessory role in VasX-mediated bacterial killing.
disruption phenotype: Deletion results in an attenuated phenotype towards V. parahaemolyticus. - Engineered Type Six Secretion Systems Deliver Active Exogenous Effectors and Cre Recombinase
Hersch, mBio 2021 - “..., and complemented with either tsiV2 (pImm) or a nonprotective chaperone gene as a control (VCA0019; pCtrl). Survival of the prey is shown as a ratio of recovered CFU numbers (pCtrl/pImm). One-way ANOVA with Sidaks multiple-comparison test comparing no plasmid WT or VasX-Cre delivery to controls....”
- Vibrio cholerae Response Regulator VxrB Controls Colonization and Regulates the Type VI Secretion System
Cheng, PLoS pathogens 2015 - “...vgrG-3 -1.50 0.00000 VCA0124 tsiV3 -1.72 0.00144 VCA0017 hcp2 -2.82 0.00000 VCA0018 vgrG-2 -1.22 0.41237 VCA0019 vasW 1.15 0.67767 VCA0020 vasX -1.33 0.11525 VCA0021 tsiV2 -1.38 0.11525 VC1415 hcp1 -3.02 0.00000 VC1416 vgrG-1 -1.12 0.50510 VC1417 -1.44 0.04444 VC1418 tseL -1.29 0.06289 VxrB regulates production of...”
- Chimeric adaptor proteins translocate diverse type VI secretion system effectors in Vibrio cholerae
Unterweger, The EMBO journal 2015 - “...superfamily in their genomes. For example, in addition to Tap-1, V.cholerae strain N16961 encodes VasW (VCA0019) ( Fig 1C ). We previously demonstrated that VasW is necessary for the secretion of and killing mediated by VasX, the pore-forming effector encoded directly downstream of vasW (Miyata etal...”
- Dual expression profile of type VI secretion system immunity genes protects pandemic Vibrio cholerae
Miyata, PLoS pathogens 2013 - “...(VCA0117) Kitaoka et al. , 2011 Vibrio cholerae , V52 vasW V52 mutant lacking vasW (VCA0019) This study Vibrio cholerae , V52 vgrG-3 V52 mutant lacking vgrG-3 (VCA0123) Pukatzki et al. , 2006 Vibrio cholerae , V52 tseL V52 mutant lacking tseL (VC1418) This study Vibrio...”
- “...study Vibrio cholerae , V52 vgrG -3 vasW V52 mutant lacking vgrG-3 (VCA0123) and vasW (VCA0019) This study Vibrio cholerae , V52 vasH vasX V52 mutant lacking vasH (VCA0117) and vasX (VCA0020) This study Vibrio cholerae , C6706 O1 El Tor, Sm R , Rif R...”
- Genetic analysis of anti-amoebae and anti-bacterial activities of the type VI secretion system in Vibrio cholerae
Zheng, PloS one 2011 - “...of VC1421 ( Fig. 4A ). Similarly, vgrG-2 and the three downstream open reading frames (VCA0019 to VCA0021) are predicted to use the same promoter and terminator ( Fig. 4A ). All proteins encoded in these putative vgrG-1 and vgrG-2 operons are uncharacterized proteins and most...”
- “...(VC1418) to get the mutant vc1418 . Similarly, we deleted all three genes following vgrG-2 (VCA0019 through VCA0021) to get the mutant vca1921 and deleted the single gene (VCA0020) to get the mutant vca0020 . We then examined the virulence of each of these mutants towards...”
- Vibrio cholerae requires the type VI secretion system virulence factor VasX to kill Dictyostelium discoideum
Miyata, Infection and immunity 2011 - “...small chromosome immediately downstream of hcp-2, vgrG-2, and VCA0019. 2944 MIYATA ET AL. FIG. 2. VasX expression depends on the T6SS regulator VasH. (A)...”
- “...Photobacterium damselae, and Aeromonas hydrophila. The hypothetical gene VCA0019 is located between vgrG-2 and vasX and also belongs to this T6SS gene cluster,...”
- VasH is a transcriptional regulator of the type VI secretion system functional in endemic and pandemic Vibrio cholerae
Kitaoka, Journal of bacteriology 2011 - “...Walker B qRT-PCR hcp-2 (VCA0017) vgrG-2 (VCA0018) vasW (VCA0019) vasX (VCA0020) vasH (VCA0117) vasK (VCA0120) ompW (VCA0867) a b F R F R...”
- “...of primers against VCA0017 (hcp-2), VCA0018 (vgrG-2), VCA0019 (hypothetical protein), VCA0020 (vasX), VCA0120 (vasK), VCA0117 (vasH), and VCA0867 (ompW) were...”
- Molecular characterization of a functional type VI secretion system from a clinical isolate of Aeromonas hydrophila
Suarez, Microbial pathogenesis 2008 - “...AHA_1827 80/85 VgrG protein COG3501, DUF586 3 VCA0019 52/38 Hypothetical protein 4 VCA0020 25/37 Hypothetical protein AHA_1828 Hypothetical protein AHA_1829...”
VFFQA001_06835 DUF4123 domain-containing protein from Aliivibrio fischeri
Aligns to 17:135 / 284 (41.9%), covers 98.4% of PF13503, 76.4 bits
- The type-VI secretion system of the beneficial symbiont Vibrio fischeri
Guckes, Microbiology (Reading, England) 2023 - “...Aux cluster 3 Predicated Function PAAR VFFQA001_15490 Sharpens spiked tip [ 112 ] DUF4123 Tap-1 VFFQA001_06835 VFFQA001_07830 VFFQA001_16790 Loads effector onto spike [ 113 ] VasH VFFQA001_15615 Promotes transcription of hcp [ 72 ] TasR VFFQA001_15540 Promotes transcription of hcp [ 97 ] TasL VFFQA001_15520 Promotes...”
VCV52_1391 hypothetical protein from Vibrio cholerae V52
VC1417 hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 27:141 / 286 (40.2%), covers 99.2% of PF13503, 72.7 bits
- Chimeric adaptor proteins translocate diverse type VI secretion system effectors in Vibrio cholerae
Unterweger, The EMBO journal 2015 - “...domain architecture retrieval tool (Geer etal , 2002 ) using the amino acid sequence of VCV52_1391 as a query. The nucleotide sequence of the gene encoding for DUF4123 superfamily proteins plus the surrounding region was downloaded from NCBI. Each annotated open reading frame was translated into...”
- Rules of Engagement: The Type VI Secretion System in Vibrio cholerae
Joshi, Trends in microbiology 2017 - “...1 , 44 ]. Auxiliary clusters 1 and 2 encode for the nearly identical hcp1 (VC1417) and hcp2 (VCA0017) genes, either of which is sufficient to produce Hcp and form the inner tube [ 44 ]. Auxiliary clusters 1 and 2 also encode for the VgrG-1...”
- A genomic island in Vibrio cholerae with VPI-1 site-specific recombination characteristics contains CRISPR-Cas and type VI secretion modules
Labbate, Scientific reports 2016 - “...of the vgrG gene indicates a function as an accessory loading proteins like tap -1 (VC1417 in the auxiliary 1 locus of V. cholerae V52), which is responsible for the loading of cargo effectors with antibacterial activity onto VgrG proteins 47 48 . Due to the...”
- Identification of divergent type VI secretion effectors using a conserved chaperone domain
Liang, Proceedings of the National Academy of Sciences of the United States of America 2015 - “...in V. cholerae (18). In this study, we report that VC1417, the gene upstream of tseL, encodes a protein with a highly conserved domain, DUF4123. We show that...”
- “...(VC1416) and TseL. Because of the genetic linkage of VC1417 and TseL and its importance for TseL secretion, we postulated that genes encoding the conserved...”
- Vibrio cholerae Response Regulator VxrB Controls Colonization and Regulates the Type VI Secretion System
Cheng, PLoS pathogens 2015 - “...vasX -1.33 0.11525 VCA0021 tsiV2 -1.38 0.11525 VC1415 hcp1 -3.02 0.00000 VC1416 vgrG-1 -1.12 0.50510 VC1417 -1.44 0.04444 VC1418 tseL -1.29 0.06289 VxrB regulates production of T6SS To further analyze the role of vxrB in T6SS expression and function, we compared the levels of the major...”
- Molecular weaponry: diverse effectors delivered by the Type VI secretion system
Alcoforado, Cellular microbiology 2015 - “...cognate effector protein and a specific VgrG to allow delivery of the effector, exemplified by VC1417 assisting VgrG1 dependent secretion of TseL in V.cholerae (Liang et al. , 2015 ; Unterweger et al ., 2015 ). Another member of this family, VasW, was earlier described as...”
- Chimeric adaptor proteins translocate diverse type VI secretion system effectors in Vibrio cholerae
Unterweger, The EMBO journal 2015 - “...) search against the non-redundant protein sequences was performed using the amino acid sequence of VC1417 as the query. The GC content of an indicated nucleotide sequence region and the percentage of identity among nucleotide or amino acid sequences were determined by the Geneious analysis tool...”
- Genetic analysis of anti-amoebae and anti-bacterial activities of the type VI secretion system in Vibrio cholerae
Zheng, PloS one 2011 - “...and Transterm [31] suggest that hcp-1 , vgrG-1 and the five downstream open reading frames (VC1417 to VC1421) use the same promoter upstream of hcp-1 and the same terminator downstream of VC1421 ( Fig. 4A ). Similarly, vgrG-2 and the three downstream open reading frames (VCA0019...”
- “...control to show the equal protein loading. We deleted all the five genes following vgrG-1 (VC1417 through VC1421) to get the mutant vc1721 and deleted the single gene (VC1418) to get the mutant vc1418 . Similarly, we deleted all three genes following vgrG-2 (VCA0019 through VCA0021)...”
PA3293 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 27:150 / 271 (45.8%), covers 95.9% of PF13503, 71.9 bits
DV114_RS04590 DUF4123 domain-containing protein from Neisseria subflava
Aligns to 22:152 / 180 (72.8%), covers 98.4% of PF13503, 70.4 bits
- Diversity of the type VI secretion systems in the Neisseria spp
Calder, Microbial genomics 2023 - “...subflava strain ATCC 49275 is homologous to DUF2169 and is adjacent to a vgrG . DV114_RS04590 in N. subflava M18660 is homologous to DUF4123 and is also adjacent to vgrG within a polymorphic toxin locus. Predicted protein sequences from these CDSs were used as queries in...”
AL066_23365 DUF4123 domain-containing protein from Pseudomonas nunensis
Aligns to 23:142 / 245 (49.0%), covers 94.3% of PF13503, 70.0 bits
PSPTO_3483 hypothetical protein from Pseudomonas syringae pv. tomato str. DC3000
Aligns to 18:139 / 282 (43.3%), covers 98.4% of PF13503, 66.4 bits
PSF113_0667 DUF4123 domain-containing protein from Pseudomonas ogarae
Aligns to 12:132 / 265 (45.7%), covers 98.4% of PF13503, 64.5 bits
c1884 Hypothetical protein from Escherichia coli CFT073
Aligns to 2:89 / 246 (35.8%), covers 69.1% of PF13503, 60.8 bits
Atu4349 hypothetical protein from Agrobacterium tumefaciens str. C58 (Cereon)
Q7CUQ0 DUF4123 domain-containing protein from Agrobacterium fabrum (strain C58 / ATCC 33970)
Aligns to 30:162 / 318 (41.8%), covers 97.6% of PF13503, 54.0 bits
- Agrobacterium tumefaciens Type IV and Type VI Secretion Systems Reside in Detergent-Resistant Membranes
Czolkoss, Frontiers in microbiology 2021 - “...* atu4347 Q7CUP8 Peptidoglycan amidase 2.19 0.027 Tssl-1 (VgrG) atu4348 A9CGH0 VgrG protein 1.68 0.019 Atu4349 * atu4349 Q7CUQ0 Unknown + 0.95 0.751 Atu4350 * atu4350 A9CGH1 Nuclease + + 1.18 0.490 Atu4351 * atu4351 Q7CUQ2 Unknown + 0.98 0.862 Atu4352 * atu4352 A9CGH2 Unknown Only...”
- Type VI Secretion Effectors: Methodologies and Biology
Lien, Frontiers in cellular and infection microbiology 2017 - “...al., 2015 ). Its chaperone feature is consistent with previous observation of a DUF4123-containing protein, Atu4349 in stabilizing the Tde1 effector in Agrobacterium tumefaciens and forming a complex with Tde1 co-purified from Escherichia coli (Ma et al., 2014 ). However, because of its requirement for TseL...”
- VgrG C terminus confers the type VI effector transport specificity and is required for binding with PAAR and adaptor-effector complex
Bondage, Proceedings of the National Academy of Sciences of the United States of America 2016 - “...proteins in determining VgrG-Tde specificity. Tap-1 (Atu4349) and PAAR Protein Atu4352 Are Required for Tde1Dependent Antibacterial Activity and...”
- “...(Fig. 5A), we hypothesized that in addition to VgrG1, Atu4349 and Atu4352 may play roles in Tde1 translocation. This hypothesis was indeed supported by our...”
- Agrobacterium tumefaciens deploys a superfamily of type VI secretion DNase effectors as weapons for interbacterial competition in planta
Ma, Cell host & microbe 2014 - “...of the protein in Escherichia coli . Atu4350 was then purified in the presence of Atu4349, which resulted in increased Atu4350 yield and stability ( Figures S2 A and S2B). Atu4350 did not display a detectable RNase activity invitro ( FigureS2 C). Instead, it showed a...”
- “...curve analysis. Atu4350 was produced from plasmid pTrc200, and the putative immunity protein Atu4351 or Atu4349 was constitutively expressed from plasmid pRL662 (A). Atu3640 was produced from plasmid pTrc200, and the putative immunity protein Atu3639 was constitutively expressed from plasmid pRL662 (B). (C) E . coli...”
- Systematic dissection of the agrobacterium type VI secretion system reveals machinery and secreted components for subcomplex formation
Lin, PloS one 2013 - “...NA Atu4347 NA NA NA NA TssI VgrG Atu4348 + VC1416/VgrG-1VCA0018/VgrG-2 VCA1023/VgrG-3 ++ EvpI + Atu4349 NA NA NA NA Atu4350 NA NA NA NA Atu4351 NA NA NA NA NA Atu4352 VCA0105 NA EvpJ TssI VgrG Atu3642 + VC1416/VgrG-1VCA0018/VgrG-2VCA1023/VgrG-3 ++ EvpI + NA NA VCA0113/SciN...”
- “...homolog [3] , atu4331 ( pppA ), and the non-conserved genes ( atu4346, atu4347 , atu4349 , atu4350 , atu4352 ) in the hcp operon does not significantly affect Hcp secretion under this growth condition ( Figure 2A ). Atu4347 is a Novel T6SS-secreted Exoprotein Hcp,...”
- Acid-induced type VI secretion system is regulated by ExoR-ChvG/ChvI signaling cascade in Agrobacterium tumefaciens
Wu, PLoS pathogens 2012 - “...analyzed by western blot analysis with antibodies against C-IcmF, Fha1 (filled arrow), Atu4343, ClpV, Hcp, Atu4349, and RpoA. The non-secreted protein RpoA was an internal control. The positions of molecular mass markers (in kDa) are indicated on the left. ( C ) Quantitative RT-PCR (qRT-PCR) analysis...”
- “...operon ( icmF, fha1, atu4343 ) and 3 by the hcp operon ( clpV, hcp, atu4349 ) with acidity (AB-MES, pH 5.5) ( Figure 1C ). As controls, 23S rRNA and chvH genes, known not to respond to pH change [32] , showed similar mRNA levels...”
- Agrobacterium tumefaciens Type IV and Type VI Secretion Systems Reside in Detergent-Resistant Membranes
Czolkoss, Frontiers in microbiology 2021 - “...Peptidoglycan amidase 2.19 0.027 Tssl-1 (VgrG) atu4348 A9CGH0 VgrG protein 1.68 0.019 Atu4349 * atu4349 Q7CUQ0 Unknown + 0.95 0.751 Atu4350 * atu4350 A9CGH1 Nuclease + + 1.18 0.490 Atu4351 * atu4351 Q7CUQ2 Unknown + 0.98 0.862 Atu4352 * atu4352 A9CGH2 Unknown Only + vir Only...”
AT730_RS04645 DUF4123 domain-containing protein from Vibrio alginolyticus
Aligns to 6:112 / 284 (37.7%), covers 87.8% of PF13503, 45.7 bits
- DUF1127-containing protein and ProQ had opposite effects on biofilm formation in Vibrio alginolyticus
Feng, BMC microbiology 2024 - “...ATP-dependent Clp protease ATP-binding subunit sRNACandidate_1-23 -0.5211 UCUUCUUUGCCAUCAGGGUAU AT730_RS00175 DUF1887 family protein sRNACandidate_1-24 -0.5117 UCGCAAUAUUCUUCAUCUGA AT730_RS04645 DUF4123 domain-containing protein sRNACandidate_1-25 -0.5308 UGGGGAACAGAUGUUAAUUCUAUCCCAACGCGC AT730_RS12260 L-malate glycosyltransferase sRNACandidate_1-26 -0.5765 AAGCUGAAGCACAAGAAGUUGAAGCUGAGCUUGAAGAGCUUGGUGAUGAGACAGACGCUAAGAUUGCUCAACUAGAAGCGGC AT730_RS14225 molecular chaperone GrpE sRNACandidate_1-27 -0.5921 UUCAUGGCUAUUGUUCCGCUCUGC AT730_RS06365 multiple antibiotic resistance protein sRNACandidate_1-28 -0.5685 GUUUAUGGUGCACGCUACCCAAG AT730_RS06365 multiple antibiotic...”
VFFQA001_07830 DUF4123 domain-containing protein from Aliivibrio fischeri
Aligns to 26:147 / 197 (61.9%), covers 99.2% of PF13503, 41.3 bits
Or search for genetic data about PF13503 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory