Family Search for PF13569 (DUF4132)

PF13569 hits 8 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

LIC12901 molybdate metabolism regulator from Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130
Aligns to 784:970 / 1616 (11.6%), covers 100.0% of PF13569, 181.2 bits

• Leptospiral outer membrane protein microarray, a novel approach to identification of host ligand-binding proteins
  Pinne, Journal of bacteriology 2012
  • “...Lic1_SPN3200, Lic10497, Lic11028, Lic11739, Lic11990, Lic12901, Lic10125, Lic10464, Lic10465, Lic11755, Lic12048, Lic12259, and Lic13101) were amplified...”
• Genome-wide subcellular localization of putative outer membrane and extracellular proteins in Leptospira interrogans serovar Lai genome using bioinformatics approaches
  Viratyosin, BMC genomics 2008
  • “...LRR containing protein/putative lipoprotein Q9RBS2 1ogq LA3322 LIC10830 LRR containing protein/putative lipoprotein Q9RBS2 1ogq LA0701 LIC12901 LRR containing protein/molybdate metabolism regulator Q9RBS2 1ogq LA2377 LIC11568 Peptidase, M23/M37/membrane associated peptidase P24204 1acc LA0505 LIC13050 Probable glycosyl hydrolase/conserved hypothetical protein - 1f00 LA3725 LIC10502 Probable phenazine biosynthesis family...”
• Comparative genomics of two Leptospira interrogans serovars reveals novel insights into physiology and pathogenesis
  Nascimento, Journal of bacteriology 2004
  • “...other hand, the genes corresponding to LIC10590, LIC10952, and LIC12901 in Copenhageni CI have been mutagenized by IS elements in Lai CI. Although some domains...”

molR molybdate metabolism regulator MolR from Escherichia coli K12 (see paper)
Aligns to 988:1173 / 1264 (14.7%), covers 100.0% of PF13569, 173.8 bits

EC958_2450 WGR and DUF4132 domain-containing protein from Escherichia coli O25b:H4-ST131
Aligns to 1000:1183 / 1266 (14.5%), covers 100.0% of PF13569, 171.0 bits

• Sequential Acquisition of Virulence and Fluoroquinolone Resistance Has Shaped the Evolution of Escherichia coli ST131
  Ben, mBio 2016
  • “...Putative peptide synthetase-like protein 2395814 C C T T T T T T T LP EC958_2450 556 Hypothetical protein 2686010 T T C C C C C C C 2692404 C C T T T T T T T CR EC958_5002 238 ypdB Hypothetical protein 2706426...”

C4N14_02505 DUF4132 domain-containing protein from Fusobacterium nucleatum subsp. nucleatum ATCC 23726
Aligns to 1356:1528 / 1720 (10.1%), covers 100.0% of PF13569, 166.5 bits

• A global survey of small RNA interactors identifies KhpA and KhpB as major RNA-binding proteins in Fusobacterium nucleatum
  Zhu, Nucleic acids research 2024
  • “...protein RpsO (C4N14_03125), DNA gyrase subunit A, GyrA (C4N14_02325), and a protein of unknown function (C4N14_02505), indicating that these proteins interact with the 6S RNA or 6S RNA-RNAP complex in F. nucleatum . Together, these data establish an RNA-centric strategy to uncover RNA-protein interactions in F....”

YehI / b2118 DUF4132 domain-containing protein YehI from Escherichia coli K-12 substr. MG1655
b2118 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 953:1138 / 1210 (15.4%), covers 98.9% of PF13569, 161.4 bits

• Complete genome sequence and comparative genomics of Shigella flexneri serotype 2a strain 2457T
  Wei, Infection and immunity 2003
  • “...b3946 b4187 b2070 b2372 b3837 b1377 b2074 b2337 b0900 b2118 b2491 b4227 b4365 b0535 b0663 b0135 b0938 b1031 b1502 b1835 b2108 b2333 b2335 b4364 b1948 b2259...”

DRA0166 hypothetical protein from Deinococcus radiodurans R1
DR_A0166 DUF4132 domain-containing protein from Deinococcus radiodurans R1 = ATCC 13939 = DSM 20539
Aligns to 1264:1434 / 1626 (10.5%), covers 99.4% of PF13569, 151.8 bits

• Characterization of the Radiation Desiccation Response Regulon of the Radioresistant Bacterium Deinococcus radiodurans by Integrative Genomic Analyses
  Eugénie, Cells 2021
  • “...no/no DR2173 DRO_2144 hypothetical protein 17 GTTATGCTCATGACATATG yes/yes 3,5 DRA0165 DRO_A0167 Putatively In operon with drA0166 Conserved hypothetical protein 83 GGTTATGCTATTTACATAAC yes/yes 5 DRC0023 DRO_C0021 hypothetical protein 193 CTTTGTTCTGTTAGCCTAAC no protein observed 3 ambiguous DRC0017 DRO_C0017 Putatively In operon with drC0018 transposase 248 TAGTATGCTTCTGGCGTAGT no protein...”
  • “...expression of C-terminal-tagged recombinant proteins. The cellular levels of five recombinant proteins (RecG, LigA, DdrN, DRA0166, and DR2173) increased in wild-type cells in response to MMC, but remained constant in an irrE mutant, thus corroborating our data ( Figure 8 ). We were not able to...”
• Probing the sORF-Encoded Peptides of Deinococcus radiodurans in Response to Extreme Stress
  Zhou, Molecular & cellular proteomics : MCP 2022
  • “...the gene location, DR_A0165 is close to the upstream gene DR_A0164 and the downstream gene DR_A0166 ( Fig.5 A ). To exclude its deletion effect on other genes, RTPCR validation of the SEP068184 mutant strain was performed, and the gene expression levels of DR_A0164 and DR_A0166...”

SCO1181 hypothetical protein from Streptomyces coelicolor A3(2)
Aligns to 25:203 / 284 (63.0%), covers 95.5% of PF13569, 99.2 bits

• Transcriptomic analysis of liquid non-sporulating Streptomyces coelicolor cultures demonstrates the existence of a complex differentiation comparable to that occurring in solid sporulating cultures
  Yagüe, PloS one 2014
  • “...Oxidoreductase 0.4 1.8 SCO4152 5-nucleotidase 0.7 1.1 SCO1134 Oxidoreductase 1.2 1.9 SCO4284 Deacetylase 0.5 1.1 SCO1181 Putative plasmid partition protein 2.2 1.2 SCO4577 Helicase DEAD-like 1.2 1.1 SCO1335 Oxidoreductase 1.7 0.2 SCO4701 30S ribosomal protein S10 1.2 1.5 SCO1343 Uracil-DNA glycosylase 1.2 0.3 SCO4702 50S ribosomal...”

B2904_orf2005 BspA family leucine-rich repeat surface protein from Brachyspira pilosicoli B2904
Aligns to 467:619 / 714 (21.4%), covers 78.2% of PF13569, 83.0 bits

• Evidence of homologous recombination as a driver of diversity in Brachyspira pilosicoli
  Pandey, Microbial genomics 2020
  • “..., peptidase BP951000_0437, peptidase C14, caspase catalytic subunit p20 BP951000_1779, probable metal-dependent glycoprotease B06 2 B2904_orf2005, lipoprotein B2904_orf651, lipoprotein B14 1 pep_A*, peptidase SAP_774 1 BP951000_2039, putative periplasmic binding protein B04 0 B12 0 SAP_859 0 SAP_865 0 B31 0 SAP_898 0 B37 0 Accession numbers,...”

Or search for genetic data about PF13569 in the Fitness Browser