Family Search for PF13689 (DUF4154)

PF13689.6 hits 8 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

PP4671 conserved hypothetical protein (NCBI ptt file) from Pseudomonas putida KT2440
Aligns to 42:182 / 188 (75.0%), covers 97.9% of PF13689, 116.8 bits

• Mechanisms of resistance to chloramphenicol in Pseudomonas putida KT2440
  Fernández, Antimicrobial agents and chemotherapy 2012
  • “...(M) PP3214 PP3297 PP3316 PP3455 (M) PP3797 (M) PP4671 PP4810 PP5066 (M) PP5087 pqqC (coenzyme PQQ synthesis protein C) pqqB (coenzyme PQQ synthesis protein...”

PFLU5211 hypothetical protein (RefSeq) from Pseudomonas fluorescens SBW25
Aligns to 44:184 / 190 (74.2%), covers 99.3% of PF13689, 113.7 bits

• Predicting mutational routes to new adaptive phenotypes
  Lind, eLife 2019
  • “...to envelope stress ( Malone et al., 2012 ). AwsO sequesters the periplasmic protein AwsX (PFLU5211) at the outer membrane. AwsX functions as a negative regulator of the DGC AwsR (PFLU5210) in the inner membrane. Both increased binding of AwsX to AwsO or loss of negative...”
  • “...PFLU1223 NA Gene wspF ; PFLU1224 NA Gene wspR ; PFLU1225 NA Gene awsX ; PFLU5211, yfiR NA Gene awsR ; PFLU5210, yfiN , tpbB NA Gene awsO ; PFLU5209, yfiB NA Gene mwsR ; PFLU5329, morA NA Gene wss; PFLU0300-PFL0309 NA Strain, strainbackground Pseudomonas fluorescens...”
• Evolutionary convergence in experimental Pseudomonas populations
  Lind, The ISME journal 2017
  • “...(wspF, a negative regulator of the DGC WspR) and PFLU5211 (awsX, a negative regulator of the DGC AwsR) were sequenced in the remaining PWS types (McDonald et...”
• Experimental evolution reveals hidden diversity in evolutionary pathways
  Lind, eLife 2015 (no snippet)
• Adaptive divergence in experimental populations of Pseudomonas fluorescens. IV. Genetic constraints guide evolutionary trajectories in a parallel adaptive radiation
  McDonald, Genetics 2009
  • “...by 11 insertions in a 2-kb region spanning pflu5211 (2 insertions) and pflu5210 (9 insertions). Comparison with DNA and protein sequence databases showed that...”
  • “...Together the genes form a putative operon termed aws (pflu5211 awsX, plfu5210 awsR, and pflu5209 awsO) (Figure 3). Mutations in the muc locus of P. aeruginosa...”
• Mutational activation of niche-specific genes provides insight into regulatory networks and bacterial function in a complex environment
  Giddens, Proceedings of the National Academy of Sciences of the United States of America 2007
  • “...amrZ (PFLU4744) (E); fleQ (PFLU4443) (F); and awsX (PFLU5211) (G). possible causes for the transcriptional activation of dapB: first, the transposon (of either...”

NP_249812 hypothetical protein from Pseudomonas aeruginosa PAO1
PA1121 hypothetical protein (NCBI) from Pseudomonas aeruginosa PAO1
Aligns to 45:185 / 190 (74.2%), covers 97.9% of PF13689, 111.0 bits

• Crystal structures of YfiR from Pseudomonas aeruginosa in two redox states.
  Yang, Biochemical and biophysical research communications 2015 (PubMed)
  • GeneRIF: Mutagenesis studies indicated that Cys145-Cys152 plays an important role in maintaining the correct folding of YfiR.
• Structural insights into YfiR sequestering by YfiB in Pseudomonas aeruginosa PAO1.
  Li, Scientific reports 2015
  • GeneRIF: YfiB is an outer membrane lipoprotein and presumed sensor protein that sequesters the repressor protein YfiR.
• Structural insights into YfiR sequestering by YfiB in Pseudomonas aeruginosa PAO1
  Li, Scientific reports 2015
  • “...products encoding YfiB(59168) were cloned into the vector pET-32a (GE Healthcare). The gene encoding YfiR (PA1121; gene ID AAG04510.1; residues 35190) was amplified from the genome of Pseudomonas aeruginosa PAO1 and then inserted into the expression vector pET-32a (GE Healthcare) using the restriction sites Bam HI...”
• The Cyclic AMP-Vfr Signaling Pathway in Pseudomonas aeruginosa Is Inhibited by Cyclic Di-GMP
  Almblad, Journal of bacteriology 2015
  • “...with mutations in wspF (PA3703) or yfiR (PA1121) are frequently isolated from cystic fibrosis patients afflicted with persistent pulmonary biofilm infections...”
  • “...with precise in-frame deletions in wspF (PA3703) and yfiR (PA1121) (7, 18). The RSCV phenotype of both strains was verified by plating the cells on CR plates...”
• Investigating the allosteric regulation of YfiN from Pseudomonas aeruginosa: clues from the structure of the catalytic domain
  Giardina, PloS one 2013
  • “...the name YfiN for coherence with the other two members of the operon PA1119 and PA1121 , which, in the Pseudomonas genome database ( http://www.pseudomonas.com/ ), are called YfiB and YfiR, respectively. Formation of SCVs depends on enhanced c-di-GMP output by YfiN, which elevates transcription of...”
• Cyclic di-GMP: the first 25 years of a universal bacterial second messenger
  Römling, Microbiology and molecular biology reviews : MMBR 2013
  • “...downstream processes (98, 192). The periplasmic protein YfiR (PA1121) from P. aeruginosa inhibits the activity of the DGC TpbB (YfiN; PA1120), which prevents...”
• Type IV pilus assembly in Pseudomonas aeruginosa over a broad range of cyclic di-GMP concentrations
  Jain, Journal of bacteriology 2012
  • “...Multiple suppressor mutations were mapped to PA0171, PA1121 (yfiR), and PA3703 (wspF), three genes previously associated with small-colony-variant phenotypes....”
  • “...insertion in PA0171 in PA103fimX Tn insertion in PA1121 in PA103fimX Tn insertion in PA3703 in PA103fimX PA103 with the arabinose-inducible plasmid PA103...”
• The YfiBNR signal transduction mechanism reveals novel targets for the evolution of persistent Pseudomonas aeruginosa in cystic fibrosis airways
  Malone, PLoS pathogens 2012
  • “...initial set of genomes displaying synteny conservation among homologs to PA1119 (GenBank:15596316), PA1120 (GenBank:15596317) and PA1121 (GenBank:15596318) from Pseudomonas aeruginosa PAO1 (GenBank:AE004091) was manually defined. Synteny conservation was assessed for complete microbial genomes of the RefSeq database on the MAGE database server [94] . The three...”
• The multiple signaling systems regulating virulence in Pseudomonas aeruginosa
  Jimenez, Microbiology and molecular biology reviews : MMBR 2012
  • “...identified a novel c-di-GMP-related operon, yfiBNR (PA1119 to PA1121), involved in the regulation of c-di-GMP levels (124). The operon encodes YfiB (an...”
• YfiBNR mediates cyclic di-GMP dependent small colony variant formation and persistence in Pseudomonas aeruginosa
  Malone, PLoS pathogens 2010
  • “...re-streaking without losing the SCV phenotype). Three independent transposon insertions were mapped to yfiR ( PA1121 ), the first gene of the predicted three-gene operon yfiBNR ( Figure 1A ). In silico analysis predicted that yfiN encodes a 47.5 kDa protein with two transmembrane helices flanking...”
• More

y3729 hypothetical protein (NCBI ptt file) from Yersinia pestis KIM
YPO0450 putative membrane protein (NCBI ptt file) from Yersinia pestis CO92
YPTB0593 putative membrane protein (NCBI) from Yersinia pseudotuberculosis IP 32953
Aligns to 61:201 / 207 (68.1%), covers 98.6% of PF13689, 110.5 bits

• The Yersinia pestis HmsCDE regulatory system is essential for blockage of the oriental rat flea (Xenopsylla cheopis), a classic plague vector
  Bobrov, Environmental microbiology 2015
  • “...In this study, we show that the DGC HmsD is controlled by two linked genes, y3729 ( hmsC ) and y3731 ( hmsE ), which likely encode inner membrane (IM) anchored and outer membrane (OM) proteins, respectively. A deletion of hmsC or overexpression of hmsE resulted...”
• Fur is a repressor of biofilm formation in Yersinia pestis
  Sun, PloS one 2012
  • “...the fur mutant fur AGACCGCCAACCTGAACTG/CAACGAAGAATAGCCACCTGAC Protein expression fur GCGGGATCCATGACTGACAACAACAAAG/GCGAAGCTTTTATCTTTTACTGTGTGCAGA Primer extension hmsH /TATTGTTGCAAAGTCATTATAGGAT hmsT /GGTATTTATTCCGACATCACGAC YPO0450 /AGTAGCGGTAGTCATTTTTACG LacZ reporter fusion hmsH GCGGGATCCACTTTGCTGAAGACTTGTCACG/GCGAAGCTTCCGCCATAGCAGGATTAACG hmsT GCGGAATTCGCCCAGTACAGGTAACAAGG/GCGGGATCCCTGATCGTAGGAGTGGCTATTC YPO0450 TCTGGATCCCTTACTGGTTGCTATTGCC/TCTAAGCTTGAGGTTCATGATGTTCATCA EMSA hmsH ACTTTGCTGAAGACTTGTCACG/CCGCCATAGCAGGATTAACG hmsT GCCCAGTACAGGTAACAAGG/CTGATCGTAGGAGTGGCTATTC YPO0450 CTTACTGGTTGCTATTGCC/GAGGTTCATGATGTTCATCA DNase I footprinting hmsT GCCCAGTACAGGTAACAAGG/TTTGTTTCAGCCTGTCATCATG CATGATGACAGGCTGAAACAAA/CTGATCGTAGGAGTGGCTATTC A PCR-generated DNA fragment containing the fur...”
  • “...Sore hmsT hmsT AATGATAATCATAACCAAT D-272254 15.07 AACAATAATAATTCCCAAC D-9577 8.74 hmsHFRS hmsH AATGATGATGAAATGGAAT R-9476 4.58 YPO0450-0448 YPO0450 AATAAGATTTAAGATAAAT D-139121 3.89 A PSSM [13] representing the conserved signals for Fur recognition in Y. pestis was used for the prediction of Fur-box like sequences within the 300 bp upstream...”
• Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
  Rosso, BMC microbiology 2008
  • “...exported protein 2.397 (< 0.001) YPTB0560 or0394 hypothetical protein 1.636 (0.028) 0.271 (< 0.001) YPTB0593 YPO0450 putative membrane protein 0.736 (0.025) 1.464 (0.007) YPTB0651 YPO0511 hypothetical protein 0.576 (0.02) YPTB0657 YPO0516 hypothetical protein 0.457 (0.001) YPTB0666 or4788 putative IS1400 transposase B 2.101 (< 0.001) YPTB0678 YPO0544...”
• Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
  Rosso, BMC microbiology 2008
  • “...putative exported protein 2.397 (< 0.001) YPTB0560 or0394 hypothetical protein 1.636 (0.028) 0.271 (< 0.001) YPTB0593 YPO0450 putative membrane protein 0.736 (0.025) 1.464 (0.007) YPTB0651 YPO0511 hypothetical protein 0.576 (0.02) YPTB0657 YPO0516 hypothetical protein 0.457 (0.001) YPTB0666 or4788 putative IS1400 transposase B 2.101 (< 0.001) YPTB0678...”

PA14_49880 hypothetical protein (NCBI) from Pseudomonas aeruginosa UCBPP-PA14
Aligns to 45:185 / 190 (74.2%), covers 97.9% of PF13689, 110.1 bits

• Connecting quorum sensing, c-di-GMP, pel polysaccharide, and biofilm formation in Pseudomonas aeruginosa through tyrosine phosphatase TpbA (PA3885)
  Ueda, PLoS pathogens 2009
  • “...Mutant 19 PA1120 PA14_49890 tpbB c-di-GMP cyclase, GGDEF motif 0.10 white smooth Mutant 4 PA1121 PA14_49880 Hypothetical protein 0.22 white smooth Mutant 11 PA1121 PA14_49880 Hypothetical protein 0.07 white smooth Mutant 2 PA1678 PA14_42790 Putative DNA methylase 0.30 white smooth Mutant 6 PA1678 PA14_42790 Putative DNA...”
  • “...Mar2xT7 , Gm R [46] PA14_50360 (PA1086, flgK ) PA14_50360 Mar2xT7 , Gm R [46] PA14_49880 (PA1121) PA14_49880 Mar2xT7 , Gm R [46] PA14_49890 (PA1120, tpbB ) PA14_49890 Mar2xT7 , Gm R [46] PA14_42820 (PA1678) PA14_42820 Mar2xT7 , Gm R [46] PA14_67780 (PA5132) PA14_67780 Mar2xT7 ,...”

YfiR / b2603 DUF4154 domain-containing protein YfiR from Escherichia coli K-12 substr. MG1655 (see 5 papers)
YFIR_ECOLI / P64548 Protein YfiR from Escherichia coli (strain K12) (see paper)
Z3897 orf, hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 EDL933
b2603 hypothetical protein (NCBI) from Escherichia coli str. K-12 substr. MG1655
ECs3466 hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
Aligns to 29:167 / 172 (80.8%), covers 96.5% of PF13689, 102.7 bits

• function: Repressor of the cell division arrest function of DgcN. Prevents DgcN relocation to the midcell.
• Disruption of rcsB by a duplicated sequence in a curli-producing Escherichia coli O157:H7 results in differential gene expression in relation to biofilm formation, stress responses and metabolism
  Sharma, BMC microbiology 2017
  • “...+1.57 0.05 fliC Z3013 Flagellin +2.54 2.4E-07 fliD Z3014 Flagellar capping protein +2.88 1.8E-07 yfiR Z3897 Periplasmic protein +1.55 0.03 Regulators ykgK Z0361 Negative regulator of motility 2.49 0.05 bssR Z1062 Biofilm formation regulatory protein +2.57 0.08 ydeH Z2163 Putative diguanylate cyclase 2.20 1.2E-05 bdm Z2229...”
• Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
  King, Applied and environmental microbiology 2010
  • “...b3242 b1995 b1650 ECs3449 ECs3466 ECs3893 b2583 b2603 b3009 Energy production and conversion ECs3081 b2190 ECs2359 ECs3396 ECs0128 ECs3328 ECs0503 ECs0880...”
• Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
  King, Applied and environmental microbiology 2010
  • “...ATR(s) ECs4115 ECs2792 b3242 b1995 b1650 ECs3449 ECs3466 ECs3893 b2583 b2603 b3009 Energy production and conversion ECs3081 b2190 ECs2359 ECs3396 ECs0128...”

SEN2592 hypothetical protein (RefSeq) from Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
SC2673 putative periplasmic protein (NCBI) from Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
Aligns to 29:167 / 172 (80.8%), covers 97.9% of PF13689, 99.8 bits

• Single nucleotide polymorphisms that differentiate two subpopulations of Salmonella enteritidis within phage type
  Guard, BMC research notes 2011
  • “...This location was confirmed by sequencing the beginning and end of the bacteriophage 3' to SEN2592 and 5' to SEN2623, respectively (data not shown); however, the complete bacteriophage sequence was not sequenced de novo . An additional benefit of interval mapping is that it appears to...”
• Isolation and characterization of ilvA, ilvBN, and ilvD mutants of Caulobacter crescentus
  Tarleton, Journal of bacteriology 1991
  • “...str-142 SC2224 ilvBN129::TnS-132 rif-175 SC2672 zzz::TnS iIvD+ SC2673 zzz::TnS iIvD+ SC2674 zzz::TnS ilvD+ SC2675 zzz::TnS iIvD+ SC3371 ilvBN102 rec-526...”

VF_A0058 hypothetical protein (RefSeq) from Vibrio fischeri ES114
Aligns to 45:185 / 193 (73.1%), covers 98.6% of PF13689, 87.4 bits

• Genetic determinants of swimming motility in the squid light-organ symbiont Vibrio fischeri
  Brennan, MicrobiologyOpen 2013
  • “...K L Incomplete flagellar structures VF_2174 can Carbonic anhydrase 80 NS 1 can Growth defect VF_A0058 Hypothetical protein 51 NS 1 A0059- A0058 -A0057 Unknown 16S rRNA 56 ND 3 Growth defect 23S rRNA 56 ND 3 Growth defect As the genome of V. fischeri ES114...”

Or search for genetic data about PF13689 in the Fitness Browser