Family Search for PF13689 (DUF4154)
PF13689 hits 13 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
PP4671 conserved hypothetical protein (NCBI ptt file) from Pseudomonas putida KT2440
Aligns to 42:182 / 188 (75.0%), covers 97.9% of PF13689, 116.6 bits
GIB65_04465 YfiR family protein from Pseudomonas lactis
Aligns to 42:182 / 188 (75.0%), covers 99.3% of PF13689, 113.5 bits
PFLU5211 hypothetical protein (RefSeq) from Pseudomonas fluorescens SBW25
Aligns to 44:184 / 190 (74.2%), covers 99.3% of PF13689, 113.2 bits
- Predicting mutational routes to new adaptive phenotypes.
Lind, eLife 2019 - “...to envelope stress ( Malone et al., 2012 ). AwsO sequesters the periplasmic protein AwsX (PFLU5211) at the outer membrane. AwsX functions as a negative regulator of the DGC AwsR (PFLU5210) in the inner membrane. Both increased binding of AwsX to AwsO or loss of negative...”
- “...PFLU1223 NA Gene wspF ; PFLU1224 NA Gene wspR ; PFLU1225 NA Gene awsX ; PFLU5211, yfiR NA Gene awsR ; PFLU5210, yfiN , tpbB NA Gene awsO ; PFLU5209, yfiB NA Gene mwsR ; PFLU5329, morA NA Gene wss; PFLU0300-PFL0309 NA Strain, strainbackground Pseudomonas fluorescens...”
- Evolutionary convergence in experimental Pseudomonas populations
Lind, The ISME journal 2017 - “...(wspF, a negative regulator of the DGC WspR) and PFLU5211 (awsX, a negative regulator of the DGC AwsR) were sequenced in the remaining PWS types (McDonald et...”
- Experimental evolution reveals hidden diversity in evolutionary pathways.
Lind, eLife 2015 - “...negative regulator wspF (PFLU1224) deletion, insertion, stop, frameshift, amino acid substitution previous work * awsX (PFLU5211) deletion, insertion, stop, frameshift, amino acid substitution previous work * Intragenic negative regulator mwsR (PFLU5329) deletion, insertion, amino acid substitution previous work * PFLU0085 deletion, insertion, amino acid substitution 43...”
- Adaptive divergence in experimental populations of Pseudomonas fluorescens. IV. Genetic constraints guide evolutionary trajectories in a parallel adaptive radiation
McDonald, Genetics 2009 - “...by 11 insertions in a 2-kb region spanning pflu5211 (2 insertions) and pflu5210 (9 insertions). Comparison with DNA and protein sequence databases showed that...”
- “...Together the genes form a putative operon termed aws (pflu5211 awsX, plfu5210 awsR, and pflu5209 awsO) (Figure 3). Mutations in the muc locus of P. aeruginosa...”
- Mutational activation of niche-specific genes provides insight into regulatory networks and bacterial function in a complex environment
Giddens, Proceedings of the National Academy of Sciences of the United States of America 2007 - “...amrZ (PFLU4744) (E); fleQ (PFLU4443) (F); and awsX (PFLU5211) (G). possible causes for the transcriptional activation of dapB: first, the transposon (of either...”
GIB64_26910 YfiR family protein from Pseudomonas lactis
Aligns to 42:182 / 188 (75.0%), covers 99.3% of PF13689, 112.0 bits
5eb2A / Q9I4L4 Trp-bound yfir (see paper)
Aligns to 8:148 / 153 (92.2%), covers 97.9% of PF13689, 111.5 bits
- Ligand: tryptophan (5eb2A)
y3729 hypothetical protein (NCBI ptt file) from Yersinia pestis KIM
YPO0450 putative membrane protein (NCBI ptt file) from Yersinia pestis CO92
YPK_3615 hypothetical protein (RefSeq) from Yersinia pseudotuberculosis YPIII
YPTB0593 putative membrane protein (NCBI) from Yersinia pseudotuberculosis IP 32953
Aligns to 61:201 / 207 (68.1%), covers 98.6% of PF13689, 110.5 bits
- The Yersinia pestis HmsCDE regulatory system is essential for blockage of the oriental rat flea (Xenopsylla cheopis), a classic plague vector
Bobrov, Environmental microbiology 2015 - “...In this study, we show that the DGC HmsD is controlled by two linked genes, y3729 ( hmsC ) and y3731 ( hmsE ), which likely encode inner membrane (IM) anchored and outer membrane (OM) proteins, respectively. A deletion of hmsC or overexpression of hmsE resulted...”
- Fur is a repressor of biofilm formation in Yersinia pestis
Sun, PloS one 2012 - “...the fur mutant fur AGACCGCCAACCTGAACTG/CAACGAAGAATAGCCACCTGAC Protein expression fur GCGGGATCCATGACTGACAACAACAAAG/GCGAAGCTTTTATCTTTTACTGTGTGCAGA Primer extension hmsH /TATTGTTGCAAAGTCATTATAGGAT hmsT /GGTATTTATTCCGACATCACGAC YPO0450 /AGTAGCGGTAGTCATTTTTACG LacZ reporter fusion hmsH GCGGGATCCACTTTGCTGAAGACTTGTCACG/GCGAAGCTTCCGCCATAGCAGGATTAACG hmsT GCGGAATTCGCCCAGTACAGGTAACAAGG/GCGGGATCCCTGATCGTAGGAGTGGCTATTC YPO0450 TCTGGATCCCTTACTGGTTGCTATTGCC/TCTAAGCTTGAGGTTCATGATGTTCATCA EMSA hmsH ACTTTGCTGAAGACTTGTCACG/CCGCCATAGCAGGATTAACG hmsT GCCCAGTACAGGTAACAAGG/CTGATCGTAGGAGTGGCTATTC YPO0450 CTTACTGGTTGCTATTGCC/GAGGTTCATGATGTTCATCA DNase I footprinting hmsT GCCCAGTACAGGTAACAAGG/TTTGTTTCAGCCTGTCATCATG CATGATGACAGGCTGAAACAAA/CTGATCGTAGGAGTGGCTATTC A PCR-generated DNA fragment containing the fur...”
- “...Sore hmsT hmsT AATGATAATCATAACCAAT D-272254 15.07 AACAATAATAATTCCCAAC D-9577 8.74 hmsHFRS hmsH AATGATGATGAAATGGAAT R-9476 4.58 YPO0450-0448 YPO0450 AATAAGATTTAAGATAAAT D-139121 3.89 A PSSM [13] representing the conserved signals for Fur recognition in Y. pestis was used for the prediction of Fur-box like sequences within the 300 bp upstream...”
- Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Rosso, BMC microbiology 2008 - “...exported protein 2.397 (< 0.001) YPTB0560 or0394 hypothetical protein 1.636 (0.028) 0.271 (< 0.001) YPTB0593 YPO0450 putative membrane protein 0.736 (0.025) 1.464 (0.007) YPTB0651 YPO0511 hypothetical protein 0.576 (0.02) YPTB0657 YPO0516 hypothetical protein 0.457 (0.001) YPTB0666 or4788 putative IS1400 transposase B 2.101 (< 0.001) YPTB0678 YPO0544...”
- Cpx-signalling facilitates Hms-dependent biofilm formation by Yersinia pseudotuberculosis
Gahlot, NPJ biofilms and microbiomes 2022 - “...YPK_4131 ( cpxP ), YPK_2241 ( hmsH ),YPK_3638 ( hmsT ), YPK_0094 ( hmsP ), YPK_3615 ( hmsC ), YPK_2238 ( hmsS ), YPK_1182 ( rpoE ), YPK_1090 ( nlpE ), YPK_1551 ( ackA ), YPK_1550 ( pta ), YPK_0004 ( gyrB ), YPK_0341 ( rpoC...”
- Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Rosso, BMC microbiology 2008 - “...putative exported protein 2.397 (< 0.001) YPTB0560 or0394 hypothetical protein 1.636 (0.028) 0.271 (< 0.001) YPTB0593 YPO0450 putative membrane protein 0.736 (0.025) 1.464 (0.007) YPTB0651 YPO0511 hypothetical protein 0.576 (0.02) YPTB0657 YPO0516 hypothetical protein 0.457 (0.001) YPTB0666 or4788 putative IS1400 transposase B 2.101 (< 0.001) YPTB0678...”
Q9I4L4 YfiR from Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
NP_249812 hypothetical protein from Pseudomonas aeruginosa PAO1
PA1121 hypothetical protein (NCBI) from Pseudomonas aeruginosa PAO1
Aligns to 45:185 / 190 (74.2%), covers 97.9% of PF13689, 110.5 bits
- A Shaving Proteomic Approach to Unveil Surface Proteins Modulation of Multi-Drug Resistant Pseudomonas aeruginosa Strains Isolated From Cystic Fibrosis Patients
Montemari, Frontiers in medicine 2022 - “...Uncharacterized protein 100 100 Q9I6N0 PA0259 Uncharacterized protein 100 100 Q9I7A2 PA0028 Uncharacterized protein 0.01 Q9I4L4 yfiR YfiR 100 Q9HXN9 PA3756 YkuD domain-containing protein 100 100 Q9I5J7 PA0732 YkuD domain-containing protein 0.01 Q9HT54 PA5519 HotDog ACOT-type domain-containing protein Periplasmic/Cytoplasmic 0.01 Q9HU45 PA5139 PBPb domain-containing protein 0.451...”
- Crystal structures of YfiR from Pseudomonas aeruginosa in two redox states.
Yang, Biochemical and biophysical research communications 2015 (PubMed)- GeneRIF: Mutagenesis studies indicated that Cys145-Cys152 plays an important role in maintaining the correct folding of YfiR.
- Structural insights into YfiR sequestering by YfiB in Pseudomonas aeruginosa PAO1.
Li, Scientific reports 2015 - GeneRIF: YfiB is an outer membrane lipoprotein and presumed sensor protein that sequesters the repressor protein YfiR.
- Genome-wide protein-DNA interaction site mapping in bacteria using a double-stranded DNA-specific cytosine deaminase
Gallagher, Nature microbiology 2022 - “...of and in the same operon as PA2870 encoding a c-di-GMP biosynthetic enzyme) and yfiR (PA1121), which encodes a regulator of c-di-GMP synthesis 27 (Fig. 3g and Supplementary Table 1 ). To test explicitly whether PA3340, PA2869, PA2870 and yfiR are controlled by FleQ, we compared...”
- Bacteriophage-mediated interference of the c-di-GMP signalling pathway in Pseudomonas aeruginosa
De, Microbial biotechnology 2021 - “...2010 ). It is part of the yfiBNR operon, where the small periplasmic protein, YfiR (PA1121), negatively regulates YfiN and the OmpA/Pallike outermembrane lipoprotein YfiB counteracts this effect (Giardina et al ., 2013 ). Stressinduced depression results in a conformational change within YfiN (Fig. 5 ,...”
- The Cyclic AMP-Vfr Signaling Pathway in Pseudomonas aeruginosa Is Inhibited by Cyclic Di-GMP
Almblad, Journal of bacteriology 2015 - “...with mutations in wspF (PA3703) or yfiR (PA1121) are frequently isolated from cystic fibrosis patients afflicted with persistent pulmonary biofilm infections...”
- “...with precise in-frame deletions in wspF (PA3703) and yfiR (PA1121) (7, 18). The RSCV phenotype of both strains was verified by plating the cells on CR plates...”
- Structural insights into YfiR sequestering by YfiB in Pseudomonas aeruginosa PAO1
Li, Scientific reports 2015 - “...products encoding YfiB(59168) were cloned into the vector pET-32a (GE Healthcare). The gene encoding YfiR (PA1121; gene ID AAG04510.1; residues 35190) was amplified from the genome of Pseudomonas aeruginosa PAO1 and then inserted into the expression vector pET-32a (GE Healthcare) using the restriction sites Bam HI...”
- Investigating the allosteric regulation of YfiN from Pseudomonas aeruginosa: clues from the structure of the catalytic domain
Giardina, PloS one 2013 - “...the name YfiN for coherence with the other two members of the operon PA1119 and PA1121 , which, in the Pseudomonas genome database ( http://www.pseudomonas.com/ ), are called YfiB and YfiR, respectively. Formation of SCVs depends on enhanced c-di-GMP output by YfiN, which elevates transcription of...”
- Cyclic di-GMP: the first 25 years of a universal bacterial second messenger
Römling, Microbiology and molecular biology reviews : MMBR 2013 - “...downstream processes (98, 192). The periplasmic protein YfiR (PA1121) from P. aeruginosa inhibits the activity of the DGC TpbB (YfiN; PA1120), which prevents...”
- Type IV pilus assembly in Pseudomonas aeruginosa over a broad range of cyclic di-GMP concentrations
Jain, Journal of bacteriology 2012 - “...Multiple suppressor mutations were mapped to PA0171, PA1121 (yfiR), and PA3703 (wspF), three genes previously associated with small-colony-variant phenotypes....”
- “...insertion in PA0171 in PA103fimX Tn insertion in PA1121 in PA103fimX Tn insertion in PA3703 in PA103fimX PA103 with the arabinose-inducible plasmid PA103...”
- The multiple signaling systems regulating virulence in Pseudomonas aeruginosa
Jimenez, Microbiology and molecular biology reviews : MMBR 2012 - “...identified a novel c-di-GMP-related operon, yfiBNR (PA1119 to PA1121), involved in the regulation of c-di-GMP levels (124). The operon encodes YfiB (an...”
- More
PA14_49880 hypothetical protein (NCBI) from Pseudomonas aeruginosa UCBPP-PA14
Aligns to 45:185 / 190 (74.2%), covers 97.9% of PF13689, 109.6 bits
- BosR: A novel biofilm-specific regulator in Pseudomonas aeruginosa
Dostert, Frontiers in microbiology 2022 - “...domain-containing protein 8.5 PA14_28130 (bswR) Bacterial swarming regulator 220.5 PA14_30650 gacA Two-component response regulator 2.6 PA14_49880 (yfiR) B Tripartite signaling repressor 52.0 PA14_50180 fleR Two-component response regulator 9.1 PA14_52570 rsmA Carbon storage regulator 319.8 PA14_59790 pvrR A Two-component response regulator 3.1 PA14_59800 pvrS A Two-component kinase...”
- Connecting quorum sensing, c-di-GMP, pel polysaccharide, and biofilm formation in Pseudomonas aeruginosa through tyrosine phosphatase TpbA (PA3885)
Ueda, PLoS pathogens 2009 - “...Mutant 19 PA1120 PA14_49890 tpbB c-di-GMP cyclase, GGDEF motif 0.10 white smooth Mutant 4 PA1121 PA14_49880 Hypothetical protein 0.22 white smooth Mutant 11 PA1121 PA14_49880 Hypothetical protein 0.07 white smooth Mutant 2 PA1678 PA14_42790 Putative DNA methylase 0.30 white smooth Mutant 6 PA1678 PA14_42790 Putative DNA...”
- “...Mar2xT7 , Gm R [46] PA14_50360 (PA1086, flgK ) PA14_50360 Mar2xT7 , Gm R [46] PA14_49880 (PA1121) PA14_49880 Mar2xT7 , Gm R [46] PA14_49890 (PA1120, tpbB ) PA14_49890 Mar2xT7 , Gm R [46] PA14_42820 (PA1678) PA14_42820 Mar2xT7 , Gm R [46] PA14_67780 (PA5132) PA14_67780 Mar2xT7 ,...”
YfiR / b2603 DUF4154 domain-containing protein YfiR from Escherichia coli K-12 substr. MG1655 (see 5 papers)
YFIR_ECOLI / P64548 Protein YfiR from Escherichia coli (strain K12) (see paper)
Z3897 orf, hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 EDL933
b2603 hypothetical protein (NCBI) from Escherichia coli str. K-12 substr. MG1655
ECs3466 hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
Aligns to 29:167 / 172 (80.8%), covers 96.5% of PF13689, 103.0 bits
SEN2592 hypothetical protein (RefSeq) from Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
SC2673 putative periplasmic protein (NCBI) from Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
Aligns to 29:167 / 172 (80.8%), covers 97.9% of PF13689, 99.5 bits
ETAE_1906 hypothetical protein (RefSeq) from Edwardsiella tarda EIB202
Aligns to 45:180 / 183 (74.3%), covers 97.2% of PF13689, 91.3 bits
- Dysregulation of Cytosolic c-di-GMP in Edwardsiella piscicida Promotes Cellular Non-Canonical Ferroptosis
Wen, Frontiers in cellular and infection microbiology 2022 - “...Yang etal., 2017 ) E. piscicida 1906 strain was constructed by unmarked depletion of gene ETAE_1906 in EIB202 strain while E. piscicida 1906I 1905 was constructed by depletion of gene ETAE_1905 in mutant 1906I. All the E. piscicida strains were inoculated at 1:100 and cultured statically...”
- “...used to confirming the mutants. Primer pairs for generating upstream and downstream fragments of gene ETAE_1906 or ETAE_1905 are listed in Table S1 . Generation of Mlkl-Knockout Cell Lines Lentiviral CRISPR/Cas9 targeting guide RNA expressing vector (lentiCRISPRv2) was obtained from Addgene (#52961). The mlkl knockout target...”
VF_A0058 hypothetical protein (RefSeq) from Vibrio fischeri ES114
Aligns to 45:185 / 193 (73.1%), covers 98.6% of PF13689, 85.5 bits
HMPREF0010_03702 YfiR family protein from Acinetobacter baumannii ATCC 19606 = CIP 70.34 = JCM 6841
Aligns to 31:164 / 167 (80.2%), covers 95.1% of PF13689, 83.0 bits
Or search for genetic data about PF13689 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory