Family Search for PF13937 (DUF4212)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

PF13937 hits 11 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

VC2704 hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 9:86 / 88 (88.6%), covers 98.7% of PF13937, 121.4 bits

• Growth in a biofilm induces a hyperinfectious phenotype in Vibrio cholerae
  Tamayo, Infection and immunity 2010
  • “...of VC1334 In-frame deletion of VC1516 In-frame deletion of VC2704 In-frame deletion of VC2705 In-frame deletion of VCA0676 In-frame deletion of VCA0682 55 11 54...”
  • “...VC1516 Allelic exchange vector for in-frame deletion of VC2704 Allelic exchange vector for in-frame deletion of VC2705 Allelic exchange vector for in-frame...”
• Genetic analysis of Vibrio cholerae monolayer formation reveals a key role for DeltaPsi in the transition to permanent attachment
  Van, Journal of bacteriology 2008
  • “...internal, unmarked deletion pWM91 carrying a fragment of VC2704 harboring an internal, unmarked deletion pWM91 carrying a fragment of VC2705 harboring an...”
  • “...TGCGGCCGCTCGTAAGTGCAGGATATGGTGGAAT CATGGATGTGCATGTGTTCA Construction of V. cholerae VC2704 deletion P431 P432 P433 P434 Forward primer for upstream fragment...”

VIBHAR_00159 hypothetical protein from Vibrio harveyi ATCC BAA-1116
Aligns to 27:104 / 105 (74.3%), covers 100.0% of PF13937, 121.0 bits

• Hierarchical Transcriptional Control of the LuxR Quorum-Sensing Regulon of Vibrio harveyi
  Chaparian, Journal of bacteriology 2020 (secret)

RSP_0577 hypothetical protein from Rhodobacter sphaeroides 2.4.1
Aligns to 8:85 / 86 (90.7%), covers 98.7% of PF13937, 120.0 bits

• A cluster of four homologous small RNAs modulates C1 metabolism and the pyruvate dehydrogenase complex in Rhodobacter sphaeroides under various stress conditions
  Billenkamp, Journal of bacteriology 2015
  • “...RSP_0572, 6 RSP_0574, 4 RSP_0575, 3 RSP_0576, 2 RSP_0577, 1 Genes with good correlation of bioinformatic predictions and gene expression data RSP_6132 (pqqA)...”
• An integrated approach to reconstructing genome-scale transcriptional regulatory networks
  Imam, PLoS computational biology 2015
  • “...are depicted in the heat map for brevity. RSP_0490 (carbohydrate kinase), RSP_3372 (TRAP-T family transporter), RSP_0577 (hypothetical protein), RSP_1420 (TRAP-T family transporter), RSP_1613 (TRAP-T family transporter), RSP_2401 (putative 6-aminohexanoate-cyclic-dimer hydrolase), RSP_2508 (Methylcrotonyl-CoA carboxylase beta chain), RSP_1883 (ABC polyamine/opine transporter), RSP_2506 (Isovaleryl-CoA dehydrogenase), RSP_3168 (ABC transporter), RSP_3169...”

Sama_1522 small component of lactate uptake system from Shewanella amazonensis SB2B
Aligns to 9:86 / 88 (88.6%), covers 98.7% of PF13937, 119.3 bits

• mutant phenotype: PFam PF13937.2 (DUF4212). conserved cofit with Sama_1523

VP2868 hypothetical protein from Vibrio parahaemolyticus RIMD 2210633
Aligns to 9:86 / 87 (89.7%), covers 100.0% of PF13937, 119.3 bits

• Bacteriostatic effects of benzyl isothiocyanate on Vibrio parahaemolyticus: Transcriptomic analysis and morphological verification
  Liu, BMC biotechnology 2021
  • “...VP1892 Methyl-accepting chemotaxis protein 0.82761 0.02157 DOWN Hypothetical protein VP1677 Hypothetical protein 1.9793 0.20439E-10 UP VP2868 Hypothetical protein 1.4143 0.00015 UP VP1679 Hypothetical protein 1.1181 0.02512 UP VP1238 Hypothetical protein 0.88005 0.58264E-4 DOWN VPA0208 Hypothetical protein 0.87862 0.11346 DOWN VP0962 Hypothetical protein 0.84754 0.07430 UP VPA1370...”

Shew_2372 small component of L-lactate and L-malate uptake system from Shewanella loihica PV-4
Aligns to 9:86 / 88 (88.6%), covers 98.7% of PF13937, 119.1 bits

• mutant phenotype: PFam PF13937.2 (DUF4212). conserved cofit with Shew_2371

HP15_1252 small component of pyruvate transporter (TIGR03647) from Marinobacter adhaerens HP15
Aligns to 9:86 / 88 (88.6%), covers 98.7% of PF13937, 116.5 bits

• mutant phenotype: The data for HP15_1252 is noisy, but it is important for pyruvate utilization, and is 74% identical to Psest_0346, which is also important for pyruvate utilization. HP15_1252 belongs to TIGR03647, which was predicted to be the small subunit of a transporter.

Psest_0346 small component of pyruvate/D-alanine transporter (TIGR03647) from Pseudomonas stutzeri RCH2
Aligns to 9:86 / 87 (89.7%), covers 98.7% of PF13937, 107.0 bits

• mutant phenotype: Important for utilization of D-alanine and pyruvate, along with Psest_0347. Belongs to TIGR03647, which was predicted to be the small subunit of a transporter.

MCR_1286 DUF4212 domain-containing protein from Moraxella catarrhalis BBH18
Aligns to 9:86 / 88 (88.6%), covers 96.2% of PF13937, 106.4 bits

• Comparative Genomic Analyses of the Moraxella catarrhalis Serosensitive and Seroresistant Lineages Demonstrate Their Independent Evolution
  Earl, Genome biology and evolution 2016
  • “...Association analyses for the Detroit 562 adherence phenotype showed that two genes ( MCR_1831 and MCR_1286 , encoding a type I restriction modification DNA specificity protein and a membrane protein-like protein, respectively) were present in the high binding SS isolate N1 and absent from all other...”

BP2479 putative integral membrane protein from Bordetella pertussis Tohama I
Aligns to 12:86 / 90 (83.3%), covers 92.4% of PF13937, 89.7 bits

• Detection of small RNAs in Bordetella pertussis and identification of a novel repeated genetic element
  Hot, BMC genomics 2011
  • “...190 > 425 BP1878 < BP1879 > TranscriptD1 bprD1 2624007 2624157 150 90 < 783 BP2479 < BP2480 > TranscriptD2 bprD2 2624007 2624157 150 110 < 783 BP2479 < BP2480 > TranscriptE1 bprE1 2699394 2699487 93 70 > 239 BP2546 < BP2547 > TranscriptE2 bprE2 2699394...”

HVO_A0155 hypothetical protein from Haloferax volcanii DS2
Aligns to 41:122 / 145 (56.6%), covers 98.7% of PF13937, 74.0 bits

• Acetate Metabolism in Archaea: Characterization of an Acetate Transporter and of Enzymes Involved in Acetate Activation and Gluconeogenesis in Haloferax volcanii
  Kuprat, Frontiers in microbiology 2020
  • “...cluster was identified that comprises four genes ( ssf , acs7 , uspA28 , and HVO_A0155) encoding a putative acetate-transporter designated ActP ( ac etate t ransport p rotein) of the sodium: solute symporter family (SSF), a putative AMP-forming acetyl-CoA synthetase (ACS7), a putative universal stress...”
  • “...nucleotides in acetate-grown cells that corresponds to the sum of the four genes acs7 , HVO_A0155, ssf and uspA (4625 nucleotides) indicating co-transcription of the genes ( Figure 1B ). No transcript could be detected in cells grown on glucose and casamino acids indicating an acetate-specific...”

Or search for genetic data about PF13937 in the Fitness Browser