Family Search for PF14309 (DUF4378)

PF14309 hits 27 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

NP_177556 LONGIFOLIA protein from Arabidopsis thaliana
AT1G74160 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 820:1002 / 1025 (17.9%), covers 100.0% of PF14309, 144.1 bits

• TRM4 is essential for cellulose deposition in Arabidopsis seed mucilage by maintaining cortical microtubule organization and interacting with CESA3.
  Yang, The New phytologist 2019
  • GeneRIF: The results indicate that TRM4 is essential for microtubule array organization and therefore correct cellulose orientation in the SCE cells, as well as the establishment of the subsequent mucilage architecture.
• Functionally redundant LNG3 and LNG4 genes regulate turgor-driven polar cell elongation through activation of XTH17 and XTH24.
  Lee, Plant molecular biology 2018 (PubMed)
  • GeneRIF: LONGIFOLIA related genes play an important role in polar cell elongation by changing turgor pressure and controlling the activation of XTH17 and XTH24. [LNG3]
• Genetic control of tolerance to drought stress in soybean
  Saleem, BMC plant biology 2022
  • “...regulator of ABA signalling) [ 94 ] WUE 4, WUE 5, interbrach 2, DTF Glyma.06G204400 AT1G74160 LONGIFOLIA protein (cellulose deposition) [ 95 , 96 ] N/A AGRmax-Yr_SDS_3 Gm17_39250897_39530897 AX-93866910_A_C 7.1 <0.01 0.01 AGRmax-Yr_SDS_4 Gm18_54299774_54659774 AX-93883955_T_A 4.6 0.09 -0.04 Glyma.18G259700 AT5G15250 (FTSH6) FtsH protease 6 (thylakoid membrane...”
• TRM4 is essential for cellulose deposition in Arabidopsis seed mucilage by maintaining cortical microtubule organization and interacting with CESA3
  Yang, The New phytologist 2019
  • “...by AtGenexpress (Schmid etal ., 2005 ; Zou & Hastie, 2005 ), we found TRM4 (AT1G74160) to be coexpressed with RHM2 and ARA12/SBT1.7 (Usadel etal ., 2004 ; Western etal ., 2004 ; Rautengarten etal ., 2008 ). Using the Genemania tool (WardeFarley etal ., 2010...”
• Reactive oxygen species and transcript analysis upon excess light treatment in wild-type Arabidopsis thaliana vs a photosensitive mutant lacking zeaxanthin and lutein
  Alboresi, BMC plant biology 2011
  • “...At4g08150 -2,85 -0,97 -0,23 -1,98 1,33 0,25 -0,10 -0,38 KNAT1_BP__KNAT1 (BREVIPEDICELLUS 1); transcription factor 259903_at At1g74160 -2,34 -0,72 0,26 -0,26 0,16 0,05 0,25 -0,58 unknown protein 262783_at At1g10850 -2,47 -0,37 -0,27 0,07 0,41 -0,21 -0,67 -0,10 ATP binding/protein serine/threonine kinase 261883_at At1g80870 -2,43 -0,48 -0,55 -0,36...”

NP_001322622 LONGIFOLIA protein from Arabidopsis thaliana
Aligns to 780:955 / 978 (18.0%), covers 100.0% of PF14309, 142.4 bits

• Functionally redundant LNG3 and LNG4 genes regulate turgor-driven polar cell elongation through activation of XTH17 and XTH24.
  Lee, Plant molecular biology 2018 (PubMed)
  • GeneRIF: LONGIFOLIA related genes play an important role in polar cell elongation by changing turgor pressure and controlling the activation of XTH17 and XTH24. [LNG4]

AT1G18620 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 816:991 / 1014 (17.4%), covers 100.0% of PF14309, 142.3 bits

• Molecular Network for Regulation of Ovule Number in Plants.
  Qadir, International journal of molecular sciences 2021
  • “...REM22 AT3G46770 DELLA interactor protein that mediates GA-regulate [ 27 , 56 ] Arabidopsis LNG4 AT1G18620 Regulation of monopolar cell growth [ 27 , 57 ] Arabidopsis , Rice GA20OX3 AT5G07200 gibberellin biosynthetic process [ 14 , 27 , 52 , 58 ] Arabidopsis , Tomato...”
• TRM4 is essential for cellulose deposition in Arabidopsis seed mucilage by maintaining cortical microtubule organization and interacting with CESA3
  Yang, The New phytologist 2019
  • “...cells was consistent with eFP browser data (Fig. S1 k). Within the A.thaliana genome, AtTRM3 (AT1G18620) is the closest paralog of AtTRM4 , sharing 62% amino acid identity (Fig. S2 ). Phylogenetic analysis of the whole TRM gene family revealed that AtTRM4 and AtTRM3 cluster together...”

LNG1_ARATH / Q9LF24 Protein LONGIFOLIA 1; Protein TON1 RECRUITING MOTIF 2 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
NP_197062 longifolia1 from Arabidopsis thaliana
AT5G15580 LNG1 (LONGIFOLIA1) (RefSeq) from Arabidopsis thaliana
Aligns to 721:904 / 927 (19.8%), covers 100.0% of PF14309, 137.7 bits

• function: In association with LNG2, regulates leaf morphology by promoting longitudinal polar cell elongation independently of ROT3.
  subunit: Interacts (via C-terminus) with TON1A and TON1B.
  disruption phenotype: No visible phenotype under normal growth conditions, but the lng1 and lng2 double mutant shows reduced length of cotyledons, rosette leaves, siliques and flowers.
• Functional conservation of Arabidopsis LNG1 in tobacco relating to leaf shape change by increasing longitudinal cell elongation by overexpression.
  Lee, Genes & genomics 2018 (PubMed)
  • GeneRIF: Results from molecular and cellular examination show that AtLNG1 have a conserved functional role in shaping leaf morphology in both Arabidopsis and tobacco.
• Effects of mutations in the Arabidopsis Cold Shock Domain Protein 3 (AtCSP3) gene on leaf cell expansion.
  Yang, Journal of experimental botany 2012
  • GeneRIF: AtCSP3 is functionally linked to the regulation of leaf length by affecting LNG1 transcript accumulation during leaf development.
• LONGIFOLIA1 and LONGIFOLIA2, two homologous genes, regulate longitudinal cell elongation in Arabidopsis.
  Lee, Development (Cambridge, England) 2006 (PubMed)
  • GeneRIF: Results indicate that LONGIFOLIA1 (LNG1) and LNG2 are new components that regulate leaf morphology by positively promoting longitudinal polar cell elongation independently of ROT3 in Arabidopsis [LNG1] [LONGIFOLIA1]
• Genetic and signalling pathways of dry fruit size: targets for genome editing-based crop improvement
  Hussain, Plant biotechnology journal 2020
  • “...2014 ) GhWBC1 Cotton AY255521.1 ATPbindingcassette transporter Zhu et al. ( 2003 ) LNG1 Arabidopsis AT5G15580 Unidimensional cell growth Lee et al. ( 2013 ) LNG2 Arabidopsis AT3G02170 Unidimensional cell growth Lee et al. ( 2013 ) AXY3/XYL1 Arabidopsis AT1G68560 Glycoside hydrolase family 3 Gnl and...”
• Auxin promotion of seedling growth via ARF5 is dependent on the brassinosteroid-regulated transcription factors BES1 and BEH4
  Galstyan, Plant direct 2019
  • “...XTH14 (At4g25820), XTH17 (At1g65310), XTH18 (At4g30280), XTH19 (At4g30290), XTH26 (At4g28850), XTH31 (At3g44990), XTH32 (At2g36870), LNG1 (At5g15580), PIF7 (At5g61270), ACT2 (At3g18780), and housekeeping geneHK (At1g13320). 2.4 Hypocotyl measurements Seedlings were grown vertically on square plates with 0.5 LS media supplemented with 80% ethanol (mock), 5M picloram, or...”
• Simultaneous knockdown of six non-family genes using a single synthetic RNAi fragment in Arabidopsis thaliana
  Czarnecki, Plant methods 2016
  • “...Arabidopsis plant without generating a lethal phenotype; they were: AtHY2 (At3g09150) [ 50 ], AtLNG1 (At5g15580) [ 51 ], AtTRY (At5g53200) [ 52 ], AtMAX3 (At2g44990) [ 53 ], AtNPQ1 (At1g08550) [ 54 ], AtSEX1 (At1g10760) [ 55 ] and AtGUN4 (At3g59400) [ 58 ]. The...”
• Natural Variations in SLG7 Regulate Grain Shape in Rice
  Zhou, Genetics 2015
  • “...but only two of them, LONGIFOLIA1 (LNG1, At5g15580) and LONGIFOLIA12 (LNG2, At3g02170), were functionally characterized. Both of them activate longitudinal...”
  • “...(Figure 3), including two functionally characterized genes, LNG1 (At5g15580) and LNG2 (At3g02170), both of which function in the elongation of leaves, siliques,...”
• Analysis of peptide PSY1 responding transcripts in the two Arabidopsis plant lines: wild type and psy1r receptor mutant
  Mahmood, BMC genomics 2014
  • “...NGA4 (AT4G01500), Peroxidase 52 (PRX52, AT5G05340), Sweet 12 (AT5G23660), AT5G46080, NDR1-like 3 (AT5G06320), Longifolia 1 (AT5G15580) and AT5G21910. The Longifolia 1 is known to regulate longitudinal cell elongation in Arabidopsis thaliana [ 36 ]. The finding of TGTATATAT in differentially expressed genes of psy1r mutant plants...”
• Genome-wide identification of KANADI1 target genes
  Merelo, PloS one 2013
  • “...2,37E-43 3,80E-29 yes yes AT3G02170 LNG2 3204 3955 UP 5,3 2,9 3,08E-11 6,67E-07 yes yes AT5G15580 LNG1 4944 in CDS 10,7 2,6 1,57E-12 3,27E+06 yes yes AT5G61960 AML1 2123 2369 UP 5,6 1,4 3,33E-34 4,59E-06 yes yes AT5G61960 AML1 2265 in CDS 6,8 3,1 5,15E-23 3,05E-10...”
• Hypocotyl transcriptome reveals auxin regulation of growth-promoting genes through GA-dependent and -independent pathways
  Chapman, PloS one 2012
  • “...associated with growth, such as ARGOS (AT3G59900) and ARGOS-LIKE (AT2G44080)] [80] , [81] , LONGIFOLIA1 (AT5G15580) and LNG2 (AT3G02170) [82] and several EXPANSIN and EXPANSIN-LIKE genes ( Table S6 ) [83] , [84] , [85] . The matrix maps highlight a significant overlap between PIF-regulated genes...”

AT5G02390 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 664:830 / 835 (20.0%), covers 99.4% of PF14309, 130.8 bits

• Suppression of ASKβ (AtSK32), a Clade III Arabidopsis GSK3, Leads to the Pollen Defect during Late Pollen Development
  Dong, Molecules and cells 2015
  • “...Dietrich et al. (2008) At3g50310 0.8480 MKKK20 Pollen sperm cells - Borg et al. (2011) At5g02390 0.8380 DAU1 Pollen sperm cells - Borg et al. (2011) At2g18080 0.8340 EDA2 - - - At5g53520 0.8290 ATOPT8 Pollen sperm cells - Borg et al. (2011) At1g18750 0.8290 AGL65...”
• Transcriptional profiling of Arabidopsis root hairs and pollen defines an apical cell growth signature
  Becker, BMC plant biology 2014
  • “...14.0 Unknown 249185_at At5g43030 DC1 domain-containing protein 346 487 X 4.8 4.0 5.6 Unknown 251047_at At5g02390 similar to unknown protein (TAIR:AT1G07620.1) 388 321 X 4.6 5.2 4.0 Unknown 252987_at At4g38390 Similar to unknown protein (TAIR:AT1G76270.1) 106 423 5.5 Unknown 254972_at At4g10440 Dehydration-responsive family protein 135 144...”
• Functional gene-mining for salt-tolerance genes with the power of Arabidopsis
  Du, The Plant journal : for cell and molecular biology 2008
  • “...independent lines Predicted function Arabidopsis homolog (bp/aa) % Similarity (cDNA/aa) ST2-4 EU714083 494/62 1 Unknown At5G02390 (2508/836) 83/87 ST5-18-1 EU714084 462/82 3 beta-carotene hydroxylase At4G25700 (1210/311) 83/97 ST6-32 EU714085 668/136 2 eIF-5A At1G26630 (897160) 90/89 ST7-5-1 EU714086 471/140 6 NAC domain-containing protein, BTF3b-like transcription factor At1G73230...”

LNG2_ARATH / Q9S823 Protein LONGIFOLIA 2; Protein TON1 RECRUITING MOTIF 1 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AT3G02170 LNG2 (LONGIFOLIA2) (RefSeq) from Arabidopsis thaliana
NP_566165 longifolia2 from Arabidopsis thaliana
Aligns to 721:901 / 905 (20.0%), covers 99.4% of PF14309, 124.7 bits

• function: In association with LNG1, regulates leaf morphology by promoting longitudinal polar cell elongation independently of ROT3. Associates with microtubules and recruits TON1A and TON1B to the cytoskeleton through its C-terminus.
  subunit: Interacts (via C-terminus) with TON1A and TON1B.
  disruption phenotype: No visible phenotype under normal growth conditions, but the lng1 and lng2 double mutant shows reduced length of cotyledons, rosette leaves, siliques and flowers.
• Genetic and signalling pathways of dry fruit size: targets for genome editing-based crop improvement
  Hussain, Plant biotechnology journal 2020
  • “...) LNG1 Arabidopsis AT5G15580 Unidimensional cell growth Lee et al. ( 2013 ) LNG2 Arabidopsis AT3G02170 Unidimensional cell growth Lee et al. ( 2013 ) AXY3/XYL1 Arabidopsis AT1G68560 Glycoside hydrolase family 3 Gnl and Pauly ( 2011 ) CALS7 Arabidopsis AT1G06490 Callose synthase 7 Xie et...”
• Deacclimation after cold acclimation-a crucial, but widely neglected part of plant winter survival
  Vyse, Journal of experimental botany 2019
  • “...1.6663 Gamma tonoplast intrinsic protein 12 AT2G37180 2.7700 3.1986 1.6462 Aquaporin-like superfamily protein, PIPC2 13 AT3G02170 1.4330 3.7024 1.4636 Longifolia2 14 AT3G15950 1.4650 1.5050 1.4558 DNA topoisomerase-like protein 15 AT3G16420 1.4900 5.2012 1.2374 PYK10-binding protein 1 16 AT3G16460 1.3650 5.3848 1.3225 Mannose-binding lectin superfamily protein 17...”
• Natural Variations in SLG7 Regulate Grain Shape in Rice
  Zhou, Genetics 2015
  • “...them, LONGIFOLIA1 (LNG1, At5g15580) and LONGIFOLIA12 (LNG2, At3g02170), were functionally characterized. Both of them activate longitudinal organ expansion (Lee...”
  • “...two functionally characterized genes, LNG1 (At5g15580) and LNG2 (At3g02170), both of which function in the elongation of leaves, siliques, and seeds in...”
• Genome-wide identification of KANADI1 target genes
  Merelo, PloS one 2013
  • “...5,5 2,5 1,19E-32 2,38E-16 AT4G37590 NPY5 979 1452 UP 9,9 5,0 2,37E-43 3,80E-29 yes yes AT3G02170 LNG2 3204 3955 UP 5,3 2,9 3,08E-11 6,67E-07 yes yes AT5G15580 LNG1 4944 in CDS 10,7 2,6 1,57E-12 3,27E+06 yes yes AT5G61960 AML1 2123 2369 UP 5,6 1,4 3,33E-34 4,59E-06...”
• Hypocotyl transcriptome reveals auxin regulation of growth-promoting genes through GA-dependent and -independent pathways
  Chapman, PloS one 2012
  • “...such as ARGOS (AT3G59900) and ARGOS-LIKE (AT2G44080)] [80] , [81] , LONGIFOLIA1 (AT5G15580) and LNG2 (AT3G02170) [82] and several EXPANSIN and EXPANSIN-LIKE genes ( Table S6 ) [83] , [84] , [85] . The matrix maps highlight a significant overlap between PIF-regulated genes and auxin targets...”
• The relationship of drought-related gene expression in Arabidopsis thaliana to hormonal and environmental factors
  Huang, Journal of experimental botany 2008
  • “...At2g46650 Cytochrome b 5, putative [(B5 #1)] 1.195 At2g47600 Magnesium/proton exchanger (MHX1) [(ATMHX, ATMHX1)] 1.349 At3g02170 Expressed protein 0.748 At3g06770 Glycoside hydrolase family 28 protein/polygalacturonase (pectinase) family protein 0.727 At3g15530 Expressed protein 1.614 At3g21670 Nitrate transporter (NTP3) 1.724 At3g26510 Octicosapeptide/Phox/Bem1p (PB1) domain-containing protein 2.433 At3g28180 Glycosyl...”
• LONGIFOLIA1 and LONGIFOLIA2, two homologous genes, regulate longitudinal cell elongation in Arabidopsis.
  Lee, Development (Cambridge, England) 2006 (PubMed)
  • GeneRIF: Results indicate that LONGIFOLIA1 (LNG1) and LNG2 are new components that regulate leaf morphology by positively promoting longitudinal polar cell elongation independently of ROT3 in Arabidopsis [LNG2].

AT4G28760 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 751:917 / 924 (18.1%), covers 100.0% of PF14309, 108.5 bits

• Identification of nitrogen starvation-responsive microRNAs in Arabidopsis thaliana
  Liang, PloS one 2012
  • “...Length +N N Fold(log2)(N/+N) Target Target Annotation miRN01 TGAGAGAAGGAATTAGATTCA 21 22 18 0.3 At3g60830 Unknown At4g28760 miRN02 CTTGAGGAGGTGTATAGAGGTTA 23 6 8 0.4 - miRN03 TTTTACTGCTACTTGTGTTCC 21 9 13 0.5 At3g09010 Protein kinase miRN04 ATACTGAAGATGAAACTAGCT 21 6 6 0 At1g75280 Isoflavone reductase miRN05 TAGTGTTTTTTATGGATCGTCTA 23 12 28...”

Q9M2F2 GPI-anchored adhesin-like protein from Arabidopsis thaliana
AT3G58650 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 654:804 / 820 (18.4%), covers 100.0% of PF14309, 104.9 bits

• Identification of Candidate Ergosterol-Responsive Proteins Associated with the Plasma Membrane of Arabidopsis thaliana.
  Khoza, International journal of molecular sciences 2019
  • “...protein At3g19340 Q8RWC3 --- Aminopeptidase 1219.632 0.9 229.5 5.94 A12 Putative uncharacterized protein F14P22.240 At3g58650 Q9M2F2 Growth --- 472.288 1.1 160.4 1.04 A12 Putative uncharacterized protein F3A4.21 At3g50130 Q9SN05 --- --- 472.288 1.1 160.4 0.92 A2 Uncharacterized protein At4g38260 F4JTM0 --- --- 1245.520 5.2 142.3 0.98...”
• Identification of Candidate Ergosterol-Responsive Proteins Associated with the Plasma Membrane of Arabidopsis thaliana.
  Khoza, International journal of molecular sciences 2019
  • “...uncharacterized protein At3g19340 Q8RWC3 --- Aminopeptidase 1219.632 0.9 229.5 5.94 A12 Putative uncharacterized protein F14P22.240 At3g58650 Q9M2F2 Growth --- 472.288 1.1 160.4 1.04 A12 Putative uncharacterized protein F3A4.21 At3g50130 Q9SN05 --- --- 472.288 1.1 160.4 0.92 A2 Uncharacterized protein At4g38260 F4JTM0 --- --- 1245.520 5.2 142.3...”
• SSD1, which encodes a plant-specific novel protein, controls plant elongation by regulating cell division in rice
  Asano, Proceedings of the Japan Academy. Series B, Physical and biological sciences 2010
  • “...( Physcomitrella patens ) and fern ( Selaginella moellendorffii ). Three putative homologous genes, At5g26910, At3g58650, and At3g05750, which shared around 30% amino acid sequence identity with the SSD1 protein, were identified in the Arabidopsis genome. Putative SSD1 homologous genes were also identified from the genomes...”

AT5G26910 hypothetical protein (RefSeq) from Arabidopsis thaliana
Q6NQ74 At5g26910 from Arabidopsis thaliana
Aligns to 673:820 / 853 (17.4%), covers 100.0% of PF14309, 104.2 bits

• High density SNP mapping and QTL analysis for time of leaf budburst in Corylus avellana L
  Torello, PloS one 2018
  • “...l1 (RECQI1) Q9FT74 AT3G05740 3.2e-232 63.8 79.0 00690 17.2 Corav_g6392.t1 GPI-anchored adhesin-like protein (TRM8) Q6NQ74 AT5G26910 4.9e-101 39.2 62.6 00690 17.2 Corav_g6393.t1 Calmodulin-binding protein (DUF1645) AR781 AT2G15760 9.8e-14 37.9 53.8 09783 17.3 Corav_g27951.t1 Inorganic H pyrophosphatase family protein (AVP1) P31414 AT1G15690 0.00094 45.5 71.2 09783 17.3...”
• SSD1, which encodes a plant-specific novel protein, controls plant elongation by regulating cell division in rice
  Asano, Proceedings of the Japan Academy. Series B, Physical and biological sciences 2010
  • “...moss ( Physcomitrella patens ) and fern ( Selaginella moellendorffii ). Three putative homologous genes, At5g26910, At3g58650, and At3g05750, which shared around 30% amino acid sequence identity with the SSD1 protein, were identified in the Arabidopsis genome. Putative SSD1 homologous genes were also identified from the...”
• High density SNP mapping and QTL analysis for time of leaf budburst in Corylus avellana L
  Torello, PloS one 2018
  • “...helicase l1 (RECQI1) Q9FT74 AT3G05740 3.2e-232 63.8 79.0 00690 17.2 Corav_g6392.t1 GPI-anchored adhesin-like protein (TRM8) Q6NQ74 AT5G26910 4.9e-101 39.2 62.6 00690 17.2 Corav_g6393.t1 Calmodulin-binding protein (DUF1645) AR781 AT2G15760 9.8e-14 37.9 53.8 09783 17.3 Corav_g27951.t1 Inorganic H pyrophosphatase family protein (AVP1) P31414 AT1G15690 0.00094 45.5 71.2 09783...”

XP_015647277 protein LONGIFOLIA 1 from Oryza sativa Japonica Group
Aligns to 740:913 / 940 (18.5%), covers 100.0% of PF14309, 102.8 bits

• Copy number variation at the GL7 locus contributes to grain size diversity in rice.
  Wang, Nature genetics 2015 (PubMed)
  • GeneRIF: Data indicate that cloned GL7 protein was mapped to Os07g0603300 (LOC_ Os07g41200), and elevated expression of GL7 increases grain length.

AT1G07620 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 402:547 / 552 (26.4%), covers 98.8% of PF14309, 97.8 bits

• The Arabidopsis KH-Domain RNA-Binding Protein ESR1 Functions in Components of Jasmonate Signalling, Unlinking Growth Restraint and Resistance to Stress
  Thatcher, PloS one 2015
  • “...Protein of unknown function (DUF506) AT1G02470 3.7 5.6E-05 Polyketide cyclase/dehydrase and lipid transport superfamily protein AT1G07620 ATOBGM 2.3 5.7E-05 GTP-binding protein Obg/CgtA AT2G11810 MGDC 2.3 6.3E-05 monogalactosyldiacylglycerol synthase type C AT5G08760 2.1 6.9E-05 Unknown AT1G07400 2.1 7.4E-05 HSP20-like chaperones superfamily protein AT1G60110 3.1 1.1E-04 Mannose-binding lectin...”
• Synergistic use of plant-prokaryote comparative genomics for functional annotations
  Gerdes, BMC genomics 2011
  • “...C1402 methyltransferase (modification within P site of ribosome) 836 [ 84 ] (2010) 13 At5g18570 At1g07620 0536 Iojap At5g18570 predicted to be plastidial, At1g07615 mitochondrial. Association evidence connects At5g18570 with plastidial iojap (At3g12930) Essential for embryo development but specific function unclear 721 [ 85 ] (2009)...”

AT5G62170, NP_201023 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 488:650 / 703 (23.2%), covers 100.0% of PF14309, 94.6 bits

• An examination of targeted gene neighborhoods in strawberry
  Davis, BMC plant biology 2010
  • “...factor NP_568952 E = 1.3e-22 At5g62165 EU024863 52I20 3 unknown protein NP_201023 E = 6.9e-19 At5g62170 EU024863 52I20 6a DNA binding/binding/protein binding/zinc ion binding NP_567188 E = 1.2e-44 At4g00790 EU024863 52I20 6b unknown protein NP_567189 E = 0 At4g00800 EU024864 53J04 3 unknown protein NP_564783 E...”
  • “...(AGAMOUS LIKE 42); transcription factor NP_568952 E = 1.3e-22 At5g62165 EU024863 52I20 3 unknown protein NP_201023 E = 6.9e-19 At5g62170 EU024863 52I20 6a DNA binding/binding/protein binding/zinc ion binding NP_567188 E = 1.2e-44 At4g00790 EU024863 52I20 6b unknown protein NP_567189 E = 0 At4g00800 EU024864 53J04 3...”

AT3G05750 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 646:792 / 801 (18.4%), covers 100.0% of PF14309, 92.1 bits

• Identification of New Proteins and Potential Mitochondrial F1F0-ATPase Inhibitor Factor 1-Associated Mechanisms in Arabidopsis thaliana Using iTRAQ-Based Quantitative Proteomic Analysis.
  Chen, Plants (Basel, Switzerland) 2021
  • “...1.25 JAL30_ARATH PYK10-binding protein 1 PBP1 1.2 A0A178VSK5_ARATH Uncharacterized protein At2g41150 1.25 A0A178VBA5_ARATH Glutaredoxin-dependent peroxiredoxin At3g05750 1.21 RL61_ARATH 60S ribosomal protein L6-1 RPL6A 1.26 A0A178V6D3_ARATH Phenylalanyl-tRNA synthetase At3g52700 1.21 A0A178WET2_ARATH - - 1.22 A0A178VVV5_ARATH THF1 At2g16340 1.21 D7MSA7_ARALL Uncharacterized protein ARALYDRAFT_918349 1.47 A0A178V4T2_ARATH HMA domain-containing protein...”
• SSD1, which encodes a plant-specific novel protein, controls plant elongation by regulating cell division in rice
  Asano, Proceedings of the Japan Academy. Series B, Physical and biological sciences 2010
  • “...patens ) and fern ( Selaginella moellendorffii ). Three putative homologous genes, At5g26910, At3g58650, and At3g05750, which shared around 30% amino acid sequence identity with the SSD1 protein, were identified in the Arabidopsis genome. Putative SSD1 homologous genes were also identified from the genomes of Sorghum...”

AT2G39435 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 312:459 / 464 (31.9%), covers 99.4% of PF14309, 84.4 bits

• Phloem Proteomics Reveals New Lipid-Binding Proteins with a Putative Role in Lipid-Mediated Signaling
  Barbaglia, Frontiers in plant science 2016
  • “...rice PUTATIVE RECEPTOR COMPONENTS 14-3-3 proteins At1g22300 At2g10450 28; 9 X Arabidopsis, rice PIG-P-like protein At2g39435 50 PtdOH, DAG BEACH domain containing protein At1g03060 400 Contains PH domain; PInsPs? Broccoli OTHER LIPID-INTERACTING PROTEINS WITH POSSIBLE ROLES IN LIPID-MOVEMENT Long-chain-fatty-acid-CoA ligase family protein At2g04350 68 Lipid metabolism...”
  • “...expression and purification A cDNA clones for GDSL-lipase (At1g29660), U13183; PLAFP (At4g39730), U21720; and PIG-P (At2g39435) were obtained from Arabidopsis Biological Resource Centre, Ohio State University (Columbus, OH, USA). The coding regions of GDSL-lipase, PLAFP, and PIG-P excluding the 78 and 69 nucleotide regions encoding the...”
• Identification of lipids and lipid-binding proteins in phloem exudates from Arabidopsis thaliana
  Guelette, Journal of experimental botany 2012
  • “...3 family protein At4g16820 58 Aspartic protease At4g04460 56 GRP17 (oleosin) At5g07530 53 Putative PIG-P At2g39435 50 Sqd1 At4g33030 44 Putative lipase/hydrolase At1g29660 40 Annexin At1g35720 36 Putative 3--hydroxysteroid dehydratase/isomerase At2g37660 35 Lipid-associated family protein At4g39730 20 Bet vI allergen At1g23130 18 GRP7 At2g21660 17 Two...”
• New aspects of Phloem-mediated long-distance lipid signaling in plants
  Benning, Frontiers in plant science 2012
  • “...56 Yes LNDENADMVPLK Glycine-rich protein (oleosin) GRP17 At5g07530 53 Yes KKKCMSGGMSGSEEGMSGSEGGMSSGGGSK DNPPPAGLPPNSGAGAGGAQSLIKKSK KSMSGGMSGSEEGMSGSEGGMSSGGGSK Put. PIG-P At2g39435 50 No YDQQNFKSK GDSL motiv Lipase/hydrolase At1g29660 40 Yes ITFSGQVENYK Annexin* At1g35720 36 Yes TGTDEGALTR YGDDHGEEILK TLDKELSNDFER TSTQLLHAR 14-3-3-like protein GF14 epsilon psi At1g22300 28 Yes ILSSIEQK At2g10450 9 DSTLIMQLLP...”
• Proteomic analyses of apoplastic proteins from germinating Arabidopsis thaliana pollen
  Ge, Biochimica et biophysica acta 2011
  • “...0.00052 5.03 Yes 59 AT1G36940 ** unknown protein 0.0074 Non-classical Secreted. 0.0024 1.33 Yes 67 AT2G39435 ** unknown protein 0.043 Non-classical Secreted. 0.0027 2.37 No 56 AT2G24070 ** unknown protein 0.022 Non-classical Secreted. 0.0034 3.55 Yes 92 AT1G15415 Unknown protein 2.30E-05 Non-classical Secreted. 0.00085 22.74 No...”

AT2G45900 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 556:701 / 720 (20.3%), covers 99.4% of PF14309, 84.1 bits

• Transcriptional mechanisms associated with seed dormancy and dormancy loss in the gibberellin-insensitive sly1-2 mutant of Arabidopsis thaliana
  Nelson, PloS one 2017
  • “...At2g31730 bHLH154 -0.68 DOWN At5g52830 WRKY27 At5g67480 BT4 -1.81 1.48 DOWN UP 1.06 2.57 UP At2g45900 Exp-PT1 -0.93 0.95 DOWN UP 0.89 1.22 UP At2g34340 Exp-PT2 0.82 UP At4g36410 UBC17 At4g19700 RING a Putative DELLA targets identified in Zentella et al. [ 24 ]; targets significantly...”
• Highly efficient isolation of Populus mesophyll protoplasts and its application in transient expression assays
  Guo, PloS one 2012
  • “...4A ). For gibberellin responses, POPTR_14s08030 was chosen because it is a close homologue of At2g45900 , a direct target of the DELLA protein that can be induced by GA treatment in Arabidopsis [32] . An approximately 4-fold increase of its expression was observed in response...”

Q0D9B8 Os06g0728200 protein from Oryza sativa subsp. japonica
Aligns to 755:918 / 931 (17.6%), covers 98.8% of PF14309, 78.9 bits

• Global analysis of lysine acetylation suggests the involvement of protein acetylation in diverse biological processes in rice (Oryza sativa)
  Nallamilli, PloS one 2014
  • “...containing protein A K(ac) DLLECINHVQ k631 Q2R286 Retrotransposon protein, Ty3-gypsy subclass ISPTRDVYCPIQ K(ac) TKNHDLSSCKVFLSAMK k157 Q0D9B8 Os06g0728200 Hypothetical protein EGNMEEFLEEV K(ac) ERL K(ac) KELK K381, k385 C7J3B8 Os06g0515301 protein FAGGSRDTCAKLSGC K(ac) IVDGNC K(ac) PPYVHHTLHPEAGK k60, k67 Q6F2N5 ZOS5-08 - C2H2 zinc finger protein, expressed KHGAKPFACRRCAKPFAV K(ac)...”

LOC119365239 uncharacterized protein LOC119365239 from Triticum dicoccoides
Aligns to 700:847 / 854 (17.3%), covers 98.8% of PF14309, 71.6 bits

• Genetic Insight Into the Insect Resistance in Bread Wheat Exploiting the Untapped Natural Diversity
  Arif, Frontiers in genetics 2022
  • “..., wsnp_Ra_c28955_38371323 , IAAV3303 , Tdurum_contig66317_77 106.8107.8 Serine racemase ( Elaeis guineensis ), uncharacterized protein LOC119365239 and 119365272 ( Triticum dicoccoides ), 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase, chloroplastic-like ( Triticum dicoccoides ), BEACH domain-containing protein C2-like isoform X3 ( Triticum dicoccoides ), hypothetical protein CFC21_031208 ( Triticum aestivum )...”

AT3G61380 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 547:696 / 718 (20.9%), covers 99.4% of PF14309, 67.9 bits

• Dataset of Arabidopsis plants that overexpress FT driven by a meristem-specific KNAT1 promoter
  Duplat-Bermúdez, Data in brief 2016
  • “...acyltransfer or hydrolase reactions with lipid and non-lipid substrates. 0.24 TON1 RECRUITING MOTIF 14, TRM14 At3g61380 Nucleus, plasma membrane Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-related. 0.39 ATIMD3, IMD3, IPMDH1 At1g31180 Chloroplast stroma, mitochondrion, plastid, thylakoid The AtIMD3 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase...”
• The iron-responsive element (IRE)/iron-regulatory protein 1 (IRP1)-cytosolic aconitase iron-regulatory switch does not operate in plants
  Arnaud, The Biochemical journal 2007
  • “...CAAAAUCAGUGAAUUUU CUUGUGCAGUGGCACAA At1g63490 At3g02520 At3g54130 At3g61380 Jumonji domain-containing protein 14-3-3 protein Josephin protein family Unknown acn...”

AT5G51850 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 431:563 / 590 (22.5%), covers 98.8% of PF14309, 65.1 bits

• Transcriptome analysis of Hpa1Xoo transformed cotton revealed constitutive expression of genes in multiple signalling pathways related to disease resistance
  Miao, Journal of experimental botany 2010
  • “...transfer CM105A02 AT1G69440 7.02 2.11 A member of the ARGONAUTE family RNA-mediated gene silencing CM104G01 AT5G51850 4.89 4.82 Expressed protein Unknown CM088H01 AT5G49740 4.52 2.79 Ferric chelate reductase. Iron chelate transport related to oxidationreduction CM105C04 AT1G30700 4.44 2.38 FAD-binding domain-containing protein Oxidoreductase related to oxidationreduction CM105F08...”

NP_001325882 zinc finger CCCH domain protein from Arabidopsis thaliana
Aligns to 351:488 / 508 (27.2%), covers 100.0% of PF14309, 58.4 bits

• Arabidopsis TRM5 encodes a nuclear-localised bifunctional tRNA guanine and inosine-N1-methyltransferase that is important for growth.
  Guo, PloS one 2019
  • GeneRIF: AtTRM5 is localized to the nucleus in plant cells.

AT3G63430 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 383:520 / 540 (25.6%), covers 100.0% of PF14309, 58.2 bits

• Comparing RNA-Seq and microarray gene expression data in two zones of the Arabidopsis root apex relevant to spaceflight
  Krishnamurthy, Applications in plant sciences 2018
  • “...5.85 NA Pectin lyaselike superfamily protein [Source:TAIR;Acc:AT4G23500] AT4G27950 4.04 CRF4 Cytokinin response factor 4 [Source:TAIR;Acc:AT4G27950] AT3G63430 4.10 TRM5 TON1 RECRUITING MOTIF 5, TRM5 zinc finger CCCH domain protein;(source:Araport11) AT5G01445 4.13 NA Unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; Has 5...”

GRMZM2G403003 uncharacterized protein LOC100381614 from Zea mays
Aligns to 861:996 / 1011 (13.5%), covers 98.8% of PF14309, 47.1 bits

• Genome-wide association study reveals the genetic architecture of root hair length in maize
  Liu, BMC genomics 2021
  • “...7.4 0.05 3.65E-06 AC193598.3_FG002 55034305507323 NBS-LRR disease resistance protein 6 34221678 T/A 9.0 0.08 1.70E-07 GRMZM2G403003 3421771734222233 TON1 recruiting motif 19 (TRM19) 6 75630277 A/G 9.7 0.06 3.97E-07 GRMZM5G825276 7563035375630906 GDSL-like lipase 10 2049694 C/A 9.2 0.16 2.00E-06 GRMZM2G180244 20494402055121 NBS-LRR disease resistance protein 10 138881367...”
  • “...significant SNP (chr6.S_ 34221678, P -value=1.70E-07, R 2 =9.0%) locates in the fourth exon of GRMZM2G403003 (Fig. 4 a), encoding a TON1 recruiting motif (TRM) protein. The average root hair length for A allele was substantially shorter than T allele ( P 0.01, Fig. 4 d)....”

AT1G63670 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 526:672 / 689 (21.3%), covers 99.4% of PF14309, 38.3 bits

• Signatures of balancing selection are maintained at disease resistance loci following mating system evolution and a population bottleneck in the genus Capsella
  Gos, BMC evolutionary biology 2012
  • “...no evidence that this is the case (Table 1 ). Nevertheless, a divergent haplotype at AT1G63670 did remain unsampled in C. grandiflora . Additionally, high levels of linkage disequilibrium in C. rubella combined with the genome-wide loss of diversity due to the population bottleneck may exaggerate...”

CE350_MOUSE / E9Q309 Centrosome-associated protein 350; Cep350 from Mus musculus (Mouse) (see paper)
Aligns to 2906:3077 / 3095 (5.6%), covers 67.1% of PF14309, 29.3 bits

• function: Plays an essential role in centriole growth by stabilizing a procentriolar seed composed of at least, SASS6 and CENPJ. Required for anchoring microtubules to the centrosomes and for the integrity of the microtubule network. Recruits PPARA to discrete subcellular compartments and thereby modulates PPARA activity. Required for ciliation.
  subunit: Part of a ternary complex that contains CEP350, CEP43 and MAPRE1. Interacts (via C-terminus) directly with CEP43 (via N- terminus). Interacts with NR1H3, PPARA, PPARD and PPARG. Interacts directly with microtubules. Interacts with the fusion protein CEP43- FGFR1, and by doing so recruits and activates PI3K and PLC-gamma. Interacts with CYLD (By similarity). Interacts with CFAP157 (PubMed:27965440). Interacts with CEP19 (via C-terminus) (By similarity).
• Tandem mass tag-based proteomics analysis of type 2 diabetes mellitus with non-alcoholic fatty liver disease in mice treated with acupuncture.
  Wang, Bioscience reports 2022
  • “...assembly factor 6 Ndufaf6 0.711 0.00736 down P47934 Carnitine O -acetyltransferase Crat 0.71 0.000319 down E9Q309 Centrosome-associated protein 350 Cep350 0.708 0.0283 down Q9QYR9 Acyl-coenzyme A thioesterase 2, mitochondrial Acot2 0.708 0.0011 down Q91V92 ATP-citrate synthase Acly 0.705 0.00136 down P19096 Fatty acid synthase Fasn 0.698...”

LOC107434963 uncharacterized protein LOC107434963 from Ziziphus jujuba var. spinosa
Aligns to 439:534 / 545 (17.6%), covers 41.5% of PF14309, 28.6 bits

• Transcriptomics of different tissues of blueberry and diversity analysis of rhizosphere fungi under cadmium stress
  Chen, BMC plant biology 2021
  • “...isoform X1 Theobroma cacao DN44665_c1_g1+ Cd 4363 Galacturonosyltransferase Actinidia chinensis DN36060_c0_g2- Cd 1912 Non-characterized protein LOC107434963 Ziziphus jujuba Leaf DN41610_c1_g2+ Cd 2467 UDP-glucose: flavonoid 3-O-glucosyltransferase Vaccinium corymbosum DN33777_c2_g4+ Cu 2497 RNA polymerase beta subunit Vaccinium macrocarpon DN29488_c0_g1+ Cu 2037 ABC transporter G family member 5-like Actinidia...”

AT5G03670 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 362:507 / 516 (28.3%), covers 40.9% of PF14309, 27.5 bits

• Nitric oxide coordinates growth, development, and stress response via histone modification and gene expression
  Ageeva-Kieferle, Plant physiology 2021
  • “...related 2, AT4G24670), serine biosynthesis (D-3-phosphoglycerate dehydrogenase, AT4G34200), and histone modification (histone-lysine N-methyltransferase SETD1B-like protein, AT5G03670; Figure 8 ; Supplemental Table S2 ). Under D conditions, only three genes are hyperacetylated and overexpressed in both mutants. One of these genes, AT5G16980 (Zinc-binding dehydrogenase family protein), has...”
  • “...to low nitrogen conditions. AT4G34200 D-3-phosphoglycerate dehydrogenase AT3G50660 Cytochrome P450 superfamily protein Brassinosteroid biosynthetic pathway. AT5G03670 Histone-lysine N-methyltransferase SETD1B-like protein Histone methyltransferase that specifically methylates H3K4. ChIP-seq and RNA-seq datasets were integrated at the gene level for both mutants to analyze the effect of H3K9ac on...”
• Genome-Wide Association Study and Genomic Prediction Elucidate the Distinct Genetic Architecture of Aluminum and Proton Tolerance in Arabidopsis thaliana
  Nakano, Frontiers in plant science 2020
  • “...were newly identified by this study, these include: TON1 RECRUITING MOTIF 28 ( AtTRM28 ; At5G03670 ) (RRL [/WT] = 0.36), SENSITIVE TO FREEZING 6 ( AtSFR6 ; AT4G04920 ) (RRL [/WT] = 0.53) and THIOREDOXIN H-TYPE 1 ( AtTRX1 ; AT3G51030 ) (RRL [/WT] =...”

CE350_HUMAN / Q5VT06 Centrosome-associated protein 350; Cep350; Centrosome-associated protein of 350 kDa from Homo sapiens (Human) (see 11 papers)
NP_055625 centrosome-associated protein 350 from Homo sapiens
Aligns to 2922:3099 / 3117 (5.7%), covers 68.3% of PF14309, 27.0 bits

• function: Plays an essential role in centriole growth by stabilizing a procentriolar seed composed of at least, SASS6 and CENPJ (PubMed:19052644). Required for anchoring microtubules to the centrosomes and for the integrity of the microtubule network (PubMed:16314388, PubMed:17878239, PubMed:28659385). Recruits PPARA to discrete subcellular compartments and thereby modulates PPARA activity (PubMed:15615782). Required for ciliation (PubMed:28659385).
  subunit: Part of a ternary complex that contains CEP350, CEP43 and MAPRE1. Interacts (via C-terminus) directly with CEP43 (via N-terminus) (PubMed:16314388, PubMed:28625565, PubMed:28428259). Interacts with NR1H3, PPARA, PPARD and PPARG (PubMed:15615782). Interacts directly with microtubules (PubMed:17878239). Interacts with the fusion protein CEP43-FGFR1, and by doing so recruits and activates PI3K and PLC-gamma (PubMed:18412956). Interacts with CYLD (PubMed:25134987). Interacts with CFAP157 (By similarity). Interacts with CEP19 (via C-terminus) (PubMed:28659385).
• CEP78 functions downstream of CEP350 to control biogenesis of primary cilia by negatively regulating CP110 levels.
  Gonçalves, eLife 2021
  • GeneRIF: CEP78 functions downstream of CEP350 to control biogenesis of primary cilia by negatively regulating CP110 levels.
• Glycosylation Changes in Serum Proteins Identify Patients with Pancreatic Cancer.
  Drabik, Journal of proteome research 2017 (PubMed)
  • GeneRIF: Expression of cancer-specific glycan epitopes represents an excellent opportunity for diagnostics and potentially specific detection of tumors. Here, we report four proteins (LIFR, CE350, VP13A, HPT) found in sera from pancreatic cancer patients carrying aberrant glycan structures as compared to those of controls.
• Transposon mutagenesis identifies genetic drivers of Braf(V600E) melanoma.
  Mann, Nature genetics 2015
  • GeneRIF: CEP350 is a tumor-suppressor gene in human melanoma.
• Variability of Gene Expression Identifies Transcriptional Regulators of Early Human Embryonic Development.
  Hasegawa, PLoS genetics 2015
  • GeneRIF: Results from a study on gene variability markers in early-stage human embryos shows that CEP350 is a putative variability marker for the 3-day, 8-cell embryo stage.
• Centrosomal CAP350 protein stabilises microtubules associated with the Golgi complex.
  Hoppeler-Lebel, Journal of cell science 2007 (PubMed)
  • GeneRIF: CAP350 specifically stabilises Golgi-associated microtubules and in this way participates in the maintenance of a continuous pericentrosomal Golgi ribbon.
• A complex of two centrosomal proteins, CAP350 and FOP, cooperates with EB1 in microtubule anchoring.
  Yan, Molecular biology of the cell 2006
  • GeneRIF: CAP350 interacts directly with FOP (FGFR1 oncogene partner) to form a centrosomal complex required for microtubule anchoring.
• Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score.
  Rose, Molecular medicine (Cambridge, Mass.)
  • GeneRIF: Clinical trial of gene-disease association and gene-environment interaction. (HuGE Navigator)
• Understanding the activating mechanism of the immune system against COVID-19 by Traditional Indian Medicine: Network pharmacology approach.
  Thirumal, Advances in protein chemistry and structural biology 2022
  • “...611423 Q66GS9 CEP250 CEP250 ENSG00000126001 1859 11190 609689 Q9BV73 CEP350 CEP350 ENSG00000135837 24238 9857 617870 Q5VT06 CEP43 CEP43 ENSG00000213066 17012 11116 605392 O95684 CEP68 CEP68 ENSG00000011523 29076 23177 616889 Q76N32 CENPF CENPF ENSG00000117724 1857 1063 600236 P49454 GOLGA7 GOLGA7 ENSG00000147533 24876 51125 609453 Q7Z5G4 HLA-A HLA-A...”
• Human leukemia cells (HL-60) proteomic and biological signatures underpinning cryo-damage are differentially modulated by novel cryo-additives.
  Al-Otaibi, GigaScience 2019
  • “...4 ND ND 4 1.6 P08758 Annexin A5 (Annexin-V) 6 -6.6 6 -9.2 6 4.5 Q5VT06 Centrosome-associated protein 350 29 88.9 29 61.2 29 81.2 P25787 Proteasome subunit alpha type-2 (PSAT2) ND 3 34.4 ND Nuclear activities regulation Q9BTE3 Mini-chromosome maintenance complex-binding protein ND 2 11.0...”
• PP2A-B' holoenzyme substrate recognition, regulation and role in cytokinesis.
  Wu, Cell discovery 2017
  • “...PEI MRTIPEEE LTD MxxIxEEE 3 c Q16589 CCNG2 Cyclin-G2 VPE LPTIPE GGCFD LxxIxE 1 c Q5VT06 CEP350 Centrosome-associated protein 350 RGS LESIAE HVDAS LExIxE 2 c Q92974 ARHGEF2 Rho guanine nucleotide exchange factor 2 FTR MQDIPEE TESR MxxIxEE 2 c; m; s Q9Y2I6 NLP Ninein-like protein...”
• The Plk1-dependent phosphoproteome of the early mitotic spindle.
  Santamaria, Molecular & cellular proteomics : MCP 2011

Or search for genetic data about PF14309 in the Fitness Browser