Family Search for PF14574 (RACo_C_ter)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

PF14574 hits 40 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

3zyyX / Q3ACS2 Reductive activator for corrinoid,iron-sulfur protein (see paper)
Aligns to 369:628 / 628 (41.4%), covers 99.6% of PF14574, 369.4 bits

• Ligands: fe2/s2 (inorganic) cluster; (r,r)-2,3-butanediol (3zyyX)

Ccar_18775 corrinoid activation/regeneration protein AcsV from Clostridium carboxidivorans P7
Aligns to 377:638 / 643 (40.7%), covers 100.0% of PF14574, 368.4 bits

• Combination of Trace Metal to Improve Solventogenesis of Clostridium carboxidivorans P7 in Syngas Fermentation
  Han, Frontiers in microbiology 2020
  • “...updated and remapped the WLP gene cluster ( Table 2 , and it ranged from Ccar_18775 to _18845 and contained 15 genes ( Pierce et al., 2008 ; Bruant et al., 2010 ). Formate dehydrogenase (FDH), the enzyme responsible for CO 2 reduction or formate oxidization,...”

TepiRe1_0615 corrinoid activation/regeneration protein AcsV from Tepidanaerobacter acetatoxydans Re1
Aligns to 375:637 / 642 (41.0%), covers 100.0% of PF14574, 358.4 bits

• Genome-guided analysis of physiological capacities of Tepidanaerobacter acetatoxydans provides insights into environmental adaptations and syntrophic acetate oxidation
  Müller, PloS one 2015
  • “...genes encoding putative ferredoxins (TepiRe1_0333, 0615, 2026) were found in the genome. Ferredoxin encoding gene TepiRe1_0615 is part of the WL pathway operon; TepiRe1_0333 was found to be reverse-transcribed close to the second fhs cluster (described above). Six enzymatic activities were predicted to use ferredoxin as...”

Dtox_1273 ferredoxin from Desulfotomaculum acetoxidans DSM 771
Aligns to 366:626 / 627 (41.6%), covers 99.2% of PF14574, 356.2 bits

• Genome analysis of Desulfotomaculum kuznetsovii strain 17(T) reveals a physiological similarity with Pelotomaculum thermopropionicum strain SI(T)
  Visser, Standards in genomic sciences 2013
  • “...(Desku_1493) and acsE (Desku_1487), which in contrast is present in the genome of D. acetoxidans (Dtox_1273). Moreover, three genes similar to heterodisulfide reductase encoding genes (Desku_1486-1484) are located upstream of acsE in D. kuznetsovii , which is not the case in the genome of D. acetoxidans...”

CAETHG_1606 corrinoid activation/regeneration protein AcsV from Clostridium autoethanogenum DSM 10061
Aligns to 377:637 / 644 (40.5%), covers 99.6% of PF14574, 351.0 bits

• Deletion of genes linked to the C₁-fixing gene cluster affects growth, by-products, and proteome of Clostridium autoethanogenum
  Nwaokorie, Frontiers in bioengineering and biotechnology 2023
  • “...Clostridium autoethanogenum. The gene cluster contains 16 genes, including five genes with unconfirmed biochemical functions (CAETHG_1606; 1607; 1612; 1613; 1619). Gene names and annotations based on Valgepea et al., 2022 . Figure created using BioRender.com . Determination of gene functionalities in acetogens through genotype-phenotype studies has...”

Dhaf_2795 ferredoxin from Desulfitobacterium hafniense DCB-2
DSY1650 ferredoxin from Desulfitobacterium hafniense Y51
Aligns to 373:635 / 638 (41.2%), covers 99.6% of PF14574, 349.2 bits

• Characterization of an O-demethylase of Desulfitobacterium hafniense DCB-2
  Studenik, Journal of bacteriology 2012
  • “...cassettes for the genes Dhaf_1265, Dhaf_2573, Dhaf_2795, Dhaf_3310, Dhaf_3879, Dhaf_4322, Dhaf_4610, Dhaf_4611, and Dhaf_4612 (GenBank accession no. CP001336.1)...”
  • “...on March 3, 2017 by University of California, Berkeley Dhaf_2795 2 Studenik et al. oriented in the reverse direction in comparison to the orientation in the...”
• Complete genome sequence of the dehalorespiring bacterium Desulfitobacterium hafniense Y51 and comparison with Dehalococcoides ethenogenes 195
  Nonaka, Journal of bacteriology 2006
  • “...DSY0391 DSY0393 DSY1228 DSY1247 DSY1596 DSY1598 DSY1648 DSY1650 DSY1651 DSY1652 DSY1671 DSY1890 DSY2085 DSY2558 DSY2585 DSY3715 DSY4099 DSY4876 Predicted...”

CD0730 putative iron-sulfur protein from Clostridium difficile 630
Aligns to 376:637 / 642 (40.8%), covers 99.6% of PF14574, 347.2 bits

• Diverse Energy-Conserving Pathways in Clostridium difficile: Growth in the Absence of Amino Acid Stickland Acceptors and the Role of the Wood-Ljungdahl Pathway
  Gencic, Journal of bacteriology 2020 (secret)
• Vegetative Cell and Spore Proteomes of Clostridioides difficile Show Finite Differences and Reveal Potential Protein Markers
  Abhyankar, Journal of proteome research 2019
  • “...C.difficile 630, which reinforces the acetogenic nature of C.difficile growth. Of these, CD3405, CD3407, and CD0730 have been detected only in single replicates and thus are not quantified. The other WoodLjungdahl pathway proteins have all been quantified, with only three proteinsMetF (CD0722), CD0728, and CD3258being highly...”

Awo_c10680 corrinoid activation/regeneration protein AcsV from Acetobacterium woodii DSM 1030
Aligns to 379:640 / 641 (40.9%), covers 99.6% of PF14574, 338.5 bits

• A new metabolic trait in an acetogen: Mixed acid fermentation of fructose in a methylene-tetrahydrofolate reductase mutant of Acetobacterium woodii
  Moon, Environmental microbiology reports 2023
  • “...171,346 29,713 2.52 Awo_c10670 CODH Ni 2+ insertion accessory protein CooC1 ACS/CODH 1000 1997 0.99 Awo_c10680 Corrinoid activation/regeneration protein 4126 7952 0.94 Awo_c10690 Hypothetical protein 1356 2178 0.68 Awo_c10700 Hypothetical protein 933 1748 0.9 Awo_c10710 CFeS protein, SSU AcsD 16,808 36,479 1.11 Awo_c10720 CFeS protein, LSU...”

DET0670 iron-sulfur cluster binding protein from Dehalococcoides ethenogenes 195
DET0704 iron-sulfur cluster binding protein from Dehalococcoides ethenogenes 195
Aligns to 369:629 / 640 (40.8%), covers 98.9% of PF14574, 317.7 bits

• Comparative genomics of "Dehalococcoides ethenogenes" 195 and an enrichment culture containing unsequenced "Dehalococcoides" strains
  West, Applied and environmental microbiology 2008
  • “...DET0318 DET0343 DET0551 DET0666 DET0667 DET0668 DET0669 DET0670 DET0671 DET1158 DET1481 DET1483 DET1484 DET1488 DET1494 DET1559 DET1574 DET1630 Trichloroethene...”
• Complete genome sequence of the dehalorespiring bacterium Desulfitobacterium hafniense Y51 and comparison with Dehalococcoides ethenogenes 195
  Nonaka, Journal of bacteriology 2006
  • “...DET1175 DET1173 DET0516 DET0237 DET0109 DET0110 DET0701 DET0704 DET0699 DET0700 DET1371 DET0104 DET0685 DET0698 DET0926 DET1598 DET1387 DET0416 hydrogenase....”

Dhaf_1265 ferredoxin from Desulfitobacterium hafniense DCB-2
Aligns to 276:524 / 535 (46.5%), covers 100.0% of PF14574, 315.5 bits

• Characterization of an O-demethylase of Desulfitobacterium hafniense DCB-2
  Studenik, Journal of bacteriology 2012
  • “...components. Expression cassettes for the genes Dhaf_1265, Dhaf_2573, Dhaf_2795, Dhaf_3310, Dhaf_3879, Dhaf_4322, Dhaf_4610, Dhaf_4611, and Dhaf_4612 (GenBank...”
  • “...Desulfitobacterium hafniense DCB-2 into pET11aa Gene Primer sequence PCR step Dhaf_1265 CGC GTT CAT ATG AAT CAT TAT CGG CC CTG CGG GTG GCT CCA AGC GCT GCA GAG...”

SMc04347 CONSERVED HYPOTHETICAL PROTEIN from Sinorhizobium meliloti 1021
Aligns to 386:655 / 683 (39.5%), covers 99.6% of PF14574, 303.5 bits

• An integrated approach to functional genomics: construction of a novel reporter gene fusion library for Sinorhizobium meliloti
  Cowie, Applied and environmental microbiology 2006
  • “...SMc04010 ................................Hypothetical protein SMc04347 ................................Conserved hypothetical protein SMb20057...”
• sinI- and expR-dependent quorum sensing in Sinorhizobium meliloti
  Gao, Journal of bacteriology 2005
  • “...CoA, coenzyme A. b SMc03864 SMc03930 SMc03969 SMc03972 SMc03983 SMc03983 SMc04040 SMc04330 SMc04347 33 44 29 47 17 19 58 10 15 31 42 43 a 111 56 70 55 112 96 77...”

Dhaf_3310 ferredoxin from Desulfitobacterium hafniense DCB-2
Aligns to 352:608 / 608 (42.3%), covers 94.6% of PF14574, 292.5 bits

• Characterization of an O-demethylase of Desulfitobacterium hafniense DCB-2
  Studenik, Journal of bacteriology 2012
  • “...for the genes Dhaf_1265, Dhaf_2573, Dhaf_2795, Dhaf_3310, Dhaf_3879, Dhaf_4322, Dhaf_4610, Dhaf_4611, and Dhaf_4612 (GenBank accession no. CP001336.1) as...”
  • “...CCT TAT TTT TCG AAC TGC GGG TGG C 1 Dhaf_2573 Dhaf_3310 Dhaf_3879 Dhaf_4322 Dhaf_4610 Dhaf_4611 Dhaf_4612 a 2 2 2 2 2 2 2 2 For details, see Materials and...”

BP07_RS03235, WP_042685513 ASKHA domain-containing protein from Methermicoccus shengliensis DSM 18856
Aligns to 355:607 / 616 (41.1%), covers 95.8% of PF14574, 292.3 bits

• Methanogenic archaea use a bacteria-like methyltransferase system to demethoxylate aromatic compounds
  Kurth, The ISME journal 2021
  • “...and MtoD The gene encoding the corrinoid protein MtoC (BP07_RS03260) and the corrinoid activating enzyme (BP07_RS03235) were amplified from genomic M. shengliensis DNA with primers 3235fw/3235Srev (CTCATATGAGCGTCAGAGTAACGTTCGAGC, CTGCGGCCGCTTATTTTTCGAACTGCGGGTGGCTCCAGCTAGCTGAAGAGAGTTTTTCTCC) and 3260fw/3260Srev (CTCATATGACGGACGTAAGAGAAGAGCTC/CTGCGGCCGCTTATTTTTCGAACTGCGGGTGGCTCCAGCTAGCCTCCACCCCCACCAGAGC) for cloning in expression vector pET-30a inserting an N-terminal Strep tag via the reverse primer....”
  • “...plasmid transformation. For production of the corrinoid protein MtoC (BP07_RS03260) and the corrinoid activating enzyme (BP07_RS03235) the plasmids pET-30a_BP07_RS03260 and pET-30a_BP07_RS03235 were used for transformation into E. coli Bl21 (DE3). For protein overexpression, one colony was inoculated in 600ml LB-medium containing 50g/ml kanamycin and incubated at...”
• Several ways one goal-methanogenesis from unconventional substrates
  Kurth, Applied microbiology and biotechnology 2020
  • “...MtvB O-demethylase BP07_RS03250 WP_042685515 Corrinoid protein BP07_RS03260 WP_042685521 MtrH-like methyltransferase BP07_RS03240 WP_042685937 Corrinoid activation protein BP07_RS03235 WP_042685513 Methanococcoides Tertiary amines ? ? ? Methanolobus vulcani Quaternary amines MtgB methyltransferase FKV42_RS08545 WP_154809802 Corrinoid protein FKV42_RS08550 WP_154809803 Corrinoid activator FKV42_RS10455 WP_154810143 CoM methyltransferase FKV42_RS10480 WP_154810148 For the organisms...”
  • “...O-demethylase BP07_RS03250 WP_042685515 Corrinoid protein BP07_RS03260 WP_042685521 MtrH-like methyltransferase BP07_RS03240 WP_042685937 Corrinoid activation protein BP07_RS03235 WP_042685513 Methanococcoides Tertiary amines ? ? ? Methanolobus vulcani Quaternary amines MtgB methyltransferase FKV42_RS08545 WP_154809802 Corrinoid protein FKV42_RS08550 WP_154809803 Corrinoid activator FKV42_RS10455 WP_154810143 CoM methyltransferase FKV42_RS10480 WP_154810148 For the organisms conducting...”

PGA1_c15200 ATP-dependent reduction of co(II)balamin (RamA-like) (EC:2.1.1.13) from Phaeobacter inhibens BS107
PGA1_c15200 ASKHA domain-containing protein from Phaeobacter inhibens DSM 17395
Aligns to 395:668 / 698 (39.3%), covers 98.5% of PF14574, 292.0 bits

• mutant phenotype: Apparently required for the reactivation of vitamin B12. Distantly related to RamA (see PMID: 19043046) (auxotroph)
• Filling gaps in bacterial amino acid biosynthesis pathways with high-throughput genetics
  Price, PLoS genetics 2018
  • “...are likely to be involved in B12 reactivation: a protein with ferredoxin and DUF4445 domains (PGA1_c15200) and a DUF1638 protein (PGA1_c13340). As shown in Fig 4B , mutants in these genes are rescued by added methionine. The DUF4445 protein is distantly related to RamA, which uses...”

Dhaf_2573 ferredoxin from Desulfitobacterium hafniense DCB-2
Aligns to 356:615 / 615 (42.3%), covers 96.2% of PF14574, 285.0 bits

• Characterization of an O-demethylase of Desulfitobacterium hafniense DCB-2
  Studenik, Journal of bacteriology 2012
  • “...Expression cassettes for the genes Dhaf_1265, Dhaf_2573, Dhaf_2795, Dhaf_3310, Dhaf_3879, Dhaf_4322, Dhaf_4610, Dhaf_4611, and Dhaf_4612 (GenBank accession no....”
  • “...GAT CCT TAT TTT TCG AAC TGC GGG TGG C 1 Dhaf_2573 Dhaf_3310 Dhaf_3879 Dhaf_4322 Dhaf_4610 Dhaf_4611 Dhaf_4612 a 2 2 2 2 2 2 2 2 For details, see Materials and...”

AF_0010 ASKHA domain-containing protein from Archaeoglobus fulgidus DSM 4304
Aligns to 354:597 / 597 (40.9%), covers 94.6% of PF14574, 280.5 bits

• A novel methoxydotrophic metabolism discovered in the hyperthermophilic archaeon Archaeoglobus fulgidus
  Welte, Environmental microbiology 2021
  • “.... Genomic and transcriptomic analysis revealed cobalamin binding protein MtoC (AF_0006) and its activator MtoD (AF_0010), Odemethylase MtoB (AF_0007) and methyl transferase MtoA (AF_0009) to be essential for growth of A. fulgidus on methoxylated aromatic compounds. CoM: coenzyme M, H 4 folate: tetrahydrofolate, CO(III): cobalamin binding...”
  • “...VhtACDG (AF_137881), ATP synthase AtpAK (AF_115868), cobalamin binding protein MtoC (AF_0006) and its activator MtoD (AF_0010), Odemethylase MtoB (AF_0007) and methyl transferase MtoA (AF_0009), MFS transporters (AF_0008 & AF_0013). H 4 MPT: tetrahydromethanopterin, MQH 2 : reduced menaquinone (MQ), MFR: methanofuran, Fd: ferredoxin, F 420 H...”

SSCH_450007 ASKHA domain-containing protein from Syntrophaceticus schinkii
Aligns to 358:619 / 619 (42.3%), covers 97.3% of PF14574, 278.0 bits

• Genome-Guided Analysis and Whole Transcriptome Profiling of the Mesophilic Syntrophic Acetate Oxidising Bacterium Syntrophaceticus schinkii
  Manzoor, PloS one 2016
  • “...Several ferredoxin-encoding genes were found dispersed in the genome of S . schinkii (SSCH _100042, SSCH_450007, SSCH_530010, SSCH_760007, SSCH_1120013) and one putative rubredoxin gene (SSCH_180038). 10.1371/journal.pone.0166520.g006 Fig 6 Comparison of the NADH-dependent [Fe-Fe] hydrogenase gene cluster (SSCH_21000810) predicted for S . schinkii strain Sp3 to the...”

TepiRe1_0333 ASKHA domain-containing protein from Tepidanaerobacter acetatoxydans Re1
Aligns to 343:609 / 609 (43.8%), covers 96.9% of PF14574, 264.9 bits

• Genome-guided analysis of physiological capacities of Tepidanaerobacter acetatoxydans provides insights into environmental adaptations and syntrophic acetate oxidation
  Müller, PloS one 2015
  • “...proteins belonging to the family [ 57 ]. Energy conservation Three genes encoding putative ferredoxins (TepiRe1_0333, 0615, 2026) were found in the genome. Ferredoxin encoding gene TepiRe1_0615 is part of the WL pathway operon; TepiRe1_0333 was found to be reverse-transcribed close to the second fhs cluster...”

RSK20926_19267 iron-sulfur cluster-binding protein from Roseobacter sp. SK209-2-6
Aligns to 1:259 / 289 (89.6%), covers 93.5% of PF14574, 262.3 bits

• Filling gaps in bacterial amino acid biosynthesis pathways with high-throughput genetics
  Price, PLoS genetics 2018
  • “...However in Roseobacter sp. SK209-2-6, the RamA-like protein is split into two proteins (RSK20926_19262 and RSK20926_19267), and we manually classified the RamA-like protein as present in this bacterium. Source code Code for analyzing fitness data and for the Fitness Browser is available at https://bitbucket.org/berkeleylab/feba . Supporting...”

D9S251 Ferredoxin from Thermosediminibacter oceani (strain ATCC BAA-1034 / DSM 16646 / JW/IW-1228P)
Aligns to 349:612 / 614 (43.0%), covers 96.9% of PF14574, 258.4 bits

• Role of Allelic Imbalance in Predicting Hepatocellular Carcinoma (HCC) Recurrence Risk After Liver Transplant.
  Pagano, Annals of transplantation 2019
  • “...Results We report that AI was associated with HCC recurrence in 3 main loci (D3S2303, D9S251, and D9S254). Tumor recurrence was associated only with 2 specific panels with 9 microsatellites previously reported to be associated with high risk for HCC recurrence. Our data show that fractional...”
  • “...for D3S2303 (p=0.048) considering the presence of LOH ( Table 3A ), and D1S407 (p=0.006) D9S251 (p=0.02), D1S162 (p=0.005), D5S592 (p=0.005), D9S254 (p=0.002) and D10S520 (p=0.04) considering high-level LOH ( Table 3B ). Evaluation of specific panels and association with HCC recurrence Descriptive analysis of the...”
• The C9ORF72 expansion mutation is a common cause of ALS+/-FTD in Europe and has a single founder.
  Smith, European journal of human genetics : EJHG 2013
• Clinical, neuroimaging and neuropathological features of a new chromosome 9p-linked FTD-ALS family.
  Boxer, Journal of neurology, neurosurgery, and psychiatry 2011
  • “...Genome-wide linkage analysis conclusively linked family VSM-20 to a 28.3 cM region between D9S1808 and D9S251 on chromosome 9p, reducing the published minimal linked region to a 3.7 Mb interval. Genomic sequencing and expression analysis failed to identify mutations in the 10 known and predicted genes...”
  • “...GENESCAN and GENOTYPER software (Applied Biosystems) and normalised to the CEPH genotype database, except for D9S251 and D9S304 for which fragment sizes were not available. Mutation analyses In family VSM-20, a genomic DNA (gDNA) sequencing analysis was performed for all 10 candidate genes located within the...”
• Chromosome 9p21 in sporadic amyotrophic lateral sclerosis in the UK and seven other countries: a genome-wide association study.
  Shatunov, The Lancet. Neurology 2010
  • “...7 this 36 Mb locus is defined across studies by the flanking markers D9S169 and D9S251. The SNPs we have identified lie within this region, with the peak association at 1065 Kb. A GWAS that used pathological subtyping of patients with frontotemporal dementia to increase homogeneity...”
• Liver transplantation for hepatocellular carcinoma: extension of indications based on molecular markers.
  Schwartz, Journal of hepatology 2008
• Use of microsatellite marker loss of heterozygosity in accurate diagnosis of pancreaticobiliary malignancy from brush cytology samples.
  Khalid, Gut 2004

Dhaf_3879 ferredoxin from Desulfitobacterium hafniense DCB-2
Aligns to 359:615 / 616 (41.7%), covers 95.0% of PF14574, 257.6 bits

• Characterization of an O-demethylase of Desulfitobacterium hafniense DCB-2
  Studenik, Journal of bacteriology 2012
  • “...for the genes Dhaf_1265, Dhaf_2573, Dhaf_2795, Dhaf_3310, Dhaf_3879, Dhaf_4322, Dhaf_4610, Dhaf_4611, and Dhaf_4612 (GenBank accession no. CP001336.1) as Strep...”
  • “...TAT TTT TCG AAC TGC GGG TGG C 1 Dhaf_2573 Dhaf_3310 Dhaf_3879 Dhaf_4322 Dhaf_4610 Dhaf_4611 Dhaf_4612 a 2 2 2 2 2 2 2 2 For details, see Materials and Methods....”

Dtur_0730 ferredoxin from Dictyoglomus turgidum DSM 6724
Aligns to 345:568 / 570 (39.3%), covers 93.9% of PF14574, 255.7 bits

• The Complete Genome Sequence of Hyperthermophile Dictyoglomus turgidum DSM 6724™ Reveals a Specialized Carbohydrate Fermentor
  Brumm, Frontiers in microbiology 2016
  • “...ubiquinone is scavenged from the environment, or an alternate electron acceptor is utilized, like ferridoxin (Dtur_0730) or ferredoxin-like proteins (Dtur_0076; Dtur_0457; Dtur_0556; Dtur_0730; Dtur_0774, and Dtur_1717). The proton gradient needed for ATP generation is produced by NADH oxidoreductase (Dtur_0558; Dtur_0559; Dtur_0916; Dtur_0919, and Dtur_1091), and succinate...”

Dhaf_4322 ferredoxin from Desulfitobacterium hafniense DCB-2
Aligns to 354:611 / 611 (42.2%), covers 95.8% of PF14574, 253.4 bits

• Characterization of an O-demethylase of Desulfitobacterium hafniense DCB-2
  Studenik, Journal of bacteriology 2012
  • “...the genes Dhaf_1265, Dhaf_2573, Dhaf_2795, Dhaf_3310, Dhaf_3879, Dhaf_4322, Dhaf_4610, Dhaf_4611, and Dhaf_4612 (GenBank accession no. CP001336.1) as Strep tag...”
  • “...BamHI according to the manufacturer's protocol. For Dhaf_4322, a compatible 3318 jb.asm.org Journal of Bacteriology Downloaded from http://jb.asm.org/ on March...”

B8R2M5 [Co(II) methylated amine-specific corrinoid protein] reductase (EC 1.16.99.1) from Acetobacterium dehalogenans (see paper)
WP_026395886 ASKHA domain-containing protein from Acetobacterium dehalogenans DSM 11527
Aligns to 339:598 / 598 (43.5%), covers 96.9% of PF14574, 251.6 bits

• Redox potential changes during ATP-dependent corrinoid reduction determined by redox titrations with europium(II)-DTPA
  Dürichen, Protein science : a publication of the Protein Society 2019
  • “...Germany). 4.2 Production and purification of the recombinant proteins The activating enzyme (AE; Accession number: WP_026395886) and corrinoid protein (CP; Accession number: WP_026394334) of the vanillate O demethylase of A. dehalogenans were heterologously produced as Cterminal Strep Tag fusions in Escherichia coli BL21 (DE3) as described...”

Dred_2206 ferredoxin from Desulfotomaculum reducens MI-1
Aligns to 289:539 / 539 (46.6%), covers 96.6% of PF14574, 248.7 bits

• The genome of the Gram-positive metal- and sulfate-reducing bacterium Desulfotomaculum reducens strain MI-1
  Junier, Environmental microbiology 2010
  • “..., formate, CO as well as various reduced soluble electron transport proteins such as ferredoxin (dred_2206) and electron transfer flavoproteins (EtfAB) (dred_1778-9, dred_1538-9, dred_0572-3 and dred_0367-8) ( Fig. 2 ). Formate is oxidized via formate dehydrogenase (dred_1112-19) that includes a ten-TMH transmembrane subunit (dred_1116) annotated as...”

ELI_0370 ASKHA domain-containing protein from Eubacterium callanderi
Aligns to 334:592 / 593 (43.7%), covers 95.0% of PF14574, 248.6 bits

• Cloning, expression, and characterization of a four-component O-demethylase from human intestinal bacterium Eubacterium limosum ZL-II
  Chen, Applied microbiology and biotechnology 2016 (PubMed)
  • “...including ELI_2003 (MT-I), ELI_2004 (CP), ELI_2005 (MT-II), and ELI_0370 (AE), were confirmed to constitute the Odemethylase in E. limosum ZL-II. The complete...”
  • “...was oxidized to [CoII]-CP immediately in vitro, and ELI_0370 (AE) was responsible for catalyzing the reduction of [CoII]CP to its active form [CoI]-CP. The...”

RAMQ_EUBLI / P0DX10 Corrinoid activation enzyme RamQ from Eubacterium limosum (see 2 papers)
WP_038351871 ASKHA domain-containing protein from Eubacterium limosum
Aligns to 334:592 / 593 (43.7%), covers 95.0% of PF14574, 245.8 bits

• function: Involved in the degradation of the quaternary amines L- proline betaine and L-carnitine (PubMed:31341018, PubMed:32571881). Component of a corrinoid-dependent methyltransferase system that transfers a methyl group from L-proline betaine or L-carnitine to tetrahydrofolate (THF), forming methyl-THF, a key intermediate in the Wood-Ljungdahl acetogenesis pathway (PubMed:31341018, PubMed:32571881). RamQ is not required for the methyl transfer, but it stimulates reduction of reconstituted MtqC from the Co(II) state to the Co(I) state in vitro (PubMed:31341018). It also stimulates the rate of THF methylation (PubMed:32571881).
  cofactor: [2Fe-2S] cluster (Binds 1 2Fe-2S cluster.)
• MtpB, a member of the MttB superfamily from the human intestinal acetogen Eubacterium limosum, catalyzes proline betaine demethylation
  Picking, The Journal of biological chemistry 2019 (secret)

MM0940 putative Flavoprotein from Methanosarcina mazei Goe1
Aligns to 168:428 / 542 (48.2%), covers 99.6% of PF14574, 230.1 bits

• Quantitative proteomic and microarray analysis of the archaeon Methanosarcina acetivorans grown with acetate versus methanol
  Li, Journal of proteome research 2007
  • “...of 59 kDa 52, the sequence is 90% identical to MM0940 of M. mazei encoding a 59-kDa putative flavoprotein of unknown function that is also up regulated in...”
  • “...cells 11. The results suggest that the product of MM0940 and MA3972 is a core flavoprotein with an unknown function in the acetate pathways of freshwater and...”

MA3972 conserved hypothetical protein from Methanosarcina acetivorans C2A
Aligns to 173:433 / 546 (47.8%), covers 99.2% of PF14574, 225.5 bits

• Quantitative proteomic and microarray analysis of the archaeon Methanosarcina acetivorans grown with acetate versus methanol
  Li, Journal of proteome research 2007
  • “...pathway. NIH-PA Author Manuscript The protein product of MA3972 was in greater abundance, and expression of the gene up regulated in acetate-grown cells (Table...”
  • “...The results suggest that the product of MM0940 and MA3972 is a core flavoprotein with an unknown function in the acetate pathways of freshwater and marine...”

FKV42_RS10455, WP_154810143 methylamine methyltransferase corrinoid protein reductive activase from Methanolobus vulcani
Aligns to 169:429 / 540 (48.3%), covers 99.6% of PF14574, 220.0 bits

• Several ways one goal-methanogenesis from unconventional substrates
  Kurth, Applied microbiology and biotechnology 2020
  • “...? Methanolobus vulcani Quaternary amines MtgB methyltransferase FKV42_RS08545 WP_154809802 Corrinoid protein FKV42_RS08550 WP_154809803 Corrinoid activator FKV42_RS10455 WP_154810143 CoM methyltransferase FKV42_RS10480 WP_154810148 For the organisms conducting hydrogen-dependent methylotrophic the enzymes important for energy conversion/recycling of reducing equivalents are shown as those play an important role of the...”
  • “...proteomic analysis revealed that MtgB, a corrinoid binding protein (FKV42_RS08550), a corrinoid reductive activation enzyme (FKV42_RS10455) and a methylcorrinoid:CoM methyltransferase (FKV42_RS10480) were highly abundant when M. vulcani B1d was grown on betaine relative to growth on trimethylamine. Energy conservation presumably follows what is known for methylamine...”
  • “...Methanolobus vulcani Quaternary amines MtgB methyltransferase FKV42_RS08545 WP_154809802 Corrinoid protein FKV42_RS08550 WP_154809803 Corrinoid activator FKV42_RS10455 WP_154810143 CoM methyltransferase FKV42_RS10480 WP_154810148 For the organisms conducting hydrogen-dependent methylotrophic the enzymes important for energy conversion/recycling of reducing equivalents are shown as those play an important role of the special...”

Mmah_1683 4Fe-4S ferredoxin iron-sulfur binding domain protein from Methanohalophilus mahii DSM 5219
Aligns to 169:428 / 541 (48.1%), covers 98.9% of PF14574, 218.5 bits

• The genome sequence of Methanohalophilus mahii SLP(T) reveals differences in the energy metabolism among members of the Methanosarcinaceae inhabiting freshwater and saline environments
  Spring, Archaea (Vancouver, B.C.) 2010
  • “...activation of the corrinoid protein is catalyzed in methylotrophic methanogens by the iron-sulfur protein RamA (Mmah_1683) [ 49 ]. In Methanosarcina species it was demonstrated that the corrinoid protein and the substrate specific methyltransferase form a tight complex and that the corresponding genes are transcribed in...”

Q8PXZ5 Conserved protein from Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
MM1071 conserved protein from Methanosarcina mazei Goe1
Aligns to 169:429 / 539 (48.4%), covers 99.6% of PF14574, 216.0 bits

• Mining proteomic data to expose protein modifications in Methanosarcina mazei strain Gö1
  Leon, Frontiers in microbiology 2015
  • “...Rpl1P 3 62 Q8PY39 MM1025 ThiC 3 58 Q8PXZ6 MM1070 MtaA1 methylcobalamin:CoM methyltransferase 7 374 Q8PXZ5 MM1071 4Fe:4S ferredoxin, hypothetical 2 121 Q8PXZ3 MM1073 MtaC2 methyl corrinoid protein 6 230 Q8PXZ2 MM1074 MtaB2 9 250 Q8PXZ1 MM1075 Putative regulatory protein 2 92 1 Y Q8PXX0 MM1096...”
• Mining proteomic data to expose protein modifications in Methanosarcina mazei strain Gö1
  Leon, Frontiers in microbiology 2015
  • “...3 62 Q8PY39 MM1025 ThiC 3 58 Q8PXZ6 MM1070 MtaA1 methylcobalamin:CoM methyltransferase 7 374 Q8PXZ5 MM1071 4Fe:4S ferredoxin, hypothetical 2 121 Q8PXZ3 MM1073 MtaC2 methyl corrinoid protein 6 230 Q8PXZ2 MM1074 MtaB2 9 250 Q8PXZ1 MM1075 Putative regulatory protein 2 92 1 Y Q8PXX0 MM1096 Thermosome,...”
• Transcriptional profiling of methyltransferase genes during growth of Methanosarcina mazei on trimethylamine
  Krätzer, Journal of bacteriology 2009
  • “...(C-terminal domain) MM0174 MM0175 MM0312 MM0408 MM0479 MM0924 MM1071 MM1073 MM1074 MM1075 MM1112 MM1271 MM1272 MM1273 MM1274 MM1275 MM1647 MM1648 MM1761 MM1762...”
• RamA, a protein required for reductive activation of corrinoid-dependent methylamine methyltransferase reactions in methanogenic archaea
  Ferguson, The Journal of biological chemistry 2009
  • “...were found in M. acetivorans (MA4380), M. mazei (mm1071), and M. barkeri (Mbar_A1055). Additionally, other RamA homologs in Methanosarcina spp. were found, but...”
• A subset of the diverse COG0523 family of putative metal chaperones is linked to zinc homeostasis in all kingdoms of life
  Haas, BMC genomics 2009
  • “...( M. mazei COG0523) is induced to the same extent as its neighboring ramM homolog, MM1071 , during growth in high salt conditions (2.38 and 2.21 fold, respectively) [ 104 ]. Archaeal genomes sequenced to date lack any recognizable homolog of the Fur (Fe) or Zur...”
• Characterization of a novel bifunctional dihydropteroate synthase/dihydropteroate reductase enzyme from Helicobacter pylori
  Levin, Journal of bacteriology 2007
  • “...MM512 MM612 MM808 MM847 MM851 MM902 MM1059 MM1060 MM1061 MM1071 Genotype or description 4064 LEVIN ET AL. and E. coli Fre. The reaction mixture was incubated...”

MA4380 conserved hypothetical protein from Methanosarcina acetivorans C2A
Aligns to 169:429 / 539 (48.4%), covers 99.6% of PF14574, 214.2 bits

• RamA, a protein required for reductive activation of corrinoid-dependent methylamine methyltransferase reactions in methanogenic archaea
  Ferguson, The Journal of biological chemistry 2009
  • “...RamM genes were found in M. acetivorans (MA4380), M. mazei (mm1071), and M. barkeri (Mbar_A1055). Additionally, other RamA homologs in Methanosarcina...”

MA0849 hypothetical protein (multi-domain) from Methanosarcina acetivorans C2A
Aligns to 169:437 / 563 (47.8%), covers 97.7% of PF14574, 212.3 bits

• Genetic basis for metabolism of methylated sulfur compounds in Methanosarcina species
  Fu, Journal of bacteriology 2015
  • “...vs MeSH MA4164 MA4165 MA4166 MA4167 MA1617 MA1616 MA0849 MA3860 MA3861 MA3862 MA3863 MA3864 MA3865 MA3300 MA0859 MA4384 MA4558 MA3302 MA3130 MA0685 MA3736...”
  • “...scriptional regulation during growth on methylsulfides. The MA0849 locus, which encodes a protein with homology to the methylamine methyltransferase-activating...”
• RamA, a protein required for reductive activation of corrinoid-dependent methylamine methyltransferase reactions in methanogenic archaea
  Ferguson, The Journal of biological chemistry 2009
  • “...and methylcobamide:CoM methyltransferases (47, 48). A RamA homolog (MA0849) was also found in M. acetivorans adjacent to a gene encoding a methylcobamide:CoM...”

MM1440 conserved protein from Methanosarcina mazei Goe1
Aligns to 168:427 / 540 (48.1%), covers 98.5% of PF14574, 212.2 bits

• RamA, a protein required for reductive activation of corrinoid-dependent methylamine methyltransferase reactions in methanogenic archaea
  Ferguson, The Journal of biological chemistry 2009
  • “...(45) was examined, which led to identification of MM1440 (GenBankTM NP_633464), whose predicted product differed from the N terminus of the isolated protein by...”
  • “...1). Genes were identified in M. mazei (MM1440), M. barkeri Fusaro (Mbar_A0840), and Methanosarcina acetivorans (MA0150) genomes whose predicted gene products...”

ramA / B8Y445 [Co(II) methylated amines-specific corrinoid protein] reductase (EC 1.16.99.1) from Methanosarcina barkeri (see 2 papers)
B8Y445 [Co(II) methylated amine-specific corrinoid protein] reductase (EC 1.16.99.1) from Methanosarcina barkeri (see paper)
Aligns to 168:427 / 540 (48.1%), covers 98.5% of PF14574, 209.8 bits

MA0150 methylamine methyltransferase corrinoid activation protein from Methanosarcina acetivorans C2A
Aligns to 168:427 / 540 (48.1%), covers 98.1% of PF14574, 208.5 bits

• RamA, a protein required for reductive activation of corrinoid-dependent methylamine methyltransferase reactions in methanogenic archaea
  Ferguson, The Journal of biological chemistry 2009
  • “...M. barkeri Fusaro (Mbar_A0840), and Methanosarcina acetivorans (MA0150) genomes whose predicted gene products are 93-97% similar to that produced by the...”
• Cobalamin- and corrinoid-dependent enzymes
  Matthews, Metal ions in life sciences 2009
  • “.../hydrogenase [ 81 , 91 ] Methylamine:coenzyme M methyltransferases (5-OH-benzimidazolylcobamide) Methanosarcina barkeri Methanosarcina acetovorans RamA (MA0150) ATP/ [ 26 ] Energy-conserving methyltetrahydromethanopterin: coenzyme M methyltransferase (5-OH-benzimidazolylcobamide) Methanobacterium thermoautotrophicum not identified ATP/reduced ferredoxin [ 92 ] Veratrol:H 4 folate and vanillate:H 4 folate O-methyltransferases (cobalamin) Acetobacterium dehalogenans...”

DvMF_1398 ATP-dependent reduction of co(II)balamin (RamA-like) from Desulfovibrio vulgaris Miyazaki F
DvMF_1398 iron-sulfur cluster-binding protein, putative from Desulfovibrio vulgaris str. Miyazaki F
Aligns to 434:685 / 685 (36.8%), covers 93.9% of PF14574, 143.7 bits

• mutant phenotype: Cofit with the B12-dependent methionine synthase (DvMF_0476), which lacks a standard domain for the reactivation of vitamin B12.
• Filling gaps in bacterial amino acid biosynthesis pathways with high-throughput genetics
  Price, PLoS genetics 2018
  • “...the standard B12 activation domain. This methionine synthase has a very similar fitness pattern as DvMF_1398, which contains two DUF4445 domains (r = 0.92 across 170 experiments; also see Fig 3 ). We infer that DUF4445 proteins perform the reactivation of vitamin B12 in diverse bacteria....”

DVU0908 ATP-dependent reduction of co(II)balamin from Desulfovibrio vulgaris Hildenborough JW710
Aligns to 296:542 / 543 (45.5%), covers 94.3% of PF14574, 139.1 bits

• mutant phenotype: Important for fitness in most defined media. Semi-automated annotation based on the auxotrophic phenotype and a hit to HMM PF14574.

Dde_2711 2Fe-2S iron-sulfur cluster binding domains protein from Desulfovibrio desulfuricans G20
Aligns to 278:554 / 554 (50.0%), covers 94.3% of PF14574, 127.4 bits

• Filling gaps in bacterial amino acid biosynthesis pathways with high-throughput genetics
  Price, PLoS genetics 2018
  • “...vitamin B12 reactivation, and we previously proposed that in Desulfovibrio alaskensis , a RamA-like protein (Dde_2711) would be involved in B12 reactivation because it is cofit with MetH (r = 0.90; [ 3 ]). We also found evidence that DUF4445 is involved in the reactivation of...”
• Functional genomics with a comprehensive library of transposon mutants for the sulfate-reducing bacterium Desulfovibrio alaskensis G20
  Kuehl, mBio 2014
  • “...supplementation of minimal medium with methionine also rescued the fitness defects of the uncharacterized genes Dde_2711 and Dde_3007 ( Fig.4B ). The D.alaskensis G20 MetH is missing the N-terminal activation domain [for reducing Co(II) to Co(I)] that is present in E. coli MetH. To identify this...”
  • “...G20, we examined the new methionine auxotrophs identified by our fitness assay and found that Dde_2711 encodes a predicted ferredoxin and has homology to this missing activation domain of E. coli MetH. Dde_3007 encodes a conserved protein annotated as domain of unknown function DUF39. To determine...”

Or search for genetic data about PF14574 in the Fitness Browser