Family Search for PF15061 (DUF4538)
Running HMMer for PF15061
PF15061 hits 8 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
SIM20_BOVIN / F1MDB2 Small integral membrane protein 20; Mitochondrial translation regulation assembly intermediate of cytochrome c oxidase protein of 7 kDa; MITRAC7 from Bos taurus (Bovine) (see paper)
SIM20_HUMAN / Q8N5G0 Small integral membrane protein 20; Mitochondrial translation regulation assembly intermediate of cytochrome c oxidase protein of 7 kDa; MITRAC7 from Homo sapiens (Human) (see 2 papers)
NP_001138904 small integral membrane protein 20 isoform 1 from Homo sapiens
Aligns to 2:58 / 67 (85.1%), covers 100.0% of PF15061, 98.7 bits
- function: [Small integral membrane protein 20]: Component of the MITRAC (mitochondrial translation regulation assembly intermediate of cytochrome c oxidase complex) complex, that regulates cytochrome c oxidase assembly (By similarity). Promotes the progression of complex assembly after the association of MT-CO1/COX1 with COX4I1 and COX6C (By similarity). Chaperone-like assembly factor required to stabilize newly synthesized MT-CO1/COX1 and to prevent its premature turnover (By similarity).
function: [Phoenixin-14]: Peptide involved in a broad spectrum of regulatory functions (By similarity). Is a ligand for GPR173 (By similarity). As part of the reproductive cycle, it regulates gonadotropin-releasing hormone (GnRH) signaling in the hypothalamus and pituitary gland which augments the release of luteinizing hormone (By similarity). Plays a protective role in memory retention through activation of GNRHR (By similarity). Regulates the secretion of AVP by hypothalamic neurons (By similarity). Plays a role in the transduction of the itch sensation (By similarity). Induces anxiolytic effects, reducing behavior associated with anxiety (By similarity). Regulates food intake as well as satiation and satiety (By similarity). In the ovary, it regulates follicular growth by stimulating granulosa cell proliferation by increasing the expression of GPR173, CREB1, CYP19A1, KITLG, FSHR, and LHCGR (By similarity). It also increases the production of estradiol (E2) (By similarity). In the heart, it regulates contractility and relaxation (By similarity). It also plays a cardioprotective role during ischemia, where it activates the SAFE and RISK pathways (By similarity). Stimulates the proliferation and differentiation of preadipocytes (By similarity). In pancreatic islet cells, it induces proliferation of islet cells as well as the production of INS (By similarity).
function: [Phoenixin-20]: Peptide involved in a broad spectrum of regulatory functions (By similarity). Is a ligand for GPR173 (By similarity). As part of the reproductive cycle, it regulates gonadotropin-releasing hormone (GnRH) signaling in the hypothalamus and pituitary gland which augments the release of luteinizing hormone (By similarity). Plays a protective role in memory retention through activation of GNRHR (By similarity). Regulates the secretion of AVP by hypothalamic neurons (By similarity). Plays a role in the transduction of the itch sensation (By similarity). Induces anxiolytic effects, reducing behavior associated with anxiety (By similarity). Regulates food intake as well as satiation and satiety (By similarity). In the ovary, it regulates follicular growth by stimulating granulosa cell proliferation by increasing the expression of GPR173, CREB1, CYP19A1, KITLG, FSHR, and LHCGR (By similarity). It also increases the production of estradiol (E2) (By similarity). In the heart, it regulates contractility and relaxation (By similarity). It also plays a cardioprotective role during ischemia, where it activates the SAFE and RISK pathways (By similarity). Stimulates the proliferation and differentiation of preadipocytes (By similarity). In pancreatic islet cells, it induces proliferation of islet cells as well as the production of INS (By similarity).
subunit: Component of the MITRAC (mitochondrial translation regulation assembly intermediate of cytochrome c oxidase complex) complex, the core components of this complex being COA3/MITRAC12 and COX14 (By similarity). Interacts with COA3/MITRAC12 and COX4I1 (By similarity). Directly interacts with newly synthesized MT-CO1/COX1 (By similarity). - function: [Small integral membrane protein 20]: Component of the MITRAC (mitochondrial translation regulation assembly intermediate of cytochrome c oxidase complex) complex, that regulates cytochrome c oxidase assembly (PubMed:26321642). Promotes the progression of complex assembly after the association of MT-CO1/COX1 with COX4I1 and COX6C (PubMed:26321642). Chaperone-like assembly factor required to stabilize newly synthesized MT-CO1/COX1 and to prevent its premature turnover (PubMed:26321642).
function: [Phoenixin-14]: Peptide involved in a broad spectrum of regulatory functions (By similarity). Is a ligand for GPR173 (By similarity). As part of the reproductive cycle, it regulates gonadotropin-releasing hormone (GnRH) signaling in the hypothalamus and pituitary gland which augments the release of luteinizing hormone (By similarity). Plays a protective role in memory retention through activation of GNRHR (By similarity). Regulates the secretion of AVP by hypothalamic neurons (By similarity). Plays a role in the transduction of the itch sensation (By similarity). Induces anxiolytic effects, reducing behavior associated with anxiety (By similarity). Regulates food intake as well as satiation and satiety (By similarity). In the ovary, it regulates follicular growth by stimulating granulosa cell proliferation by increasing the expression of GPR173, CREB1, CYP19A1, KITLG, FSHR, and LHCGR (PubMed:30933929). It also increases the production of estradiol (E2) (PubMed:30933929). In the heart, it regulates contractility and relaxation (By similarity). It also plays a cardioprotective role during ischemia, where it activates the SAFE and RISK pathways (By similarity). Stimulates the proliferation and differentiation of preadipocytes (By similarity). In pancreatic islet cells, it induces proliferation of islet cells as well as the production of INS (By similarity).
function: [Phoenixin-20]: Peptide involved in a broad spectrum of regulatory functions (By similarity). Is a ligand for GPR173 (By similarity). As part of the reproductive cycle, it regulates gonadotropin-releasing hormone (GnRH) signaling in the hypothalamus and pituitary gland which augments the release of luteinizing hormone (By similarity). Plays a protective role in memory retention through activation of GNRHR (By similarity). Regulates the secretion of AVP by hypothalamic neurons (By similarity). Plays a role in the transduction of the itch sensation (By similarity). Induces anxiolytic effects, reducing behavior associated with anxiety (By similarity). Regulates food intake as well as satiation and satiety (By similarity). In the ovary, it regulates follicular growth by stimulating granulosa cell proliferation by increasing the expression of GPR173, CREB1, CYP19A1, KITLG, FSHR, and LHCGR (PubMed:30933929). It also increases the production of estradiol (E2) (PubMed:30933929). In the heart, it regulates contractility and relaxation (By similarity). It also plays a cardioprotective role during ischemia, where it activates the SAFE and RISK pathways (By similarity). Stimulates the proliferation and differentiation of preadipocytes (By similarity). In pancreatic islet cells, it induces proliferation of islet cells as well as the production of INS (By similarity).
subunit: Component of the MITRAC (mitochondrial translation regulation assembly intermediate of cytochrome c oxidase complex) complex, the core components of this complex being COA3/MITRAC12 and COX14 (PubMed:26321642). Interacts with COA3/MITRAC12 and COX4I1 (PubMed:26321642). Directly interacts with newly synthesized MT- CO1/COX1 (PubMed:26321642). - MITRAC7 Acts as a COX1-Specific Chaperone and Reveals a Checkpoint during Cytochrome c Oxidase Assembly.
Dennerlein, Cell reports 2015 (PubMed)- GeneRIF: SMIM20 (MITRAC7) is a COX1 specific chaperone which is necessary for cytochrome c oxidase biogenesis.
- GeneRIF: MITRAC7 affects the biogenesis pathway by stabilizing newly synthesized COX1 in assembly intermediates, concomitantly preventing turnover.
- Characterization of the cellular localization of C4orf34 as a novel endoplasmic reticulum resident protein
Jun, BMB reports 2014 - “...AAI54300); Xenopus, Xenopus laevis (NCBI Accession Number: NP_001084560). C4orf52: Human, Homo sapience (NCBI Accession Number: NP_001138904); Mouse, Mus musculus (NCBI Accession Number: NP_001138905); Zebrafish, Danio rerio (NCBI Accession Number: XP_002663002); Aplysia, Aplysia californica (NCBI Accession Number: XP_005096219). C4orf32: Human, Homo sapience (NCBI Accession Number: NP_689613); Mouse,...”
- Oral Glucose Mobilizes Triglyceride Stores From the Human Intestine
Xiao, Cellular and molecular gastroenterology and hepatology 2019 - “...LAP3 0.4431 .0436 Protein metabolism Q9NR19 Acetyl-coenzyme A synthetase; cytoplasmic ACSS2 0.4512 .0470 Lipid metabolism Q8N5G0 Small integral membrane protein 20 SMIM20 0.4532 .0296 Mitochondria/redox P49247 Ribose-5-phosphate isomerase RPIA 0.4698 .0326 Carbohydrate metabolism Q9Y333 U6 snRNA-associated Sm-like protein LSm2 LSM2 0.4741 .0355 Transcription/RNA processing/translation Q9H490 Phosphatidylinositol...”
SIM20_MOUSE / D3Z7Q2 Small integral membrane protein 20; Mitochondrial translation regulation assembly intermediate of cytochrome c oxidase protein of 7 kDa; MITRAC7 from Mus musculus (Mouse) (see 9 papers)
NP_001138905 small integral membrane protein 20 from Mus musculus
Aligns to 4:60 / 69 (82.6%), covers 100.0% of PF15061, 95.6 bits
- function: [Small integral membrane protein 20]: Component of the MITRAC (mitochondrial translation regulation assembly intermediate of cytochrome c oxidase complex) complex, that regulates cytochrome c oxidase assembly (By similarity). Promotes the progression of complex assembly after the association of MT-CO1/COX1 with COX4I1 and COX6C (By similarity). Chaperone-like assembly factor required to stabilize newly synthesized MT-CO1/COX1 and to prevent its premature turnover (By similarity).
function: [Phoenixin-14]: Peptide involved in a broad spectrum of regulatory functions (PubMed:25687846, PubMed:26505917, PubMed:27268078). Is a ligand for GPR173 (By similarity). As part of the reproductive cycle, it regulates gonadotropin-releasing hormone (GnRH) signaling in the hypothalamus and pituitary gland which augments the release of luteinizing hormone (PubMed:27268078). More specifically, it regulates the expression of transcription factors CEBPB and POU2F1/OCT1 through the cAMP-PKA signaling pathway, which subsequently regulate the expression of GNRHR and KISS1 (PubMed:27268078). Plays a protective role in memory retention through activation of GNRHR (PubMed:26505917). Regulates the secretion of AVP by hypothalamic neurons (By similarity). Plays a role in the transduction of the itch sensation (PubMed:26415767). Induces anxiolytic effects, reducing behavior associated with anxiety (PubMed:25687846). Regulates food intake as well as satiation and satiety by increasing Nucb2 expression in neurons (By similarity). In the ovary, it regulates follicular growth by stimulating granulosa cell proliferation by increasing the expression of GPR173, CREB1, CYP19A1, KITLG, FSHR, and LHCGR (PubMed:30933929). It also increases the production of estradiol (E2) (PubMed:30933929). In the heart, it regulates contractility and relaxation by activating the AKT1-NOS3 and MAPK1-MAPK3 signaling pathways (By similarity). It also plays a cardioprotective role during ischemia, where it activates the SAFE and RISK pathways (By similarity). Stimulates the proliferation and differentiation of preadipocytes (PubMed:30251651). In pancreatic islet cells, it induces proliferation of islet cells as well as the production of INS through activation of the MAPK1-MAPK3 signaling pathways (PubMed:31422055).
function: [Phoenixin-20]: Peptide involved in a broad spectrum of regulatory functions (PubMed:25687846, PubMed:26505917, PubMed:27268078). Is a ligand for GPR173 (By similarity). As part of the reproductive cycle, it regulates gonadotropin-releasing hormone (GnRH) signaling in the hypothalamus and pituitary gland which augments the release of luteinizing hormone (PubMed:27268078). More specifically, it regulates the expression of transcription factors CEBPB and POU2F1/OCT1 through the cAMP-PKA signaling pathway, which subsequently regulate the expression of GNRHR and KISS1 (PubMed:27268078). Plays a protective role in memory retention through activation of GNRHR (PubMed:26505917). Regulates the secretion of AVP by hypothalamic neurons (By similarity). Plays a role in the transduction of the itch sensation (PubMed:26415767). Induces anxiolytic effects, reducing behavior associated with anxiety (PubMed:25687846). Regulates food intake as well as satiation and satiety by increasing Nucb2 expression in neurons (By similarity). In the ovary, it regulates follicular growth by stimulating granulosa cell proliferation by increasing the expression of GPR173, CREB1, CYP19A1, KITLG, FSHR, and LHCGR (PubMed:30933929). It also increases the production of estradiol (E2) (PubMed:30933929). In the heart, it regulates contractility and relaxation by activating the AKT1-NOS3 and MAPK1-MAPK3 signaling pathways (By similarity). It also plays a cardioprotective role during ischemia, where it activates the SAFE and RISK pathways (By similarity). Stimulates the proliferation and differentiation of preadipocytes (PubMed:30251651). In pancreatic islet cells, it induces proliferation of islet cells as well as the production of INS through activation of the MAPK1-MAPK3 signaling pathways (PubMed:31422055).
subunit: Component of the MITRAC (mitochondrial translation regulation assembly intermediate of cytochrome c oxidase complex) complex, the core components of this complex being COA3/MITRAC12 and COX14 (By similarity). Interacts with COA3/MITRAC12 and COX4I1 (By similarity). Directly interacts with newly synthesized MT-CO1/COX1 (By similarity). - Characterization of the cellular localization of C4orf34 as a novel endoplasmic reticulum resident protein
Jun, BMB reports 2014 - “...NP_001084560). C4orf52: Human, Homo sapience (NCBI Accession Number: NP_001138904); Mouse, Mus musculus (NCBI Accession Number: NP_001138905); Zebrafish, Danio rerio (NCBI Accession Number: XP_002663002); Aplysia, Aplysia californica (NCBI Accession Number: XP_005096219). C4orf32: Human, Homo sapience (NCBI Accession Number: NP_689613); Mouse, Mus musculus (NCBI Accession Number: EDL12251); Zebrafish,...”
SIM20_RAT / C0HLM6 Small integral membrane protein 20; Mitochondrial translation regulation assembly intermediate of cytochrome c oxidase protein of 7 kDa; MITRAC7 from Rattus norvegicus (Rat) (see 10 papers)
NP_001128111 small integral membrane protein 20 from Rattus norvegicus
Aligns to 4:60 / 69 (82.6%), covers 100.0% of PF15061, 94.5 bits
- function: [Small integral membrane protein 20]: Component of the MITRAC (mitochondrial translation regulation assembly intermediate of cytochrome c oxidase complex) complex, that regulates cytochrome c oxidase assembly (By similarity). Promotes the progression of complex assembly after the association of Mt-Co1/Cox11 with Cox4I1 and Cox6c (By similarity). Chaperone-like assembly factor required to stabilize newly synthesized Mt-Co1/Cox1 and to prevent its premature turnover (By similarity).
function: [Phoenixin-14]: Peptide involved in a broad spectrum of regulatory functions (PubMed:27440717, PubMed:28844870, PubMed:29364701, PubMed:28965207, PubMed:30609107). Is a ligand for GPR173 (PubMed:27440717). As part of the reproductive cycle, it regulates gonadotropin-releasing hormone (GnRH) signaling in the hypothalamus and pituitary gland which augments the release of luteinizing hormone (PubMed:22963497, PubMed:27440717). More specifically, it regulates the expression of transcription factors CEBPB and POU2F1/OCT1 through the cAMP-PKA signaling pathway, which subsequently regulate the expression of GNRHR and KISS1 (By similarity). Plays a protective role in memory retention through activation of GNRHR (By similarity). Regulates the secretion of AVP by hypothalamic neurons (PubMed:29364701). Plays a role in the transduction of the itch sensation (By similarity). Induces anxiolytic effects, reducing behavior associated with anxiety (By similarity). Regulates food intake as well as satiation and satiety by increasing NUCB2 expression in neurons (PubMed:28844870, PubMed:30930149). In the ovary, it regulates follicular growth by stimulating granulosa cell proliferation by increasing the expression of GPR173, CREB1, CYP19A1, KITLG, FSHR, and LHCGR (By similarity). It also increases the production of estradiol (E2) (By similarity). In the heart, it regulates contractility and relaxation by activating the AKT1-NOS3 and MAPK1-MAPK3 signaling pathways (PubMed:28965207). It also plays a cardioprotective role during ischemia, where it activates the SAFE and RISK pathways (PubMed:28965207). Stimulates the proliferation and differentiation of preadipocytes (PubMed:30251651). In pancreatic islet cells, it induces proliferation of islet cells as well as the production of INS1 and INS2 through activation of the MAPK1-MAPK3 signaling pathways (PubMed:31422055).
function: [Phoenixin-20]: Peptide involved in a broad spectrum of regulatory functions (PubMed:27440717, PubMed:28844870, PubMed:29364701, PubMed:28965207, PubMed:30609107). Is a ligand for GPR173 (PubMed:27440717). As part of the reproductive cycle, it regulates gonadotropin-releasing hormone (GnRH) signaling in the hypothalamus and pituitary gland which augments the release of luteinizing hormone (PubMed:22963497, PubMed:27440717). More specifically, it regulates the expression of transcription factors CEBPB and POU2F1/OCT1 through the cAMP-PKA signaling pathway, which subsequently regulate the expression of GNRHR and KISS1 (By similarity). Plays a protective role in memory retention through activation of GNRHR (By similarity). Regulates the secretion of AVP by hypothalamic neurons (PubMed:29364701). Plays a role in the transduction of the itch sensation (By similarity). Induces anxiolytic effects, reducing behavior associated with anxiety (By similarity). Regulates food intake as well as satiation and satiety by increasing NUCB2 expression in neurons (PubMed:28844870, PubMed:30930149). In the ovary, it regulates follicular growth by stimulating granulosa cell proliferation by increasing the expression of GPR173, CREB1, CYP19A1, KITLG, FSHR, and LHCGR (By similarity). It also increases the production of estradiol (E2) (By similarity). In the heart, it regulates contractility and relaxation by activating the AKT1-NOS3 and MAPK1-MAPK3 signaling pathways (PubMed:28965207). It also plays a cardioprotective role during ischemia, where it activates the SAFE and RISK pathways (PubMed:28965207). Stimulates the proliferation and differentiation of preadipocytes (PubMed:30251651). In pancreatic islet cells, it induces proliferation of islet cells as well as the production of INS1 and INS2 through activation of the MAPK1-MAPK3 signaling pathways (PubMed:31422055).
subunit: Component of the MITRAC (mitochondrial translation regulation assembly intermediate of cytochrome c oxidase complex) complex, the core components of this complex being Coa3/Mitrac12 and Cox14 (By similarity). Interacts with Coa3/Mitrac12 and Cox4i1 (By similarity). Directly interacts with newly synthesized Mt-Co1/Cox1 (By similarity). - Modulatory effect of olanzapine on SMIM20/phoenixin, NPQ/spexin and NUCB2/nesfatin-1 gene expressions in the rat brainstem.
Pałasz, Pharmacological reports : PR 2021 - GeneRIF: Modulatory effect of olanzapine on SMIM20/phoenixin, NPQ/spexin and NUCB2/nesfatin-1 gene expressions in the rat brainstem.
- Restraint stress affects circulating NUCB2/nesfatin-1 and phoenixin levels in male rats.
Schalla, Psychoneuroendocrinology 2020 (PubMed)- GeneRIF: Restraint stress affects circulating NUCB2/nesfatin-1 and phoenixin levels in male rats.
- Contingent role of phoenixin and nesfatin-1 on secretions of the male reproductive hormones.
Guvenc, Andrologia 2019 (PubMed)- GeneRIF: phoenixin induced a significant enhancement in plasma FSH, LH and testosterone without inducing any alteration in plasma GnRH in the rats.
- A novel reproductive peptide, phoenixin.
Yosten, Journal of neuroendocrinology 2013 - GeneRIF: Phoenixin may represent a new class of hypothalamically-derived pituitary priming factors that sensitize the pituitary to the action of other releasing factors.
NP_001138902 small integral membrane protein 20 from Gallus gallus
Aligns to 2:58 / 67 (85.1%), covers 100.0% of PF15061, 91.5 bits
NP_001289553 small integral membrane protein 20 from Danio rerio
Aligns to 2:58 / 68 (83.8%), covers 96.5% of PF15061, 88.3 bits
LOC104975039 small integral membrane protein 20-like from Bos taurus
Aligns to 19:75 / 84 (67.9%), covers 100.0% of PF15061, 81.0 bits
XP_005096219 small integral membrane protein 20 from Aplysia californica
Aligns to 33:89 / 99 (57.6%), covers 98.2% of PF15061, 63.4 bits
LOC724988 uncharacterized protein LOC724988 from Apis mellifera
Aligns to 3:51 / 58 (84.5%), covers 68.4% of PF15061, 44.7 bits
- Age-dependent transcriptional and epigenomic responses to light exposure in the honey bee brain
Becker, FEBS open bio 2016 - “...2.04 miR let7 miR let7 MI0005726 (miRBase.org) TGAGGTAGTAGGTTGTATAGT/ miScript Universal Primer (Qiagen) 2.01 RNU62 Uncharacterized LOC724988 GB50324 RNU62 miScript Primer Assay (Qiagen) 2.01 bgm Very longchainfattyacidCoA ligase bubblegum GB51580 Outer primers: TTTTTTAATAATTTTAGGTAGTTG/ AATAAATACTTACTTCAAATTTAC Nested primers: GCAGAATTCTATTTTATGTTATATATAGTTGGT/ CGCAAGCTTCTAATATATTCACAATATATACAC / John Wiley & Sons, Ltd Brain dissections were...”
Or search for genetic data about PF15061 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory