Family Search for PF16473 (Rv2179c-like)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF16473 hits 50 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
STMUK_2027 3'-5' exonuclease from Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1
Aligns to 2:178 / 189 (93.7%), covers 100.0% of PF16473, 240.5 bits
BHE81_21560 exonuclease from Klebsiella sp. AqSCr
Aligns to 518:696 / 712 (25.1%), covers 99.4% of PF16473, 235.2 bits
- Transcriptome Analysis Reveals Cr(VI) Adaptation Mechanisms in Klebsiella sp. Strain AqSCr
Lara, Frontiers in microbiology 2021 - “...-adj slightly greater than (0.0106) the cutoff level ( Supplementary Table 5 ). Moreover, RecE (BHE81_21560), NrdG (BHE81_25210), and RtprB (BHE81_25215), also involved in DNA repair and replication, were downregulated with respect to the controls ( Supplementary Table 6 ). Sulfur, Phosphate, Molybdate, Iron, and Manganese...”
DR88_1301 exonuclease from Klebsiella pneumoniae
Aligns to 518:696 / 712 (25.1%), covers 99.4% of PF16473, 233.8 bits
- Chemogenomic Screen for Imipenem Resistance in Gram-Negative Bacteria
El, mSystems 2019 - “...COG0215 Cysteinyl-tRNA synthetase DR76_4436 (2) DR88_4524 (3) cysS L COG0847 DNA polymerase III DR76_3797 (2) DR88_1301 (2) M COG0860 N-acetylmuramoyl- l -alanine amidase DR76_1787 (9) DR88_2369 (26) amiC COG1388 LysM repeat DR76_1882 (5) DR88_2261 (18) nlpD COG0472 UDP-N-acetylmuramyl pentapeptide phosphotransferase/ UDP-N-acetylglucosamine-1-phosphate transferase DR76_689 (5) DR88_3479 (5)...”
DR76_3797 exonuclease from Escherichia coli ATCC 25922
Aligns to 630:802 / 812 (21.3%), covers 99.4% of PF16473, 227.4 bits
- Chemogenomic Screen for Imipenem Resistance in Gram-Negative Bacteria
El, mSystems 2019 - “...(2) gidA COG0215 Cysteinyl-tRNA synthetase DR76_4436 (2) DR88_4524 (3) cysS L COG0847 DNA polymerase III DR76_3797 (2) DR88_1301 (2) M COG0860 N-acetylmuramoyl- l -alanine amidase DR76_1787 (9) DR88_2369 (26) amiC COG1388 LysM repeat DR76_1882 (5) DR88_2261 (18) nlpD COG0472 UDP-N-acetylmuramyl pentapeptide phosphotransferase/ UDP-N-acetylglucosamine-1-phosphate transferase DR76_689 (5)...”
c1402 Exodeoxyribonuclease VIII from Escherichia coli CFT073
Aligns to 631:803 / 813 (21.3%), covers 99.4% of PF16473, 227.4 bits
EC1303_c12230 exonuclease from Escherichia coli 1303
Aligns to 641:813 / 823 (21.0%), covers 99.4% of PF16473, 227.1 bits
- No evidence for a bovine mastitis Escherichia coli pathotype
Leimbach, BMC genomics 2017 - “...island (PAI). Finally, two genes contained in MAEC 1303 prophage 1, encoding for an exonuclease (EC1303_c12230) and an envelope protein (EC1303_c12530), are also associated with phylogroups A/B1/E. In summary, the putative mastitis-eliciting function of any of the genes within the significantly MAEC-associated OGs is unclear. A...”
UTI89_C1459 putative exonuclease VIII, ds DNA exonuclease encoded by prophage CP-933O from Escherichia coli UTI89
Aligns to 641:813 / 823 (21.0%), covers 99.4% of PF16473, 227.1 bits
- High-throughput sequencing of sorted expression libraries reveals inhibitors of bacterial cell division
Mediati, BMC genomics 2018 - “...2284 4.7 174.7 UTI89_C1358 S UTI89_C1359 minE D UTI89_C1360 minD D UTI89_C1361 minC D 1,392,0091,395,131 UTI89_C1459 exoO SR 3123 70.7 10,266.0 UTI89_C1460 S UTI89_C1461 dicB D UTI89_C1462 dicF RD UTI89_C1463 ydfC S UTI89_C1464 ydfB S UTI89_C1465 ydfA S UTI89_C1466 dicA KT UTI89_C1467 dicC R 1,961,2911,963,326 UTI89_C2055...”
Z2037 putative exonuclease VIII, ds DNA exonuclease, 5' --> 3' specific encoded by prophage CP-933O from Escherichia coli O157:H7 EDL933
Aligns to 641:813 / 823 (21.0%), covers 99.4% of PF16473, 226.5 bits
- Development of a High Resolution Virulence Allelic Profiling (HReVAP) Approach Based on the Accessory Genome of Escherichia coli to Characterize Shiga-Toxin Producing E. coli (STEC)
Michelacci, Frontiers in microbiology 2016 - “...39347663934848 83 CCATTATAAACATTTGCCAGACC efa2 Z4333 ACTAAGATCAATACAAGGATTCC 39364243936496 73 ATCCATCAGGCCATAGGTG OI-57 Z2036 ATCGCCCGTTTGCTGAGCTT 18501061850256 151 ACGTTTTGGCACCAGACCGT Z2037 TTTCCGGTTCCTGTTGCGCT 18517361851871 136 ACCCGCGATTCTGTGAACCA Z2039 TTTGTGATGCGGTGCCTGGT 18538721853944 73 GGGATTCTCTGTATCCGGCGTT Z2045 ATCGGTTCGCCTGGTTGCTT 18559961856164 169 AGGCCGCATTAGGTAAGCTGGT Z2046 AGCTTGCCAATGTCGCAGGA 18563451856517 173 TTCATTGTTCAACCGCCCCG Z2048 TGGCTTTGCCGGAGACAGAA 18577001857842 143 TTTAACCTGCGCCCTGACGT adfO Z2053 AACTGTCGCCGCAATCCGAA 18606161860778 163 GTCTGGCGCTATTTCCACGACA...”
- “...Z2054, and Z2101, were positive in more than 95% of the strains tested, while genes Z2037, Z2039, Z2056, Z2057, Z2060, Z2069, Z2071, Z2084, Z2086, Z2096, Z2118, Z2131, and Z2146, were positive in more than 50% of the population assayed. As a whole, a mean of 15.9...”
EC1303_c16970 exonuclease from Escherichia coli 1303
Aligns to 641:813 / 823 (21.0%), covers 99.4% of PF16473, 222.9 bits
- No evidence for a bovine mastitis Escherichia coli pathotype
Leimbach, BMC genomics 2017 - “...shock proteins, EC1303_c16710 and EC1303_c16770, respectively), and recE (exonuclease VIII, 5 ->3 specific dsDNA exonuclease, EC1303_c16970) also lie within the same prophage region. Because the E. coli 1303 prophage 2 genome does not contain genes related to metabolic or virulence functions, the role of the respective...”
Z1324 putative exodeoxyribonuclease VIII for cryptic prophage CP-933M from Escherichia coli O157:H7 EDL933
Aligns to 641:813 / 823 (21.0%), covers 100.0% of PF16473, 209.6 bits
ECs1057 hypothetical protein from Escherichia coli O157:H7 str. Sakai
Aligns to 641:813 / 823 (21.0%), covers 100.0% of PF16473, 209.6 bits
- Construction and Analysis of Gene Co-Expression Networks in Escherichia coli
Liu, Cells 2018 - “...co-expression modules in E. coli . Module Gene Encoding Protein Black Z4148 Hypothetical protein Blue ECs1057 Hypothetical protein Brown4 fhuF Ferric iron reductase protein Cyan ECs2033 Hypothetical protein Darkgreen elaA Hypothetical protein Darkgrey rfbB dTDP-glucose 4,6 dehydratase, NAD(P)-binding Darkmagenta c1590 Tail component of prophage Darkolivegreen ssuC...”
ECs1503 hypothetical protein from Escherichia coli O157:H7 str. Sakai
Aligns to 1:135 / 145 (93.1%), covers 74.0% of PF16473, 159.1 bits
Z1766 unknown protein encoded by prophage CP-933N from Escherichia coli O157:H7 EDL933
Aligns to 1:104 / 114 (91.2%), covers 57.1% of PF16473, 125.8 bits
- Comparative genomics analysis and characterization of Shiga toxin-producing Escherichia coli O157:H7 strains reveal virulence genes, resistance genes, prophages and plasmids
Naidoo, BMC genomics 2023 - “...Z563, Z570, Z852, Z866, Z869, Z885, Z887, Z892, Z903, Z910, Z1486, Z1504, Z1615, Z1626, Z1723, Z1766, Z1767, Z1768, Z1769, Z1811, Z1812, Z1813, Z1814, Z1815, Z1816, Z1825, Z1826, Z1830, Z1831, Z1832, Z1833, Z1834, Z1835, Z1836. The number or virulence genes present ranged from 15 to 46. The...”
- “...4 questionable and 6 incomplete) and percentage GC of 50.50%. Fourteen strains (Z852, Z903, Z1626, Z1766, Z1768, Z1769, Z1812, Z1815, Z1816, Z1825, Z1830, Z1831, Z1832 and Z1833) had 21 prophages (13 intact, 5 questionable and 3 incomplete) and percentage GC of 50.53%. The results for the...”
- Genome structural variation in Escherichia coli O157:H7
Fitzgerald, Microbial genomics 2021 - “...N j (0) and N j (1)=initial and final colony counts of structural variant strain (Z1766, Z1767 or Z1615), respectively. For controls WT strain 9000 or Z1723 were competed against Nal r derivatives generated previously [ 52 ]. Fitness was analysed by ordinary one-way ANOVA with...”
- “...53 ] and pDW6 [ 54 ], respectively. Reporter plasmids were transformed into strains Z1723, Z1766 and Z1767 by electroporation and transformants were cultured overnight in LB media supplemented with chloramphenicol (50 g ml 1 ). Overnight cultures were diluted 1 : 100 into MEM-HEPES and...”
EXOD_BPT4 / P04536 Exodeoxyribonuclease; 3'-5' exonuclease; EC 3.1.11.1 from Enterobacteria phage T4 (Bacteriophage T4) (see 2 papers)
Aligns to 3:203 / 227 (88.5%), covers 79.1% of PF16473, 79.9 bits
- function: 3'-5' exonuclease that preferentially uses ssDNA as substrate. Plays a role in group I intron homing. May play a role in the final step of host DNA degradation, by scavenging DNA into mononucleotides.
catalytic activity: Exonucleolytic cleavage in the 3'- to 5'-direction to yield nucleoside 5'-phosphates.
SXYL_00943 3'-5' exonuclease from Staphylococcus xylosus
Aligns to 5:163 / 184 (86.4%), covers 96.0% of PF16473, 50.8 bits
EXRBN_MYCTU / P9WJ73 3'-5' exoribonuclease Rv2179c; EC 3.1.13.- from Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) (see paper)
NP_216695 3'-5' exoribonuclease from Mycobacterium tuberculosis H37Rv
Rv2179c hypothetical protein from Mycobacterium tuberculosis H37Rv
Aligns to 1:157 / 168 (93.5%), covers 97.7% of PF16473, 47.8 bits
- function: Exonuclease that cleaves single-stranded 3' overhangs of double-stranded RNA. Has no activity with 5' overhangs. Has negligible endonuclease activity. Can bind ATP, dATP and AMP (in vitro); the nucleotide occupies the predicted substrate binding site.
cofactor: Mg(2+) (Binds 1 Mg(2+) ion per subunit.)
subunit: Homodimer. - Mycobacterium tuberculosis Rv2179c protein establishes a new exoribonuclease family with broad phylogenetic distribution.
Abendroth, The Journal of biological chemistry 2014 - GeneRIF: Rv2179c is the founding member of a new, large RNase family with hundreds of members across the bacterial kingdom.
- Functional Whole Genome Screen of Nutrient-Starved Mycobacterium tuberculosis Identifies Genes Involved in Rifampin Tolerance
Matern, Microorganisms 2023 - “...starvation in Mtb mutants lacking the following genes: ercc3 , moeA1 , rv0049 , and rv2179c . These findings shed light on potential therapeutic targets, which could help shorten the duration and complexity of antitubercular regimens. Mycobacterium tuberculosis tolerance persistence virulence transposon sequencing molecular genetics bioinformatics...”
- “...3 ). Three genes met these criteria, namely rv0049 , moeA1 / rv0994 , and rv2179c . rv0049 ::Tn had a rifampin LFC of 2.99 ( p = 1.40 10 8 ) in nutrient-rich broth and LFC values of 1.45 ( p = 6.12 10 15...”
- Functional whole genome screen of nutrient-starvedMycobacterium tuberculosisidentifies genes involved in antibiotic tolerance
Matern, 2023 - Small RNAs Asserting Big Roles in Mycobacteria
Coskun, Non-coding RNA 2021 - “...D ( rv2681 ), and a divergent functional and structural ortholog of RNase T ( rv2179c ) [ 66 ]. As a large proportion of mycobacterial tRNAs require an enzymatic addition of the CCA sequence at their 3 end, they are likely additionally processed by the...”
- “...A. Andrews E.S. Myler P.J. Staker B.L. Edwards T.E. Arcus V.L. Grundner C. Mycobacterium tuberculosis Rv2179c protein establishes a new exoribonuclease family with broad phylogenetic distribution J. Biol. Chem. 2014 289 2139 2147 10.1074/jbc.M113.525683 24311791 67. Jain C. Novel role for RNase PH in the degradation...”
- Serum proteomic analysis of Mycobacterium tuberculosis antigens for discriminating active tuberculosis from latent infection
Peng, The Journal of international medical research 2020 - “...Rv1876-IgG 1.030 0.019 bfrA Bacterioferritin BfrA Rv1876-IgM 1.083 0 bfrA Bacterioferritin BfrA Rv2179c-IgG 1.007 0.0031 Rv2179c 3-5 exoribonuclease Rv2368c-IgG 1.028 0.0064 phoH1 Phosphate starvation-inducible protein PhoH Rv2368c-IgM 1.022 0.0033 phoH1 Phosphate starvation-inducible protein PhoH Rv2511-IgG 1.036 0.0007 orn Oligoribonuclease Rv3248c-IgG 1.046 0.0001 sahH Adenosylhomocysteinase Rv3248c-IgM 1.024...”
- Mycobacterium tuberculosis Rv2179c protein establishes a new exoribonuclease family with broad phylogenetic distribution
Abendroth, The Journal of biological chemistry 2014 - “...Inc. Published in the U.S.A. Mycobacterium tuberculosis Rv2179c Protein Establishes a New Exoribonuclease Family with Broad Phylogenetic Distribution* Received...”
- “...unknown. Here, we identify the hypothetical Mtb protein Rv2179c as a highly divergent exoribonuclease. Although the primary sequence of Rv2179c has no...”
- Deciphering the role of IS6110 in a highly transmissible Mycobacterium tuberculosis Beijing strain, GC1237
Alonso, Tuberculosis (Edinburgh, Scotland) 2011 (PubMed)- “...copy located 31 bp upstream of the essential gene Rv2179c and compared to the reference strain H37Rv. 0 false false Beijing genotype IS6110 Promoter activity...”
- “...3.7 IS6110 is acting as a promoter of Rv2179c gene both under extracellular and intracellular conditions 3.8 Rv2179c gene expression is increased in GC1237...”
- Lipoarabinomannan biosynthesis in Corynebacterineae: the interplay of two α(1→2)-mannopyranosyltransferases MptC and MptD in mannan branching
Mishra, Molecular microbiology 2011 - “...are retained at this locus: a serine/threonine protein kinase ( pknL ), hypothetical proteins (NCgl2099, Rv2179c; NCgl2094, Rv2175c) and a 3-deoxy-7-phosphoheptulonate synthase ( aroG ) ( Fig. 1A ). Fig. 1 Comparative gene relatedness of (12) and (16) mannopyranosyltransferases. A. The genomic region in selected Corynebacterianeae...”
- Regulation of Mycobacterium tuberculosis whiB3 in the mouse lung and macrophages
Banaiee, Infection and immunity 2006 - “...PCR Rv1651c RT PCR Rv1874 RT PCR Rv2031c (acr) RT PCR Rv2179c RT PCR Rv2780 (ald) RT PCR Rv3106 (fprA) RT PCR Rv3416 (whiB3) RT PCR Rv3451 RT PCR Forward whiB3...”
- More
4hecB / P9WJ73 Crystal structure of a putative uncharacterized protein from mycobacterium tuberculosis (see paper)
Aligns to 3:159 / 163 (96.3%), covers 97.7% of PF16473, 47.7 bits
- Ligand: magnesium ion (4hecB)
NCgl2099 polyadenylate-specific 3'-exoribonuclease AS from Corynebacterium glutamicum ATCC 13032
cg2392 hypothetical protein from Corynebacterium glutamicum ATCC 13032
Aligns to 1:156 / 168 (92.9%), covers 98.9% of PF16473, 46.0 bits
- Metabolic Engineering of Shikimic Acid-Producing Corynebacterium glutamicum From Glucose and Cellobiose Retaining Its Phosphotransferase System Function and Pyruvate Kinase Activities
Sato, Frontiers in bioengineering and biotechnology 2020 - “...of aroG from gtg to atg (aroG gtgatg ) with an in-frame deletion of cg2392 (NCgl2099) in SA-2 ( Figure 3D ). The resulting strain was named SA-5 (SA-2/cg2392, aroG gtgatg ). Changing the translational start codon of the gene increased its expression ( Vogt et...”
- Lipoarabinomannan biosynthesis in Corynebacterineae: the interplay of two α(1→2)-mannopyranosyltransferases MptC and MptD in mannan branching
Mishra, Molecular microbiology 2011 - “...genes are retained at this locus: a serine/threonine protein kinase ( pknL ), hypothetical proteins (NCgl2099, Rv2179c; NCgl2094, Rv2175c) and a 3-deoxy-7-phosphoheptulonate synthase ( aroG ) ( Fig. 1A ). Fig. 1 Comparative gene relatedness of (12) and (16) mannopyranosyltransferases. A. The genomic region in selected...”
- Metabolic Engineering of Shikimic Acid-Producing Corynebacterium glutamicum From Glucose and Cellobiose Retaining Its Phosphotransferase System Function and Pyruvate Kinase Activities
Sato, Frontiers in bioengineering and biotechnology 2020 - “...SA-2 + aroK:P H 36 -aroB This study SA-5 SA-2 + aroG gtg atg , cg2392 This study SA-6 SA-5 + aroK:P H 36 -aroB This study SA-7 SA-5 + aroK:P H 36 -aroB, pta:P H 36 -aroG This study SA-8 SA-7 + ldh This study...”
- “...Hin dIII. Other plasmids for gene deletion ( qsuD , qsuB , nagD , and cg2392 ) and for point mutation (gnd S361F) were constructed similarly. We constructed an aroG -expressing plasmid under the control of the H36 promoter as follows. A gene fragment encoding aroG...”
B2HGU6 poly(A)-specific ribonuclease (EC 3.1.13.4) from Mycobacterium marinum (see paper)
Aligns to 1:157 / 159 (98.7%), covers 96.0% of PF16473, 45.2 bits
DFS55_14810 polyadenylate-specific 3'-exoribonuclease AS from Mycobacterium avium subsp. hominissuis
Aligns to 1:159 / 162 (98.1%), covers 97.7% of PF16473, 44.5 bits
SA1710 hypothetical protein from Staphylococcus aureus subsp. aureus N315
Aligns to 5:163 / 184 (86.4%), covers 96.0% of PF16473, 44.4 bits
SACOL1954 exonuclease from Staphylococcus aureus subsp. aureus COL
SAOUHSC_02110 hypothetical protein from Staphylococcus aureus subsp. aureus NCTC 8325
SAUSA300_1875 exonuclease from Staphylococcus aureus subsp. aureus USA300_FPR3757
Aligns to 5:163 / 184 (86.4%), covers 96.0% of PF16473, 44.0 bits
- Importance of bacillithiol in the oxidative stress response of Staphylococcus aureus
Posada, Infection and immunity 2014 - “...2.84 Nucleotide excision and repair mutS2 radA radC SACOL1954 uvrA uvrB uvrC Recombination and DNA strand exchange inhibitor protein DNA repair DNA repair...”
- Designing Single-Atom Active Sites on sp2 -Carbon Linked Covalent Organic Frameworks to Induce Bacterial Ferroptosis-Like for Robust Anti-Infection Therapy
Sun, Advanced science (Weinheim, Baden-Wurttemberg, Germany) 2023 - “...in the Ir SAC group (SAOUHSC_02334, SAOUHSC_02276, SAOUHSC_00624, etc.) and in the Ru SAC group (SAOUHSC_02110, SAOUHSC_00730, SAOUHSC_01363, etc.) was markedly regulated, meaning that bacterial genetic systems were further disrupted by the significant oxidative stress. 5) Beyond these physiological activities, the expressions of genes associated with...”
- Identification of Methicillin-Resistant Staphylococcus aureus (MRSA) Genetic Factors Involved in Human Endothelial Cells Damage, an Important Phenotype Correlated with Persistent Endovascular Infection
Xiao, Antibiotics (Basel, Switzerland) 2022 - “...11.00 SAUSA300_0941 hypothetical putative ferrichrome ABC transporter 24.69 6.43 SAUSA300_0951 sspA V8 protease 24.55 8.41 SAUSA300_1875 hypothetical exonuclease 24.52 10.68 SAUSA300_0566 hypothetical amino acid permease 24.49 5.06 SAUSA300_0871 hypothetical hypothetical protein 24.49 12.19 SAUSA300_0565 hypothetical conserved hypothetical protein 24.43 5.34 SAUSA300_0391 hypothetical hypothetical protein 24.38 0.45...”
- “...8.31 63.35 2.06 SAUSA300_1040 EC damage 30% in 384-well plates hypothetical 26.74 8.21 30.92 a SAUSA300_1875 hypothetical 24.52 10.68 30.51 a SAUSA300_0871 hypothetical 24.49 12.19 28.60 a SAUSA300_1950 hypothetical 23.24 9.64 25.87 a SAUSA300_0253 scdA 21.83 12.24 22.52 a SAUSA300_0649 hypothetical 20.24 0.89 22.65 a SAUSA300_2587...”
X276_07910 exonuclease domain-containing protein from Clostridium beijerinckii NRRL B-598
Aligns to 2:161 / 310 (51.6%), covers 99.4% of PF16473, 43.3 bits
EF2736 exonuclease from Enterococcus faecalis V583
OG1RF_12100 3'-5' exonuclease from Enterococcus faecalis OG1RF
Aligns to 2:161 / 177 (90.4%), covers 97.2% of PF16473, 42.1 bits
lp_0811 DNA-directed DNA polymerase III, epsilon chain (putative) from Lactobacillus plantarum WCFS1
Aligns to 1:156 / 173 (90.2%), covers 95.5% of PF16473, 42.0 bits
- Transcriptomic Evidence of Molecular Mechanisms Underlying the Response of Lactobacillus Plantarum WCFS1 to Hydroxytyrosol
Reverón, Antioxidants (Basel, Switzerland) 2020 - “...cell proliferation that code for factors playing roles in DNA ( lp_0787 or rpoN ; lp_0811 (DNA-directed DNA polymerase III subunit epsilon; lp_2454 (DNA adenine methylase)) or RNA replication ( lp_1613 or rpoZ ), were downregulated. In the same vein, genes coding for cell division (...”
- Identification of key proteins and pathways in cadmium tolerance of Lactobacillus plantarum strains by proteomic analysis
Zhai, Scientific reports 2017 - “...global stress response protein) and pdc (PadA) was observed, and the two proteins (dnaE and lp_0811) involved in pyrimidine metabolism interacted with each other. For altered protein profiles of CCFM191 after Cd exposure (Fig. S3 ), proteins related to glycerol lipid metabolism, pyrimidine metabolism and global...”
- “...(lp_2444), Nucleotide-binding protein, universal stress protein UspA family (lp_2993), DNA-directed DNA polymerase III subunit epsilon (lp_0811) and Cold shock protein 1 (CspP), were randomly selected for RT-qPCR assay to confirm the reliability of proteomic results. For this reason, the proteins in the same operon are preferred,...”
LBUL_0800 3'-5' exonuclease with to CRISPR-associated protein from COG1343 from Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Aligns to 125:283 / 290 (54.8%), covers 96.6% of PF16473, 40.3 bits
- Evolution and classification of the CRISPR-Cas systems
Makarova, Nature reviews. Microbiology 2011 - “...in GSU0057 from G. sulfurreducens ), of cas1 and a DEDDh family exonuclease (for example, LBUL_0800 from Lactobacillus delbrueckii subsp. bulgaricus ) and of cas1 and a reverse transcriptase (for example, VVA1544 from Vibrio vulnificus ). In several genomes, homologues of some cas genes also appear...”
8h18A / A0AA34S1Q0 Crystal structure of dnaq domain of streptococcus thermophilus strain dgcc 7710 (see paper)
Aligns to 4:164 / 172 (93.6%), covers 93.8% of PF16473, 40.2 bits
- Ligand: magnesium ion (8h18A)
8fycK Cryo-em structure of cas1:cas2-deddh:half-site integration complex linear crispr repeat conformation (see paper)
Aligns to 2:161 / 164 (97.6%), covers 94.4% of PF16473, 39.7 bits
FD24_GL002157 type I-E CRISPR-associated endoribonuclease Cas2e from Lactiplantibacillus pentosus DSM 20314
Aligns to 130:292 / 299 (54.5%), covers 97.2% of PF16473, 37.2 bits
- In silico genomic analysis of the potential probiotic Lactiplantibacillus pentosus CF2-10N reveals promising beneficial effects with health promoting properties
Abriouel, Frontiers in microbiology 2022 - “...maintenance of CRISPR repeat elements, defense response to virus, nucleic acid phosphodiester bond hydrolysis gene_2924 FD24_GL002157 3,234,2703,235,169 + 900 Type I-E CRISPR-associated endoribonuclease Cas2 GO:0003676 Nucleic acid binding gene_2925 gene_2925 * 3,236,488-3,239,202 + 2,715 CRISPR-associated helicase/endonuclease Cas3 gene_2926 gene_2926 * 3,239,207-3,240,958 + 1752 CRISPR-associated protein gene_2927...”
LCRIS_01207 CRISPR-associated protein, Cas2 from Lactobacillus crispatus ST1
Aligns to 129:290 / 298 (54.4%), covers 96.6% of PF16473, 37.0 bits
- Comparative genomics of Lactobacillus crispatus suggests novel mechanisms for the competitive exclusion of Gardnerella vaginalis
Ojala, BMC genomics 2014 - “...3 LACT02396 Cas9/Csn1 0 0 0 1/1 1/1 0 0 0 1/1 0 3 3 LCRIS_01207 cas-CT1978 0 0 0 0 0 0 0 0 0 1/1 1 1 LCRIS_01209 casE-Cse3 0 0 0 0 0 0 0 0 0 1/1 1 1 LCRIS_01210 casD-Cas5e, CRISPR-cas5...”
- BLANNOTATOR: enhanced homology-based function prediction of bacterial proteins
Kankainen, BMC bioinformatics 2012 - “...interspaced short palindromic repeats (CRISPR) system, whereas the competing methods failed to infer functions for LCRIS_01207 and LCRIS_01212, both of which are components of this vital defence mechanism that provides acquired phage resistance in bacteria and archaea [ 31 ]. LCRIS_01207 and LCRIS_01212 showed only remote...”
- “...with meaningful functional information had limited ( 50%) identity to the queried protein. For example, LCRIS_01207 had acceptable similarity to 59 sequences annotated as ' CRISPR-associated protein, Cas2 ', but these sequences displayed a maximum identity of 45%. Thus, if annotations had been predicted from top...”
CJE0502 exonuclease, DNA polymerase III, epsilon subunit family from Campylobacter jejuni RM1221
Aligns to 49:205 / 233 (67.4%), covers 97.7% of PF16473, 36.6 bits
- DNA sequence heterogeneity of Campylobacter jejuni CJIE4 prophages and expression of prophage genes
Clark, PloS one 2014 - “...strain RM1221 has a copy of the DNA polymerase III epsilon subunit in its chromosome (CJE0502), though this 233 amino acid protein was quite dissimilar from the ORF8 characterized in this study and present in other C. jejuni isolates. Since many C. jejuni are quite syntenic,...”
- “...this work are underway and should provide an unambiguous answer. BLASTp alignments of ORF8 and CJE0502 performed using the tools in NCBI returned an Expect value of 3e-19 with only 38/94 identities and 60/94 positives, with two gaps. Both ORF8 and CJE0502 had even lower identity...”
CJJ81176_0477 DNA polymerase III subunit epsilon from Campylobacter jejuni subsp. jejuni 81-176
Aligns to 72:228 / 253 (62.1%), covers 97.7% of PF16473, 35.6 bits
RLO149_22990 Exonuclease from Roseobacter litoralis Och 149
Aligns to 2:160 / 287 (55.4%), covers 94.4% of PF16473, 35.2 bits
Cj0452 exonuclease, possibly dna polymerase III epsilon subunit from Campylobacter jejuni subsp. jejuni NCTC 11168
Aligns to 72:228 / 253 (62.1%), covers 97.7% of PF16473, 35.2 bits
- The CJIE1 prophage of Campylobacter jejuni affects protein expression in growth media with and without bile salts
Clark, BMC microbiology 2014 - “...(single value) Succinate dehydrogenase flavoprotein subunit Cj0437 gi|218562095 0.700.44 0.60.87 DNA polymerase III subunit epsilon Cj0452 gi|218562107 0.230.21 0.670.31 Thiamine biosynthesis protein ThiC Cj0453 gi|121613325 2.230.38 1.830.32 ATP-dependent chaperone protein ClpB Cj0509c gi|121613623 0.330.15 0.670.15 2-oxoglutarate-acceptor oxidoreductase subunit OorD Cj0535 gi|157414816 0.870.55 0.630.66 2-oxoglutarate-acceptor oxidoreductase subunit...”
VIBHAR_02991 hypothetical protein from Vibrio harveyi ATCC BAA-1116
Aligns to 19:199 / 214 (84.6%), covers 96.6% of PF16473, 34.9 bits
GAVG_0516 type I-E CRISPR-associated endoribonuclease Cas2e from Gardnerella vaginalis ATCC 14018 = JCM 11026
Aligns to 177:352 / 359 (49.0%), covers 98.3% of PF16473, 34.6 bits
FPSM_02105 3'-5' exonuclease from Flavobacterium psychrophilum
FP1195 Probable DNA polymerase III, epsilon subunit from Flavobacterium psychrophilum JIP02/86
Aligns to 2:158 / 160 (98.1%), covers 95.5% of PF16473, 33.7 bits
- Stress Tolerance-Related Genetic Traits of Fish Pathogen Flavobacterium psychrophilum in a Mature Biofilm
Levipan, Frontiers in microbiology 2018 - “...peroxidase FPSM_02014, FP1100 GO:0004601, GO:0051920, GO:0055114 2.05 FP1195 DNA polymerase III subunit epsilon dnaQ , FPSM_02105 GO:0003676, GO:0003887, GO:0004527, GO:0071897, GO:0090305 3.53 FP1417 Glutathione peroxidase FPSM_01888, bsaA GO:0004602, GO:0006979, GO:0055114 2.63 FP1509 Chaperone protein HtpG htpG , IA01_07270 GO:0005737, GO:0005524, GO:0051082, GO:0006457, GO:0006950 3.32 FP1594 2-Cys...”
- Stress Tolerance-Related Genetic Traits of Fish Pathogen Flavobacterium psychrophilum in a Mature Biofilm
Levipan, Frontiers in microbiology 2018 - “...phrB1 , IA01_04785 GO:0003904, GO:0018298 3.99 FP1100 Thiol peroxidase FPSM_02014, FP1100 GO:0004601, GO:0051920, GO:0055114 2.05 FP1195 DNA polymerase III subunit epsilon dnaQ , FPSM_02105 GO:0003676, GO:0003887, GO:0004527, GO:0071897, GO:0090305 3.53 FP1417 Glutathione peroxidase FPSM_01888, bsaA GO:0004602, GO:0006979, GO:0055114 2.63 FP1509 Chaperone protein HtpG htpG , IA01_07270...”
ABUW_2826 ribonuclease T from Acinetobacter baumannii
ACICU_01102 DNA polymerase III, epsilon subunit from Acinetobacter baumannii ACICU
Aligns to 23:205 / 220 (83.2%), covers 98.3% of PF16473, 33.4 bits
SmuNN2025_0610 DNA polymerase III subunit alpha from Streptococcus mutans NN2025
Aligns to 130:288 / 300 (53.0%), covers 93.2% of PF16473, 33.4 bits
VC1006 ribonuclease T from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 38:218 / 243 (74.5%), covers 98.3% of PF16473, 33.3 bits
- Cholera outbreaks in Nigeria are associated with multidrug resistant atypical El Tor and non-O1/non-O139 Vibrio cholerae
Marin, PLoS neglected tropical diseases 2013 - “...O1 Bauchi 2010 + 7 ET CIRS ET - - + Ser83Ile Ser85Leu 0.500 6.0 VC1006 Non-O1 Bauchi 2010 - - - - - Ser83 Ser85 0.012 0.5 VC1009 Non-O1 Bauchi 2010 - - - - - Ser83 Ser85 0.008 0.5 VC1005 Non-O1 Ile Ife 2010...”
- “...VC835) are genetically related and shared a profile with El Tor VC121. The non-O1 strains (VC1006 and VC998) shared a unique profile distinct from the O1 strains. 10.1371/journal.pntd.0002049.g001 Figure 1 Genetic relatedness of Nigeria V. cholerae strains. The epidemic O1 Nigeria strains are within the El...”
XP_005174272 uncharacterized protein si:ch1073-385f13.3 from Danio rerio
Aligns to 56:230 / 244 (71.7%), covers 84.2% of PF16473, 31.9 bits
- PML and PML-like exonucleases restrict retrotransposons in jawed vertebrates.
Mathavarajah, Nucleic acids research 2023 - GeneRIF: The zebrafish PML-like exon 9 (Plex9) genes encode DEDDh exonucleases that are distinct evolutionarily from TREX1 and derived from a progenitor vertebrate promyelocytic leukemia (PML) gene first identified in spotted gar. Plex9 enzymes suppress human LINE-1 and zebrafish Line-2 retrotransposons, and specifically Plex9.1 can complement TREX1 knockout in mammalian cells to suppress micronuclei formation and LINE-1 activity.
HP1387 DNA polymerase III epsilon subunit (dnaQ) from Helicobacter pylori 26695
Aligns to 108:267 / 350 (45.7%), covers 97.7% of PF16473, 31.9 bits
- Metabolism and genetics of Helicobacter pylori: the genome era
Marais, Microbiology and molecular biology reviews : MMBR 1999 - “...initiation of the lagging-strand Okazaki fragments; HP1460, HP1387, HP0500, HP1231, and HP0717, orthologues of dnaE, dnaQ, dnaN, holB, and dnaX, respectively,...”
Nwi_0105 DNA polymerase III, epsilon subunit from Nitrobacter winogradskyi Nb-255
Aligns to 2:166 / 239 (69.0%), covers 96.0% of PF16473, 31.2 bits
PA1575 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 3:179 / 183 (96.7%), covers 96.0% of PF16473, 31.0 bits
TP0643 DNA polymerase III, subunit epsilon (dnaQ) from Treponema pallidum subsp. pallidum str. Nichols
Aligns to 14:177 / 215 (76.3%), covers 97.2% of PF16473, 30.9 bits
Dgeo_1818 DNA polymerase III, epsilon subunit from Deinococcus geothermalis DSM 11300
Aligns to 2:173 / 180 (95.6%), covers 95.5% of PF16473, 30.8 bits
- Alliance of proteomics and genomics to unravel the specificities of Sahara bacterium Deinococcus deserti
de, PLoS genetics 2009 - “...b (1683) Multidomain protein: DnaQ/DinG/RecQ Deide_06520 (849) UvrD/REP helicase Deide_17790 (202), Deide_05970 (204) DR_0856 (197) Dgeo_1818 (180) DnaQ Deide_12290 (686), Deide_1p00290 (686) DR_2069 (700) Dgeo_0696 (684) DNA ligase, NAD-dependent Deide_1p00132 (244) 5-3 exonuclease Deide_00830 (248) DR_0689 (247), DR_1751 (237), DR_0022 (199) Dgeo_2059 (245), Dgeo_1556 (230) Uracil-DNA...”
- Basal DNA repair machinery is subject to positive selection in ionizing-radiation-resistant bacteria
Sghaier, BMC genomics 2008 - “...polymerase n.a. c -1.779 DR_0507 Dgeo_0255 Krad_3187 Rxyl_1096 DNA polymerase III, subunit* n.a. -1.725 DR_0856 Dgeo_1818 Krad_3247 Rxyl_2984 DNA polymerase III, subunit 2.81 DR_1244 Dgeo_0745 Krad_3423 Rxyl_1518 Putative DNA polymerase III, subunit 1.68 DR_1707 Dgeo_1666 Krad_2951 Rxyl_2025 DNA-directed DNA polymerase* 3.15 DR_1751 Dgeo_1556 Krad_1521 Rxyl_0503 DNA...”
SMU29_09019 type I-E CRISPR-associated endoribonuclease Cas2e from Streptococcus mutans 2ST1
Aligns to 130:289 / 300 (53.3%), covers 93.2% of PF16473, 30.6 bits
TDE1999 DNA polymerase III domain protein from Treponema denticola ATCC 35405
Aligns to 15:176 / 217 (74.7%), covers 96.0% of PF16473, 30.0 bits
FTN_0068 oligoribonuclease (3'->5' exoribonuclease) from Francisella tularensis subsp. novicida U112
Aligns to 6:170 / 178 (92.7%), covers 93.8% of PF16473, 28.7 bits
- Francisella-arthropod vector interaction and its role in patho-adaptation to infect mammals
Akimana, Frontiers in microbiology 2011 - “...amino acid aminotransferase protein (class IV) ilvE * FTN_0066 Ferrous iron transport protein B feoB FTN_0068 Oligoribonuclease orn FTN_0077 Protein of unknown function FTN_0078 Shikimate 5-dehydrogenase aroE1 FTN_0090 Acid phosphatase (precursor) acpA FTN_0096 Conserved hypothetical membrane protein FTN_0097 Hydroxy/aromatic amino acid permease (HAAAP) family protein FTN_0101...”
DR0856, DR_0856 DNA polymerase III, epsilon subunit, putative from Deinococcus radiodurans R1
Aligns to 22:189 / 197 (85.3%), covers 79.7% of PF16473, 27.5 bits
- Novel Sequence Features of DNA Repair Genes/Proteins from Deinococcus Species Implicated in Protection from Oxidatively Generated Damage
Hassan, Genes 2018 - “...- DNA polymerase III, subunit (DnaE) DR0507 14 - - DNA polymerase III subunit (DnaQ) DR0856 1 - - DNA polymerase III subunit beta DR0001 1 - - DNA ligase (LigA) DR2069 4 1 Figure S17K DNA polymerase III subunit gamma/tau DR2410 7 1 Figure S17L...”
- Oxidative stress resistance in Deinococcus radiodurans
Slade, Microbiology and molecular biology reviews : MMBR 2011 - “...Gene Protein D D D D D D DR1707 DR0507 DR0856 DR0001 DR2410 DR2069 DR0099 D D DR2074 DR2584 DR0689 DR1751 DR0715 DR2162 DR2285 DR0493 DR0928 DR2438 DR0289...”
- Alliance of proteomics and genomics to unravel the specificities of Sahara bacterium Deinococcus deserti
de, PLoS genetics 2009 - “...family Deide_06510 b (1683) Multidomain protein: DnaQ/DinG/RecQ Deide_06520 (849) UvrD/REP helicase Deide_17790 (202), Deide_05970 (204) DR_0856 (197) Dgeo_1818 (180) DnaQ Deide_12290 (686), Deide_1p00290 (686) DR_2069 (700) Dgeo_0696 (684) DNA ligase, NAD-dependent Deide_1p00132 (244) 5-3 exonuclease Deide_00830 (248) DR_0689 (247), DR_1751 (237), DR_0022 (199) Dgeo_2059 (245), Dgeo_1556...”
- Basal DNA repair machinery is subject to positive selection in ionizing-radiation-resistant bacteria
Sghaier, BMC genomics 2008 - “...DNA polymerase n.a. c -1.779 DR_0507 Dgeo_0255 Krad_3187 Rxyl_1096 DNA polymerase III, subunit* n.a. -1.725 DR_0856 Dgeo_1818 Krad_3247 Rxyl_2984 DNA polymerase III, subunit 2.81 DR_1244 Dgeo_0745 Krad_3423 Rxyl_1518 Putative DNA polymerase III, subunit 1.68 DR_1707 Dgeo_1666 Krad_2951 Rxyl_2025 DNA-directed DNA polymerase* 3.15 DR_1751 Dgeo_1556 Krad_1521 Rxyl_0503...”
- Survival in nuclear waste, extreme resistance, and potential applications gleaned from the genome sequence of Kineococcus radiotolerans SRS30216
Bagwell, PloS one 2008 - “...DnaN DR_0001 Rv0002 Krad_1769 Krad_0002 DnaQ DNA polymerase III (holoenzyme), subunit - 3-5 exonuclease DnaQ DR_0856 Rv3711c Krad_4419 Krad_3247 Krad_4503 Krad_1768 DnaZ/X DNA polymerase III (holoenzyme), / subunit DnaZ/X DR_2410 Rv3721c Krad_0466 Dut dUTPase Dut No homologs Rv2697c Krad_1557 ERCC3 XPB/ERCC3 helicase No homologs DR_A0131 Rv0861c...”
- Genome of the extremely radiation-resistant bacterium Deinococcus radiodurans viewed from the perspective of comparative genomics
Makarova, Microbiology and molecular biology reviews : MMBR 2001 - “...ruvB ruvC DR0596 DR0440 dnaE DR0507 dnaQ DR0856 dnlJ ssb DR2069 DR0099 Adenine-specific DNA methylase O-6-methylguanine DNA methyltransferase 8-oxo-dGTPase; D....”
Or search for genetic data about PF16473 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory