Family Search for PF17412 (VraX)
PF17412 hits 3 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
TC 3.A.1.134.7 / Q7A2W7 Protein VraX, component of The VraFG ABC transporter interacts with GraXSR [GraX, Q7A2W7; GraS, A6QEW9; GraR, A6QEW8] to form a five- or six-component system required for cationic antimicrobial peptide sensing and resistance from Staphylococcus aureus (strain Mu50 / ATCC 700699)
NWMN_0542 hypothetical protein from Staphylococcus aureus subsp. aureus str. Newman
SAS016 hypothetical protein from Staphylococcus aureus subsp. aureus N315
SAOUHSC_00561 hypothetical protein from Staphylococcus aureus subsp. aureus NCTC 8325
USA300HOU_0572 hypothetical protein from Staphylococcus aureus subsp. aureus USA300_TCH1516
SACOL0625 hypothetical protein from Staphylococcus aureus subsp. aureus COL
SAUSA300_RS03005, USA300HOU_RS03030, WP_000587958 C1q-binding complement inhibitor VraX from Staphylococcus aureus
Aligns to 1:55 / 55 (100.0%), covers 100.0% of PF17412, 135.5 bits
- substrates: Cationic antimicrobial peptides
tcdb comment: VraX has been termed a two component system connector and may not be a component of the transporter. VraFG may be a sensor rather than the transporter for the substrate peptide. The actual transporter regulated by VraFGX may have TC# 4.H.1.1.1 (MprF) (Falord et al. 2012) - Alkaline shock protein 23 (Asp23)-controlled cell wall imbalance promotes membrane vesicle biogenesis in Staphylococcus aureus
Li, Journal of extracellular vesicles 2024 - “...(d) Transcriptional levels of selected genes were measured in NM and NM asp23 using RTqPCR. NWMN_0542 ( vraX ) that known to be positively regulated by asp23 deletion and nuc that not regulated by asp23 deletion were used as controls. Data are shown as meanSD for...”
- “...lytS , lytR , psm1 , psm2 , psm3 and psm4 ) using RTqPCR. Simultaneously, NWMN_0542 ( vraX ) (analogous to SAOUHSC_00561 in S. aureus strain NCTC 8325) that known to be significantly upregulated in an asp23 mutant (Mller etal., 2014 ), and nuc that identified...”
- Inactivation of the Ecs ABC transporter of Staphylococcus aureus attenuates virulence by altering composition and function of bacterial wall
Jonsson, PloS one 2010 - “...LukE 0.1 NWMN_0074 glycosyl transferase group 1 0.2 NWMN_0353 ParB family chromosome partioning protein 4.1 NWMN_0542 VraX (SAS016) 0.2 NWMN_0863 oligopeptide ABC transporter ATP-binding protein 0.2 NWMN_0903 ABC transporter ATP-binding protein 2.3 0.1 NWMN_0995 bacteriophage L54a antirepressor 0.2 NWMN_1223 hypothetical protein 0.1 NWMN_1252 hypothetical protein 0.2...”
- C-di-AMP levels modulate Staphylococcus aureus cell wall thickness, response to oxidative stress, and antibiotic resistance and tolerance
Dengler, Microbiology spectrum 2023 - “...expression was assessed in the absence of antibiotic-induced stress by quantifying the activity of the sas016 gene promoter, widely used as a proxy for CWSS activation ( 17 , 29 , 30 ). Confirming our hypothesis, the CWSS activity was significantly increased in the gdpP mutant...”
- “...of growth in TSB containing tetracycline was measured via the VraR-responsive promotor of the gene sas016 fused to a luciferase gene ( 17 ) and normalized to the protein content. The area under the curve (AUC) was calculated and is shown in the inlet. ( B...”
- C-di-AMP levels modulateStaphylococcus aureuscell wall thickness as well as virulence and contribute to antibiotic resistance and tolerance
Haunreiter, 2023 - Mutation in the C-di-AMP cyclase dacA affects fitness and resistance of methicillin resistant Staphylococcus aureus
Dengler, PloS one 2013 - “...1020-bp downstream regions carrying a mutation leading to Gly206Ser substitution in DacA This study p sas016 p -luc + pBUS1 containing the sas016 promoter-luciferase reporter gene fusion [67] Abbreviations: Am, ampicillin; Cm, chloramphenicol; Mc, methicillin; Tc, tetracycline; r, resistant; s, susceptible; ST, sequence type. Whole genome...”
- “...D, left, relative light units (RLU) measured from cell wall stress stimulon reporter construct p sas016 p -luc+ in RA120 (black squares) and the dacA -SNP strains ME51 (white diamonds) and RA120:: dacA -SNP (white squares) and right, the corresponding OD values of the cultures at...”
- VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus
Boyle-Vavra, Antimicrobial agents and chemotherapy 2013 - “...in the vraS and vraT mutants, including SAS016 (identical to vraX [8]), SAUSA300_1606, SAUSA300_2269, SAUSA300_1877, and SAUSA300_0622 (Table 2). When comparing...”
- “...Transport and protein processing USA300HOU_0572 SAUSA300_0622 SAUSA300_0866 SAS016 SA0591 SA0824 Kuroda et al. (9) This studyb This study 2.1 3.7 3.4...”
- Epigallocatechin gallate induces upregulation of the two-component VraSR system by evoking a cell wall stress response in Staphylococcus aureus
Levinger, Applied and environmental microbiology 2012 - “...transcription-PCR (qRTPCR). EGCG also induced the promoter of sas016 (encoding a cell wall stress protein of unknown function which is not induced in vraSR...”
- “...null mutant BB255 harboring pBUS1 containing the sas016 promoter-luciferase reporter gene fusion TABLE 2 Primer sequences for quantitative RT-PCR Reference...”
- The posttranslocational chaperone lipoprotein PrsA is involved in both glycopeptide and oxacillin resistance in Staphylococcus aureus
Jousselin, Antimicrobial agents and chemotherapy 2012 - “...by Dengler and colleagues (15). Induction by glycopeptides of sas016, part of the cell wall stimulon, was found to be higher at 5 times the MIC. DISCUSSION...”
- Induction kinetics of the Staphylococcus aureus cell wall stress stimulon in response to different cell wall active antibiotics
Dengler, BMC microbiology 2011 - “...Results We have constructed a highly sensitive luciferase reporter gene system, using the promoter of sas016 ( S. aureus N315), which detects very subtle differences in expression as well as measuring > 4 log-fold changes in CWSS activity, to compare the concentration dependence of CWSS induction...”
- “...codons inserted between the 2 nd and 3 rd vraR codons. [ 26 ] p sas016 p - luc + pBUS1 containing the sas016 promoter-luciferase reporter gene fusion [ 26 ] p tcaA p - luc + pBUS1 containing the tcaA promoter-luciferase reporter gene fusion This...”
- Mutational analyses of open reading frames within the vraSR operon and their roles in the cell wall stress response of Staphylococcus aureus
McCallum, Antimicrobial agents and chemotherapy 2011 - “...plasmid, ori ColE1, bla, luc; Apr pBUS1 containing sas016 promoter-luciferase reporter gene fusion; Tcr BTH vector encoding the T25 fragment of CyaA upstream of...”
- “...reporter gene fusion assay. The promoter region of sas016, which corresponds to ORF SACOL0625 from S. aureus COL (accession number NC_002951), was amplified...”
- More
- Alkaline shock protein 23 (Asp23)-controlled cell wall imbalance promotes membrane vesicle biogenesis in Staphylococcus aureus
Li, Journal of extracellular vesicles 2024 - “...psm2 , psm3 and psm4 ) using RTqPCR. Simultaneously, NWMN_0542 ( vraX ) (analogous to SAOUHSC_00561 in S. aureus strain NCTC 8325) that known to be significantly upregulated in an asp23 mutant (Mller etal., 2014 ), and nuc that identified with no significant change upon asp23...”
- “...promotes expression of the corresponding genes, such as the envelope stress marker NWMN_0542 (analogous to SAOUHSC_00561 in S. aureus strain NCTC 8325), prsA (encoding the peptidylprolyl isomerase) and vraR (encoding the response regulator) (Mller etal., 2014 ). These genes were also identified by RNAseq analysis and/or...”
- Transcriptomic analyses reveal the potential antibacterial mechanism of citral against Staphylococcus aureus
Liao, Frontiers in microbiology 2023 - “...log2 fold change p - adj Gene_name Gene_description Up-regulated SAOUHSC_02893 9.707596956 6.929E-263 DUF896 domain-containing protein SAOUHSC_00561 9.040725294 0 vraX C1q-binding complement inhibitor SAOUHSC_02892 8.903467143 0 hypothetical protein SAOUHSC_02866 7.489908404 0 fatty acid efflux MMPL transporter SAOUHSC_02872 7.334065647 4.3044E-201 cwrA cell wall inhibition responsive protein SAOUHSC_01683 6.724355817...”
- 6S RNA-Dependent Susceptibility to RNA Polymerase Inhibitors
Esberard, Antimicrobial agents and chemotherapy 2022 (secret) - Staphylococcal saoABC Operon Codes for a DNA-Binding Protein SaoC Implicated in the Response to Nutrient Deficit
Bukowski, International journal of molecular sciences 2022 - “...acid transport and metabolism (COG2021) srn_3780_Teg13 2.30 6.93 10 4 Non-coding RNA srn_3780_Teg13 Non-coding RNA SAOUHSC_00561 vraX 2.32 8.37 10 4 Protein VraX Virulence factors [ 34 ] SAOUHSC_00435 gltB 2.40 1.73 10 7 Glutamate synthase, large subunit Amino acid transport and metabolism (COG0069) SAOUHSC_01334 2.60...”
- Host-inherent variability influences the transcriptional response of Staphylococcus aureus during in vivo infection
Thänert, Nature communications 2017 - “...subunit A SAOUHSC_02763 opp-1F Peptide ABC transporter ATP-binding protein SAOUHSC_00988 sspA Glutamyl endopeptidase SAOUHSC_00711 Hypothetical SAOUHSC_00561 vraX Hypothetical SAOUHSC_02550 FdhD Formate dehydrogenase accessory protein SAOUHSC_00875 ndh2 Hypothetical SAOUHSC_01359 mprF Hypothetical SAOUHSC_01192 vfrA Hypothetical SAOUHSC_02887 isaA Immunodominant antigen A SAOUHSC_02254 groEL chaperonin GroEL SAOUHSC_02485 rpoA DNA-directed RNA...”
- “...Zinc metalloproteinase aureolysin 2.31 (0.96) 2.59 (0.75) SAOUHSC_00988 sspA Glutamyl endopeptidase 2.19 (0.01) 2.32 (0.46) SAOUHSC_00561 vraX Protein VraX 3.91 (2.76) 1.11 (0.04) SAOUHSC_00436 gltD Glutamate synthase subunit beta 2.41 (1.11) 6.03 (1.66) SAOUHSC_01803 aapA D-serine/D-alanine/glycine transporter 1.21 (2.32) 1.69 (0.29) RNAIII Regulatory RNA 1.80 (0.53)...”
- Genome-wide screen for genes involved in eDNA release during biofilm formation by Staphylococcus aureus
DeFrancesco, Proceedings of the National Academy of Sciences of the United States of America 2017 - “...SAOUHSC_02260 SAOUHSC_03045 SAOUHSC_01136 hld/ RNAIII cspB psm SAOUHSC_00561 SAOUHSC_00560 SAOUHSC_00141 vraX -- -- IgG binding protein A Alanine dehydrogenase...”
- The mevalonate pathway of Staphylococcus aureus
Balibar, Journal of bacteriology 2009 - “...increase in the expression of a hypothetical protein (SAOUHSC_00561). Similarly when comparing induced RN4220 spacmvaK and WT, the only significant changes were...”
- Global transcriptome responses including small RNAs during mixed-species interactions with methicillin-resistant Staphylococcus aureus and Pseudomonas aeruginosa
Miller, MicrobiologyOpen 2017 - “...Hypothetical protein 2.45 USA300HOU_0129 IucA/IucC family siderophore biosynthesis protein 2.41 USA300HOU_0127 Pyridoxal phosphatedependent enzyme 2.39 USA300HOU_0572 Hypothetical protein 2.32 USA300HOU_1065 Iron (Fe2+)regulated surface determinant protein IsdC 2.20 USA300HOU_0955 Transcriptional regulator Spx 2.13 USA300HOU_1138 Aspartate carbamoyltransferase catalytic subunit 2.55 USA300HOU_1137 Uracil permease 2.65 USA300HOU_1012 Phosphoribosylformylglycinamidine synthase 2.66...”
- VraT/YvqF is required for methicillin resistance and activation of the VraSR regulon in Staphylococcus aureus
Boyle-Vavra, Antimicrobial agents and chemotherapy 2013 - “...wall related Hypothetical Transport and protein processing USA300HOU_0572 SAUSA300_0622 SAUSA300_0866 SAS016 SA0591 SA0824 Kuroda et al. (9) This studyb This...”
- “...from the sequence of USA300 strain FPR3757. USA300HOU_0572 is from the genome sequence of USA300_TCH1516 (CA methicillin-susceptible S. aureus). Functions were...”
- Inhibition of Staphylococcus aureus biofilm formation by gurmarin, a plant-derived cyclic peptide
Chang, Frontiers in cellular and infection microbiology 2022 - “...9.21 Hypothetical protein yagU 0.04 SACOL2087 8.38 Hypothetical protein 0.01 MW0902 7.27 Hypothetical protein 0.01 SACOL0625 6.99 Conserved hypothetical protein 0.05 SAV1337 6.85 Guanosine 5'-monophosphage oxidoreductase 0.03 SACOL1535 6.77 DNA-binding response regulator srrA 0.03 SACOL2327 6.3 Formimingoglutamase hutG 0.01 MW0496 6.28 Hypothetical protein 0.01 SACOL1895 5.75...”
- Genomic, Transcriptomic and Metabolomic Studies of Two Well-Characterized, Laboratory-Derived Vancomycin-Intermediate Staphylococcus aureus Strains Derived from the Same Parent Strain
Hattangady, Antibiotics (Basel, Switzerland) 2015 - “...3.2 SACOL0908 NA hypothetical protein 3.8 8.8 5 SAS0281 NA hypothetical protein 10 3.6 6.4 SACOL0625 NA hypothetical protein 11.2 2.5 8.7 SACOL0067 NA hypothetical protein 12.6 5 7.6 SAV2556 NA hypothetical protein 12.8 3.6 9.2 Five genes in the 8-fold change subset that encode regulatory...”
- Importance of bacillithiol in the oxidative stress response of Staphylococcus aureus
Posada, Infection and immunity 2014 - “...SACOL0568 SACOL0604 SACOL0606 SACOL0613 SACOL0615 SACOL0625 SACOL0632 SACOL0671 SACOL0820 SACOL0939 SACOL1175 SACOL1226 SACOL1294 SACOL1331 SACOL1358 SACOL1359...”
- Tea tree oil-induced transcriptional alterations in Staphylococcus aureus
Cuaron, Phytotherapy research : PTR 2013 - “...regulator VraR SACOL1942 5-AAAGAAGCAATTGCCAAAGC-3 5-TGAGTCGTCGCTTCTACACC-3 vraS histidine kinase sensor SACOL1943 5-AGTGCCGATGAAAGTTGTGC-3 5-TTTTGTACCGTTTGAATGACG-3 vraX VraX protein SACOL0625 5-TCGACAGTATCACCATGAAGG-3 5-TTTCAGTATCACTAAATGAATCGTCAC-3 Table 3 Representative S. aureus genes altered by TTO challenge Gene Function Locus ID Fold change in gene expression Microarray qRT- PCR (TTO) qRT- PCR (Terpinen-4-ol) Up-regulated genes...”
- Further insights into the mode of action of the lipoglycopeptide telavancin through global gene expression studies
Song, Antimicrobial agents and chemotherapy 2012 - “...Selected other genes SACOL1942 SAR1975 SAV2702 SAV2701 SACOL0625 SAV2356 SAV2688 a ligase Tlv, telavancin; End, enduracidin. stimulon is characterized by...”
- “...tcaA (7.8-fold). The most highly upregulated gene was SACOL0625 (30.6-fold), which was recently designated cwrA (2). This gene is highly upregulated by a wide...”
- An antibiotic that inhibits a late step in wall teichoic acid biosynthesis induces the cell wall stress stimulon in Staphylococcus aureus
Campbell, Antimicrobial agents and chemotherapy 2012 - “...Hypothetical proteins Hypothetical proteins Conserved Hypothetical proteins SACOL0625 SAS1587 SACOL1945 SACOL1705 SAS0657 SAR0453 NA NA ndhF NA NA NA 2.3 2.2...”
- Induction kinetics of the Staphylococcus aureus cell wall stress stimulon in response to different cell wall active antibiotics
Dengler, BMC microbiology 2011 - “...acid, as previously described [ 26 ]. Luciferase reporter gene fusions Promoter regions of sas016 (SACOL0625) , tcaA and sa0908 (SACOL1065) were PCR amplified from S. aureus strain COL using primer pairs: sas016 .lucF (AATTA GGTACC TGGATCACGGTGCATACAAC) and sas016 .lucR (AATTA CCATGG CCTATATTACCTCCTTTGC); tcaA .lucF (TAAT...”
- Mutational analyses of open reading frames within the vraSR operon and their roles in the cell wall stress response of Staphylococcus aureus
McCallum, Antimicrobial agents and chemotherapy 2011 - “...promoter region of sas016, which corresponds to ORF SACOL0625 from S. aureus COL (accession number NC_002951), was amplified using primers SAS016.lucF and...”
- Impact of Bicarbonate-β-Lactam Exposures on Methicillin-Resistant Staphylococcus aureus (MRSA) Gene Expression in Bicarbonate-β-Lactam-Responsive vs. Non-Responsive Strains
Ersoy, Genes 2021 - “...1.44 1.46 sasD SAUSA300_0136 0.00 0.90 2.11 1.82 aaa SAUSA300_0438 0.00 1.14 2.20 0.00 vraX SAUSA300_RS03005 0.00 0.00 4.45 1.88 kdpABCDF SAUSA300_2032 0.00 0.90 2.07 1.79 osmotic stress betAB SAUSA300_2545 4.44 1.38 5.12 4.28 icaR SAUSA300_2599 0.00 1.87 1.62 0.00 transcriptional regulator rsp SAUSA300_2326 1.60 1.02...”
- Staphylococcus aureus VraX specifically inhibits the classical pathway of complement by binding to C1q.
Yan, Molecular immunology 2017 (PubMed)- GeneRIF: The results showed that VraX specifically inhibited the classical pathway of the complement system. In particular, VraX could bind to the C1q protein and block the formation of the C1 complex. Deletion of VraX decreased the pathogenesis of S. aureus.
- Absence of Protoheme IX Farnesyltransferase CtaB Causes Virulence Attenuation but Enhances Pigment Production and Persister Survival in MRSA
Xu, Frontiers in microbiology 2016 - “...USA300HOU_RS05800 1.47 4.78E-02 Fibrinogen-binding protein USA300HOU_RS03270 1.49 3.19E-02 Hydrolase USA300HOU_RS12795 1.51 2.88E-02 Hypothetical membrane protein USA300HOU_RS03030 1.51 2.58E-02 Hypothetical protein USA300HOU_RS01345 scdA 1.52 2.94E-02 Cell division and morphogenesis protein ScdA USA300HOU_RS11555 1.54 3.52E-02 Hypothetical protein USA300HOU_RS12775 htrA 1.55 4.66E-02 Hemin ABC superfamily ATP binding cassette transporter,...”
SAR0584 hypothetical protein from Staphylococcus aureus subsp. aureus MRSA252
Aligns to 1:55 / 55 (100.0%), covers 100.0% of PF17412, 132.9 bits
- Staphylococcal phenotypes induced by naturally occurring and synthetic membrane-interactive polyphenolic β-lactam resistance modifiers
Palacios, PloS one 2014 - “...ACC GGC AAT ATA ACC TGC AC ACA TGG AAT TGG CGA CCT AC vraX SAR0584 ATC AAC ATG AAG GCG CAC CA CGT CTT GTA ATA AAG AGA GC Determination of cell surface charge Staphylococcal surface charge was determined by cytochrome c binding, essentially according...”
- “...0.03* qoxB/cydB SAR1033 quinol oxidase subunit 1 0.43* 0.43* 0.35* 0.34* 0.15* 0.18* 0.04* vraX SAR0584 protein VraX 17.46* 1.09 14.39* 34.77* 40.29* 62.35* 7.31* a Quantitative reverse transcription-polymerase chain reaction. b MRSA252 ORF identifiers for the BG@S SAv1.1.0 microarray used in this study (39). c...”
- Global network analysis of drug tolerance, mode of action and virulence in methicillin-resistant S. aureus
Overton, BMC systems biology 2011 - “...ranalexin at the cell wall. The largest ranalexin dependent induction of transcription was observed for SAR0584 ( vraX , 23.89-fold), which is not well characterised. However, vraX was over-expressed in isolates of vancomycin-intermediate S. aureus (VISA) and showed >200-fold increased expression in vancomycin-sensitive S. aureus (VSSA)...”
- Insertion of epicatechin gallate into the cytoplasmic membrane of methicillin-resistant Staphylococcus aureus disrupts penicillin-binding protein (PBP) 2a-mediated beta-lactam resistance by delocalizing PBP2
Bernal, The Journal of biological chemistry 2010 - “...SA0535 vraC Hypothetical protein 5.3 Function unknown SAR0583 SA0536 vraY Hypothetical protein 2.9 Function unknown SAR0584 vraX Hypothetical protein 24.2 22.7 224.7 26.6 Function unknown SAR0645 SA0591 Hypothetical protein 3.7 5.3 Up Up Function unknown SAR2509 SA2207 hlgA -Hemolysin, component A 10.18 Toxin production and resistance...”
- The Staphylococcus aureus response to unsaturated long chain free fatty acids: survival mechanisms and virulence implications
Kenny, PloS one 2009 - “...3.32E-03 Hypothetical Genes SAR0100 putative membrane protein 2.56 2.28E-02 SAR0211 conserved hypothetical protein 11.11 3.02E-03 SAR0584 vraX predicted role in ipenimen resistance 2.27 3.15E-02 SAR0750 conserved hypothetical protein 2.22 1.32E-02 SAR0939 LysR family regulatory protein 2.94 5.81E-05 SAR2595 putative membrane protein 2.04 7.18E-03 10.1371/journal.pone.0004344.t005 Table 5...”
SERP0224 hypothetical protein from Staphylococcus epidermidis RP62A
Aligns to 1:55 / 59 (93.2%), covers 100.0% of PF17412, 131.9 bits
Or search for genetic data about PF17412 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory