Family Search for TIGR00001

TIGR00001 hits 80 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

NGO0297 putative 50s ribosomal protein L35 from Neisseria gonorrhoeae FA 1090
NMB0722 50S ribosomal protein L35 from Neisseria meningitidis MC58
NGFG_00442 50S ribosomal protein L35 from Neisseria gonorrhoeae MS11
Aligns to 2:64 / 65 (96.9%), covers 100.0% of TIGR00001, 99.1 bits

• Identification of the iron-responsive genes of Neisseria gonorrhoeae by microarray analysis in defined medium
  Ducey, Journal of bacteriology 2005
  • “...NGO0043c NGO0057 NGO0191 NGO0199c NGO0260 NGO0295 NGO0296 NGO0297 NGO0584 NGO0905 NGO1246c NGO1413 NGO1748c NGO1776 NGO1818c Conserved hypothetical protein 50S...”
• Identification of the iron-responsive genes of Neisseria gonorrhoeae by microarray analysis in defined medium
  Ducey, Journal of bacteriology 2005
  • “...NMB1862 NMB1845 NMB0609 NMB0617 NMB0687 NMB0720 NMB0721 NMB0722 NMB1320 NMB1437 NMB1587 NMB0569 NMB0244 NMB0207 NMB0168 NGO1822c NGO1824.1c NGO1826.1c NGO1828c...”
• Transcriptional landscape and essential genes of Neisseria gonorrhoeae
  Remmele, Nucleic acids research 2014
  • “...sequence 117 bp upstream of a transcript encoding the 50S ribosomal proteins L35 and L20 (NGFG_00442 and NGFG_00443) was exchanged by a Kanamycin-P trc cassette. The P trc promoter is IPTG-inducible as lacI q can bind there as a repressor. In the recombinant strains the expression...”
  • “...show growth defects when IPTG is omitted. These data indicate that the ribosomal protein-encoding genes NGFG_00442 and NGFG_00443 ( P = 0.00061 and 0.00245, respectively) are essential for GC growth (Supplementary Figure S6B). In addition to conditional knockout assays and DNA footprinting analysis, several putative essential...”

8buu3 / P55874 8buu3 (see paper)
Aligns to 1:63 / 65 (96.9%), covers 98.4% of TIGR00001, 94.4 bits

• Ligand: rna (8buu3)

RL35_BACSU / P55874 Large ribosomal subunit protein bL35; 50S ribosomal protein L35 from Bacillus subtilis (strain 168) (see paper)
BSU28860 50S ribosomal protein L35 from Bacillus subtilis subsp. subtilis str. 168
Aligns to 2:64 / 66 (95.5%), covers 98.4% of TIGR00001, 94.3 bits

• subunit: Part of the 50S ribosomal subunit.
• Arginine phosphorylation marks proteins for degradation by a Clp protease
  Trentini, Nature 2016
  • “...O31461 ilvE Branched-chain aa transaminase 1 T249 P42956 mtlA PTS system mannitol-specific EIICB S365 S365 P55874 rpmI 50S ribosomal prot. L35 S47 S47 P21476 rpsS 30S ribosomal prot. S19 T77 O34607 sdaAA Probable L-serine dehydratase, chain T99 P54334 xkdO Phage-like element PBSX prot. XkdO S295 O34833...”
• Proteomics analyses of Bacillus subtilis after treatment with plumbagin, a plant-derived naphthoquinone
  Reddy, Omics : a journal of integrative biology 2015
  • “...OS O34967 50S ribosomal protein L31 type B OS P55874 50S ribosomal protein L35 OS a Gene name Q-TOF Unique Plumbagin/ Unique Plumbagin/ Coverage peptides...”
• The Blueprint of a Minimal Cell: MiniBacillus
  Reuß, Microbiology and molecular biology reviews : MMBR 2016
  • “...BSU01340 BSU37070 BSU15080 BSU24900 BSU00990 BSU41060 BSU28860 BSU01400 BSU16490 BSU01220 BSU29660 BSU01330 BSU40910 BSU01110 BSU01300 BSU01500 BSU01150...”

sync_0059 ribosomal protein L35 from Synechococcus sp. CC9311
Aligns to 2:64 / 65 (96.9%), covers 100.0% of TIGR00001, 94.2 bits

• Selection in coastal Synechococcus (cyanobacteria) populations evaluated from environmental metagenomes
  Tai, PloS one 2011
  • “...2.046 3.161 100/14.9 A N Y sync_2711 lipoprotein, putative 0.275 2.556 75/5.4 A N N sync_0059 ribosomal protein L35 Inf Inf 72/8.1 C N N sync_0536 PsbM Inf Inf 43/4.4 C N Y sync_0637 conserved hypothetical Inf Inf 0.5/0.5 A N Y sync_0780 hypothetical Inf Inf...”
  • “...and 2 ). For example, only non-synonymous polymorphisms were observed for the ribosomal protein L35 (sync_0059) ( Table 1 ): histidine (hydrophilic, positively charged) to glutamine (hydrophilic, neutral) and proline (hydrophobic neutral) to alanine (hydrophobic neutral). A putative lipoprotein (sync_2711) has a dN/dS<1, but relative to...”
• Coastal strains of marine Synechococcus species exhibit increased tolerance to copper shock and a distinctive transcriptional response relative to those of open-ocean strains
  Stuart, Applied and environmental microbiology 2009
  • “...sync_0133 sync_2496 sync_2586 sync_1422 sync_1542 sync_0059 sync_2224 sync_2274 sync_2872 sync_2789 sync_0271 sync_0950 sync_1807 sync_2027 sync_2900 0.54...”

SYNW0058 50S ribosomal protein L35 from Synechococcus sp. WH 8102
Aligns to 2:64 / 65 (96.9%), covers 100.0% of TIGR00001, 93.9 bits

• Coastal strains of marine Synechococcus species exhibit increased tolerance to copper shock and a distinctive transcriptional response relative to those of open-ocean strains
  Stuart, Applied and environmental microbiology 2009
  • “...1.11 SYNW1960 SYNW0144 SYNW0334 SYNW2232 SYNW1303 SYNW2224 SYNW0058 SYNW0546 SYNW0521 SYNW2442 SYNW2375 SYNW0233 SYNW2103 SYNW1730 SYNW1778 SYNW2489 0.46 0.59...”

ssl1426 50S ribosomal protein L35 from Synechocystis sp. PCC 6803
Aligns to 2:66 / 67 (97.0%), covers 100.0% of TIGR00001, 93.3 bits

• Proteomic analysis of the regulatory networks of ClpX in a model cyanobacterium Synechocystis sp. PCC 6803
  Zhang, Frontiers in plant science 2022
  • “...large subunit), including rplB (sll1802), rplX (sll1807), rpsK (sll1817), rplT (sll0767), rpsL (sll1096), and rpmI (ssl1426). Furthermore, many proteases, such as hhoA (sll1679), ymxG (slr1331), htrA (slr1204), methionine aminopeptidase (sll0555), and putative carboxypeptidase (sll0777), were significantly upregulated. As mentioned above, ClpX functions as a chaperone for...”
  • “...from 50S ribosomal protein L2 (sll1802), 50S ribosomal protein L24 (sll1807), 50S ribosomal protein L35 (ssl1426), and 30S ribosomal protein S11 (sll1817) are shown in Figure5C . Figure5 Validation of DEPs using Parallel Reaction Monitoring (PRM) analysis. (A) Pairwise correlation of peak area of transitions for...”
• A transcriptional regulator Sll0794 regulates tolerance to biofuel ethanol in photosynthetic Synechocystis sp. PCC 6803
  Song, Molecular & cellular proteomics : MCP 2014
  • “...Slr1597 Slr1727 Slr1838 Slr1856 Slr1974 Slr2041 Slr2059 Ssl1426 Ssl1784 Ssl3044 Ssl3432 Ssl3441 Ssl3445 Ssr0482 Ssr1604 Ssr2799 Mutant_r1 vs. Control_r1...”
• Proteomic analysis reveals resistance mechanism against biofuel hexane in Synechocystis sp. PCC 6803
  Liu, Biotechnology for biofuels 2012
  • “...Sll1813 1.60 50S ribosomal protein L15 Ssl3436 2.58 2.06 1.72 1.71 50S ribosomal protein L29 Ssl1426 2.07 50S ribosomal protein L35 Ssl2084 3.11 3.46 3.55 5.13 1.95 Acyl carrier protein Sll1017 1.93 Ammonium/methylammonium permease Slr0242 1.58 1.66 Bacterioferritin co migratory protein Slr0043 2.56 Bicarbonate transport system...”
• RNA-seq based identification and mutant validation of gene targets related to ethanol resistance in cyanobacterial Synechocystis sp. PCC 6803
  Wang, Biotechnology for biofuels 2012
  • “...4.12E+05 6.41E+05 9.77E+05 1.72E+05 3.12E+05 5.68E+05 2.51E+05 6.14E+05 5.94E+05 50S ribosomal protein L24 Protein synthesis ssl1426 5.89E+06 2.35E+06 5.49E+06 4.31E+06 4.18E+06 2.74E+06 2.30E+06 2.22E+06 2.17E+06 50S ribosomal protein L35 Protein synthesis slr2067 1.00E+06 2.39E+06 4.47E+06 3.52E+05 1.16E+06 2.61E+06 8.80E+05 3.28E+06 3.45E+06 Allophycocyanin alpha subunit Energy metabolism...”
• Gene expression patterns of sulfur starvation in Synechocystis sp. PCC 6803
  Zhang, BMC genomics 2008
  • “...( rpl5 ), sll1809 ( rps8 ), sll1810 ( rpl6 ), sll1813 ( rpl15 ), ssl1426 ( rpl35 )) 13 RNA polymerase subunits (sll1787( rpoB ), sll1789( rpoC2 ), sll1818( rpoA )), Translation (sll1820( truA ), sll1099( tufA ), Ribosomal proteins (sll0767( rpl20 ), sll1745( rpl10...”

azo1081 50S ribosomal protein L35 from Azoarcus sp. BH72
Aligns to 2:64 / 65 (96.9%), covers 100.0% of TIGR00001, 92.8 bits

• Environmental factors affecting the expression of pilAB as well as the proteome and transcriptome of the grass endophyte Azoarcus sp. strain BH72
  Hauberg-Lotte, PloS one 2012
  • “...quadruplicates; five positive controls were spotted in additional replicates ( azo1072 (30S ribosomal protein S1), azo1081 (50S ribosomal protein L35), azo2104 (30S ribosomal protein S15), azo2837 (probable glyceraldehyde 3-phosphate dehydrogenase) and azo2898 (30S ribosomal protein S16). Negative buffer controls, as well as negative controls consisting of...”

VP1281 large subunit ribosomal protein L35 from Vibrio parahaemolyticus RIMD 2210633
Aligns to 2:63 / 64 (96.9%), covers 100.0% of TIGR00001, 92.5 bits

• Prevalence of pandemic thermostable direct hemolysin-producing Vibrio parahaemolyticus O3:K6 in seafood and the coastal environment in Japan
  Hara-Kudo, Applied and environmental microbiology 2003
  • “...2 and primer 4 are shown as indicated. Lanes: 1, VP1281; 2, VP1282; 3, VPFO1-5; 4, APCCVP9810; 5, 1001A46; 6, VPFOO-10; 7, VP-81; M1, X174 DNA digested with...”
  • “...Japanese environmental VP1152 samples VP1153 VP1219 VP1280 VP1281 VP1282 1001A44 1001A46 VPF01-13 VP80 VPF01-5 19-13 VPF00-18 VPF00-10 Origina Sample VOL. 69,...”

SG1420 50S ribosomal protein L35 from Sodalis glossinidius str. 'morsitans'
Aligns to 2:64 / 65 (96.9%), covers 100.0% of TIGR00001, 92.3 bits

• Quorum sensing primes the oxidative stress response in the insect endosymbiont, Sodalis glossinidius
  Pontes, PloS one 2008
  • “...genes encoding subunits of the 30S (SG0380, SG0412 and SG2269) and 50S ribosomal proteins (SG0133, SG1420, SG1421, SG1572, SG2207, SG2252, SG2270, SG2271 and SG2273). In addition, genes encoding a 16S rRNA pseudouridylate synthase A (SG1570), a tRNA/rRNA methyltransferase (SG1908) and a putative ribosome modulation factor (SG1025)...”

8a3l2 / P0A7Q1 8a3l2 (see paper)
Aligns to 1:63 / 64 (98.4%), covers 100.0% of TIGR00001, 91.0 bits

• Ligand: rna (8a3l2)

RpmI / b1717 50S ribosomal subunit protein L35 from Escherichia coli K-12 substr. MG1655 (see 4 papers)
rpmI / P0A7Q1 50S ribosomal subunit protein L35 from Escherichia coli (strain K12) (see 14 papers)
RL35_ECOLI / P0A7Q1 Large ribosomal subunit protein bL35; 50S ribosomal protein L35; Ribosomal protein A from Escherichia coli (strain K12) (see 9 papers)
rpmI 50S ribosomal protein L35 from Escherichia coli K12 (see paper)
B5XQC8 Large ribosomal subunit protein bL35 from Klebsiella pneumoniae (strain 342)
B1XG24 Large ribosomal subunit protein bL35 from Escherichia coli (strain K12 / DH10B)
NP_416232 50S ribosomal subunit protein L35 from Escherichia coli str. K-12 substr. MG1655
STM1335 50S ribosomal subunit protein L35 from Salmonella typhimurium LT2
b1717 50S ribosomal subunit protein A from Escherichia coli str. K-12 substr. MG1655
NP_707397 50S ribosomal protein L35 from Shigella flexneri 2a str. 301
SEN1709 50S ribosomal subunit protein L35 from Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Aligns to 2:64 / 65 (96.9%), covers 100.0% of TIGR00001, 90.9 bits

• subunit: Part of the 50S ribosomal subunit.
• Combinatorial Antimicrobial Efficacy and Mechanism of Linalool Against Clinically Relevant Klebsiella pneumoniae
  Yang, Frontiers in microbiology 2021
  • “...2.61 A6TEW9 50S ribosomal protein L2 2.42 A6TEU2 Ribosomal RNA small subunit methyltransferase B 2.23 B5XQC8 50S ribosomal protein L35 2.09 A6T766 Ribosomal RNA large subunit methyltransferase I 2.00 A6THB4 50S ribosomal protein L9 1.97 A6THB1 30S ribosomal protein S6 1.65 Linalool Induces Oxidative Stress Which...”
• Antimicrobial activity and mode of action of terpene linalyl anthranilate against carbapenemase-producing Klebsiella pneumoniae
  Yang, Journal of pharmaceutical analysis 2021
  • “...L9 2.24 B5XNB4 30S ribosomal protein S13 1.52 B5XN86 30S ribosomal protein S7 b a B5XQC8 50S ribosomal protein L35 b a A6TES6 Ribosomal protein L11 methyltransferase b a A6T6T1 Ribosomal protein S12 methylthiotransferase RimO b a A6TEC2 Ribosomal RNA large subunit methyltransferase G b a...”
• Lavender essential oil induces oxidative stress which modifies the bacterial membrane permeability of carbapenemase producing Klebsiella pneumoniae
  Yang, Scientific reports 2020
  • “...Chaperone protein DnaJ dnaJ A6T4F5 Stress response Cytoplasm 3.15398 36 50S ribosomal protein L35 rpmI B5XQC8 Protein biosynthesis Ribosomal protein 3.12775 37 Leucine-responsive regulatory protein lrp P37424 DNA processing Cytoplasm 3.05971 38 Outer membrane protein C ompC Q48473 Transporter protein Membrane 3.03548 39 ATP synthase epsilon...”
• Stress response of Escherichia coli to essential oil components - insights on low-molecular-weight proteins from MALDI-TOF
  Božik, Scientific reports 2018
  • “...to the chlorine- and peroxide-treated samples was that of 50S ribosomal protein L35 (m/z 7290,90, B1XG24), which is a structural constituent of the ribosome. This protein was also observed in cinnamaldehyde- and carene-treated samples. The lower amounts of stationary phase-induced ribosome-associated protein (m/z 5096,84, P68191, SRA)...”
• Nonspecific inhibition of Escherichia coli ornithine decarboxylase by various ribosomal proteins: detection of a new ribosomal protein possessing strong antizyme activity.
  Kashiwagi, Biochimica et biophysica acta 1987 (PubMed)
  • GeneRIF: N-terminus verified by Edman degradation on mature peptide
• Salmonella enterica serovar typhimurium colonizing the lumen of the chicken intestine grows slowly and upregulates a unique set of virulence and metabolism genes
  Harvey, Infection and immunity 2011
  • “...STM3430 STM3422 STM4393 STM3441 STM0981 STM3447 STM3448 STM3436 STM3419 STM1335 rplN rplP rpsR rpsJ rpsA rpsG rpsL rpsS rpmJ rpmI 50S 50S 30S 30S 30S 30S 30S...”
• A systems approach discovers the role and characteristics of seven LysR type transcription factors in Escherichia coli
  Rodionova, Scientific reports 2022
  • “...membrane transport protein YnfM 3.06E04 221 1.5 b1656 sodB Superoxide dismutase [Fe] 5.46E05 323 4.8 b1717 rpmI 50S ribosomal protein L35 3.57E05 55 2.4 b1886 tar Methyl-accepting chemotaxis protein II 4.20E05 298 1.4 b1889 motB Motility protein B 3.08E04 61 1.6 b2094 gatA PTS system galactitol-specific...”
• 18th Congress of the European Hematology Association, Stockholm, Sweden, June 13–16, 2013
  , Haematologica 2013
• In vitro transcription profiling of the σS subunit of bacterial RNA polymerase: re-definition of the σS regulon and identification of σS-specific promoter sequence elements
  Maciag, Nucleic acids research 2011
  • “...79 ); upregulated in rpoS mutant of MG1655 ( 17 ) rpmI Ribosomal protein L35 b1717 1.91 prfB Release Factor RF2 b2891 1.91 Upregulated in a biofilm-growing rpoS mutant derivative of MG1655 ( 18 ) rimP Ribosomal maturation protein b3170 2.01 rpsF Ribosomal protein S6 b4200...”
• Analysis of promoter targets for Escherichia coli transcription elongation factor GreA in vivo and in vitro
  Stepanova, Journal of bacteriology 2007
  • “...lpp b1677 1.8 Murein lipoprotein rplT rpmI infC b1716 b1717 Z2747 1.7 1.8 2.0 50S ribosomal subunit protein L20 and regulator 50S ribosomal subunit protein A...”
• Differential gene expression for investigation of Escherichia coli biofilm inhibition by plant extract ursolic acid
  Ren, Applied and environmental microbiology 2005
  • “...0.0220 1.0 0.7185 rmf b0953 1.5 0.0029 1.0 0.6617 rpmI b1717 1.6 0.0072 1.0 0.7076 slp ugpB b3506 b3453 1.5 0.0059 1.6 0.0020 1.4 0.0446 1.5 0.0210 ybiK yhaD...”
• Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate
  Pomposiello, Journal of bacteriology 2001
  • “...b3304 b3186 b3315 b3318 b3309 b3185 b3637 b3312 b3302 b1717 b3299 b3295 b0169 b3314 b3296 b3303 b3306 b3230 b3321 b3297 b3307 b2609 b3311 atpA atpC atpF atpH...”
• Computational Identification of Essential Enzymes as Potential Drug Targets in Shigella flexneri Pathogenesis Using Metabolic Pathway Analysis and Epitope Mapping
  Narad, Journal of microbiology and biotechnology 2021
  • “...protein L32 Cytoplasm No Hits 19 NP_709497 50S ribosomal protein L34 Cytoplasm No Hits 20 NP_707397 50S ribosomal protein L35 Cytoplasm No Hits 21 NP_709083 DNA-directed RNA polymerase subunit alpha Cytoplasm No Hits 22 NP_706830 30S ribosomal protein S1 Cytoplasm No Hits 23 NP_708875 30S ribosomal...”
• Global transcriptomic analysis of ethanol tolerance response in Salmonella Enteritidis
  He, Current research in food science 2022
  • “...L2 SEN3256 rplE 3.10 50S ribosomal protein L5 SEN3936 rplL 3.73 50S ribosomal protein L7/L12 SEN1709 rpmI 2.99 50S ribosomal protein L35 SEN0885 rpsA 2.85 30S ribosomal protein S1 SEN3252 rplR 3.90 50S ribosomal protein L18 SEN3261 rplP 3.83 50S ribosomal protein L16 SEN3249 rplO 3.40...”

PG0990 ribosomal protein L35 from Porphyromonas gingivalis W83
PGN_0964 probable 50S ribosomal protein L35 from Porphyromonas gingivalis ATCC 33277
F452_RS0103380 50S ribosomal protein L35 from Porphyromonas gulae DSM 15663
Aligns to 2:64 / 65 (96.9%), covers 98.4% of TIGR00001, 90.7 bits

• Molecular pathways underlying inhibitory effect of antimicrobial peptide Nal-P-113 on bacteria biofilms formation of Porphyromonas gingivalis W83 by DNA microarray
  Wang, BMC microbiology 2017
  • “...synthetase is one of the key enzymes in protein synthesis [ 17 ]. PG2117 and PG0990 both encoding ribosomal proteins were shown to be up-regulated by 3.32-fold and 2.52-fold, respectively. Moreover, transporting and binding protein pathway was also significantly inhibited by Nal-P-113 treatment. 4 out of...”
• Microarray analysis of the transcriptional responses of Porphyromonas gingivalis to polyphosphate
  Moon, BMC microbiology 2014
  • “...protein L31 4.01 PG0656 50S ribosomal protein L34 6.80 PG0989 50S ribosomal protein L20 3.43 PG0990 Ribosomal protein L35 1.74 PG1723 Ribosomal protein S20 2.94 PG1758 Ribosomal protein S15 6.23 PG1959 Ribosomal protein L33 2.02 PG1960 Ribosomal protein L28 2.03 PG2117 30S ribosomal protein S16 2.93...”
• Pathway analysis for intracellular Porphyromonas gingivalis using a strain ATCC 33277 specific database
  Hendrickson, BMC microbiology 2009
  • “...(1) PGN_0035 PGN_0167 PGN_0640 PGN_0965 PGN_0394 PGN_0188 PGN_0279 PGN_1572 PGN_1589 PGN_0636 PGN_0639 PGN_1647 PGN_1648 PGN_0641 PGN_0964 PGN_1698 PGN_1844 PGN_1088 PGN_1219 PGN_1651 PGN_1852 PGN_1573 PGN_1575 PGN_1853 PGN_1854 PGN_1588 PGN_1590 PGN_1855 PGN_1861 PGN_1832 PGN_1840 PGN_1863 PGN_1868 PGN_1842 PGN_1843 PGN_1872 PGN_1890 PGN_1849 PGN_1850 PGN_1891 PGN_1856 PGN_1857 PGN_1857 PGN_1858 PGN_1860...”
• Antibacterial effects of sodium tripolyphosphate against Porphyromonas species associated with periodontitis of companion animals
  Lee, Journal of veterinary science 2019
  • “...50S ribosomal protein L20 1.97E-26 +3.66 * F452_RS0100210 50S ribosomal protein L21 4.76E-35 +3.65 * F452_RS0103380 50S ribosomal protein L35 9.81E-24 +3.60 * F452_RS0102545 50S ribosomal protein L33 3.07E-20 +3.48 * F452_RS0102540 50S ribosomal protein L28 1.35E-14 +2.74 * F452_RS0101135 30S ribosomal protein S1 7.48E-15 +2.56...”

M892_02880 50S ribosomal protein L35 from Vibrio campbellii ATCC BAA-1116
Aligns to 2:63 / 64 (96.9%), covers 100.0% of TIGR00001, 90.5 bits

• Vibrio campbellii hmgA-mediated pyomelanization impairs quorum sensing, virulence, and cellular fitness
  Wang, Frontiers in microbiology 2013
  • “...PhaB 9.29E-06 2.97 0.83 3.58 I M892_16425 Acyl carrier protein 8.93E-06 4.07 1.59 2.56 I M892_02880 Ribosomal protein L35 5.66E-04 2.01 1.40 1.44 J M892_02885 Bacterial protein translation initiation factor 3 1.83E-05 2.95 2.39 1.23 J M892_07900 Ribosome-associated protein Y 6.25E-05 4.21 2.97 1.42 J M892_12355...”

MT1680 50S ribosomal protein L35 from Mycobacterium tuberculosis CDC1551
Rv1642 50S ribosomal protein L35 from Mycobacterium tuberculosis H37Rv
MRA_1653 50S ribosomal protein L35 from Mycobacterium tuberculosis H37Ra
Aligns to 2:64 / 64 (98.4%), covers 98.4% of TIGR00001, 89.9 bits

• Conserved codon composition of ribosomal protein coding genes in Escherichia coli, Mycobacterium tuberculosis and Saccharomyces cerevisiae: lessons from supervised machine learning in functional genomics
  Lin, Nucleic acids research 2002
  • “...MT0736, MT0728, MT0747, MT1337, MT2117.1, MT0663, MT4041.1, MT1680, MT3567.1, MT0729, MT0742, MT0744, MT0681, MT0062 Small subunit 22 MT1666, MT0727, MT3566,...”
• Integrated sequence and -omic features reveal novel small proteome of Mycobacterium tuberculosis
  Sinha, Frontiers in microbiology 2024
  • “...1995 ). In another example, MTB_ORF_16006 is an integral part of an operon comprising Rv1641, Rv1642, Rv1643 , and Rv1644 ( Supplementary Figure 12 ). The proteins in this operon share functions closely related to ribosome assembly and protein synthesis. Notably, MTB_ORF_16006 features a membrane-binding domain...”
  • “...MTB_ORF_54512. Supplementary Figure 12 Representation of MTB_ORF_16006 within an operon that includes the genes Rv1641, Rv1642, Rv1643 , and Rv1644 . Supplementary Table 1 The genomic locations of smORFs and the growth condition in which they were predicted. Supplementary Table 2 The accession numbers and the...”
• Label-Free Comparative Proteomics of Differentially Expressed Mycobacterium tuberculosis Protein in Rifampicin-Related Drug-Resistant Strains
  Ullah, Pathogens (Basel, Switzerland) 2021
  • “...is possibly involved in a transcriptional process, metabolism, and cell development [ 59 ]. RpmI (Rv1642) is an active virulence operon involved in protein synthesis and is associated with invasion and intercellular resistance [ 60 ]. UreA (Rv1848) is involved in the conversion of urea to...”
  • “...PPE19 PE/PPE Rv1534 Rv1534 Possibly involved in a transcriptional mechanism Probable transcriptional regulator Regulatory proteins Rv1642 rpmI Translation 50S ribosomal protein L35 RpmI Information pathways Rv1848 ureA Involved in the conversion of urea to NH 3 [catalytic activity: urea + H 2 O = CO 2...”
• Transcriptional Profile of Mycobacterium tuberculosis in an in vitro Model of Intraocular Tuberculosis
  Abhishek, Frontiers in cellular and infection microbiology 2018
  • “...intracellular replication in ARPE-19 cells. Upregulation of ribosomal ( Rv2056c, Rv3459c, Rv3456c, Rv1630, Rv0720, Rv0979A, Rv1642 , and Rv0700 ), transcriptional ( Rv0823c, Rv1994c, Rv3765c, Rv3160c, Rv1963c, Rv3416, Rv0232, Rv0602c, Rv1129c, Rv2324, Rv3183 , and Rv3833 ), and translation initiation ( Rv3462c ) transcripts whose protein...”
• The effect of growth rate on pyrazinamide activity in Mycobacterium tuberculosis - insights for early bactericidal activity?
  Pullan, BMC infectious diseases 2016
  • “...P41194 30S ribosomal protein S7 4.07 3.05 Rv0718 P66625 30S ribosomal protein S8 3.13 3.04 Rv1642 P66271 50S ribosomal protein L35 2.59 3.02 Rv0714 P66069 50S ribosomal protein L14 2.79 2.92 Rv0707 P0A5X6 30S ribosomal protein S3 1.06 2.91 5S_rRNA ribosomal RNA 2.44 2.91 Rv0721 P66574...”
• Osmosensory signaling in Mycobacterium tuberculosis mediated by a eukaryotic-like Ser/Thr protein kinase
  Hatzios, Proceedings of the National Academy of Sciences of the United States of America 2013
  • “...Rv1072 Rv1078 Rv1297 Rv1462 Rv1463 Rv1464 Rv1466 Rv1641 Rv1642 Rv1643 Rv1652 Rv1653 Rv1654 Rv1655 Rv1656 Rv1657 Rv1658 Rv1659 Rv1886c Rv1908c Rv1980c Rv1996...”
• The Corynebacterium pseudotuberculosis in silico predicted pan-exoproteome
  Santos, BMC genomics 2012
  • “...487 58.67 495 Rv1018c glmU NP_215534.1 bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase plcpsec115 cpfrc_00945 64 63.33 64 Rv1642 rpmI NP_216158.1 50S ribosomal protein L35 plcppse080 cpfrc_01015 452 57.08 470 Rv0392c ndhA NP_214906.1 membrane NADH dehydrogenase plcppse080 cpfrc_01015 452 58.10 463 Rv1854c ndh NP_216370.1 NADH dehydrogenase plcpsec041 cpfrc_01074 403...”
• Mycobacterium tuberculosis modulates its cell surface via an oligopeptide permease (Opp) transport system
  Flores-Valdez, FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2009
  • “...2.0 Annotationb or similarityc to protein domains Rv1594 Rv1596 Rv1623c Rv1642 Rv1653 Rv1687c 1.4 1.3 0.9 1.0 1.3 1.0 0.6 1.7 0.6 1.6 1.6 0.6 1.0 1.0 0.9 1.4...”
• The gene expression data of Mycobacterium tuberculosis based on Affymetrix gene chips provide insight into regulatory and hypothetical genes
  Fu, BMC microbiology 2007
  • “...rplD 4868 415 Rv2159c - 3197 832 Rv0701 rplC 4822 429 Rv0640 rplK 3169 256 Rv1642 rpmI 4816 562 Rv2392 cysH 3147 663 Rv2244 acpM 4650 1053 Rv2196 qcrB 3137 578 Rv1884c rpfC 4642 615 Rv2391 nirA 3110 822 Rv1305 atpE 4488 679 Rv0289 - 3088...”
• More
• Rv2629 Overexpression Delays Mycobacterium smegmatis and Mycobacteria tuberculosis Entry into Log-Phase and Increases Pathogenicity of Mycobacterium smegmatis in Mice
  Liu, Frontiers in microbiology 2017
  • “...YP_001283215.1 Secreted antigen 85-B FbpB Up Down Up MRA_1706 YP_001283017.1 Hypothetical protein Up Up Up MRA_1653 YP_001282961.1 50S ribosomal protein L35 Up Up Up MRA_1624 YP_001282932.1 Prolipoprotein diacylglyceryl transferase Up Up Up MRA_1622 YP_001282930.1 Tryptophan synthase subunit beta Up Up Up MRA_1323 YP_001282626.1 UDP- N -acetylglucosamine...”

8rd8dh / A0A0M4U4I0 8rd8dh (see paper)
Aligns to 2:63 / 64 (96.9%), covers 98.4% of TIGR00001, 89.2 bits

• Ligand: rna (8rd8dh)

PD1914 50S ribosomal protein L35 from Xylella fastidiosa Temecula1
Aligns to 2:64 / 65 (96.9%), covers 100.0% of TIGR00001, 89.1 bits

• Csp1, a Cold Shock Protein Homolog in Xylella fastidiosa Influences Cell Attachment, Pili Formation, and Gene Expression
  Wei, Microbiology spectrum 2021
  • “...PD1440 rpsT 30S ribosomal protein S20 6,060.28 1,246.99 0.21 PD0708 Virulence regulator 672.31 141.02 0.21 PD1914 rpmI 50S ribosomal protein L35 21,603.77 4,619.53 0.21 PD0626 ssb Single-stranded DNA-binding protein 484.98 103.71 0.21 PD0061 fimC Chaperone protein precursor 477.40 108.95 0.23 PD1087 Hypothetical protein 2,361.29 585.51 0.25...”

7f0d3 / A5U2Z9 Cryo-em structure of mycobacterium tuberculosis 50s ribosome subunit bound with clarithromycin (see paper)
Aligns to 1:62 / 62 (100.0%), covers 96.8% of TIGR00001, 89.1 bits

• Ligand: rna (7f0d3)

GBAA_4818 50S ribosomal protein L35 from Bacillus anthracis str. 'Ames Ancestor'
Aligns to 2:64 / 66 (95.5%), covers 98.4% of TIGR00001, 88.9 bits

• Microevolution of Anthrax from a Young Ancestor (M.A.Y.A.) Suggests a Soil-Borne Life Cycle of Bacillus anthracis
  Braun, PloS one 2015
  • “...Phe comG operon protein 4 GBAA_4463 6 4380690 A C - 1 ribosomal protein L35 GBAA_4818 1 silent mutation HRM for analysis of SNP distribution in Pollino isolates SNP discovery in the genome-sequenced Pollino isolates yielded a number of 6 point mutations that appeared to be...”

RK35_SPIOL / P23326 Large ribosomal subunit protein bL35c; 50S ribosomal protein L35, chloroplastic; CL35 from Spinacia oleracea (Spinach) (see 2 papers)
Aligns to 90:152 / 159 (39.6%), covers 100.0% of TIGR00001, 88.1 bits

• function: Component of the chloroplast ribosome (chloro-ribosome), a dedicated translation machinery responsible for the synthesis of chloroplast genome-encoded proteins, including proteins of the transcription and translation machinery and components of the photosynthetic apparatus.
  subunit: Component of the chloroplast large ribosomal subunit (LSU). Mature 70S chloroplast ribosomes of higher plants consist of a small (30S) and a large (50S) subunit. The 30S small subunit contains 1 molecule of ribosomal RNA (16S rRNA) and 24 different proteins. The 50S large subunit contains 3 rRNA molecules (23S, 5S and 4.5S rRNA) and 33 different proteins.
• Adaptive responses along a depth and a latitudinal gradient in the endemic seagrass Posidonia oceanica.
  Jahnke, Heredity 2019
• Cryo-EM structure of the large subunit of the spinach chloroplast ribosome
  Ahmed, Scientific reports 2016
  • “...57 bL33c c P28805 166 959 55 bL34c d P82244 92152 92148 46 bL35c e P23326 87159 91157 65 bL36c f P12230 137 137 38 PSRP5 g P27684 63142 79121 PSRP variant 5, pI=10.01 PSRP6 h P82411 48116 4893 pI=9.87 Protein residues and signal peptide positions...”

A0QYU7 Large ribosomal subunit protein bL35 from Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
MSMEG_3792 ribosomal protein L35 from Mycobacterium smegmatis str. MC2 155
MSMEG_3792, MSMEI_3704 50S ribosomal protein L35 from Mycolicibacterium smegmatis MC2 155
Aligns to 2:64 / 64 (98.4%), covers 98.4% of TIGR00001, 87.5 bits

• Interactome Analysis Identifies MSMEI_3879 as a Substrate of Mycolicibacterium smegmatis ClpC1
  Ogbonna, Microbiology spectrum 2023
  • “...protein L22 0.03 0.01 A0QSG0 rplX , MSMEG_1466, MSMEI_1430 50S ribosomal protein L24 0.02 0.02 A0QYU7 rpmI , MSMEG_3792, MSMEI_3704 50S ribosomal protein L35 0.01 0.01 A0QSP8 rplM , MSMEG_1556, MSMEI_1519 50S ribosomal protein L13 0.08 0.07 A0QSD2 rplD , MSMEG_1437, MSMEI_1401 50S ribosomal protein L4...”
• Interactome Analysis Identifies MSMEI_3879 as a Substrate of Mycolicibacterium smegmatis ClpC1
  Ogbonna, Microbiology spectrum 2023
  • “...0.01 A0QSG0 rplX , MSMEG_1466, MSMEI_1430 50S ribosomal protein L24 0.02 0.02 A0QYU7 rpmI , MSMEG_3792, MSMEI_3704 50S ribosomal protein L35 0.01 0.01 A0QSP8 rplM , MSMEG_1556, MSMEI_1519 50S ribosomal protein L13 0.08 0.07 A0QSD2 rplD , MSMEG_1437, MSMEI_1401 50S ribosomal protein L4 0.05 0.07 A0QSG6...”
• Gene Expression, Bacteria Viability and Survivability Following Spray Drying of Mycobacterium smegmatis
  Lauten, Materials (Basel, Switzerland) 2010
  • “...L33 rpmG 0.6 11.6 0.045 9% MSMEG_6946 ribosomal protein L34 rpmH 0.3 11.5 0.282 0% MSMEG_3792 ribosomal protein L35 rpmI 0.8 13.6 0.004 46% MSMEG_1520 ribosomal protein L36 rpmJ 0.4 13.3 0.080 1% MSMEG_3833 ribosomal protein S1 -0.3 12.1 0.174 1% MSMEG_2519 ribosomal protein S2 rpsB...”
• Interactome Analysis Identifies MSMEI_3879 as a Substrate of Mycolicibacterium smegmatis ClpC1
  Ogbonna, Microbiology spectrum 2023
  • “...A0QSG0 rplX , MSMEG_1466, MSMEI_1430 50S ribosomal protein L24 0.02 0.02 A0QYU7 rpmI , MSMEG_3792, MSMEI_3704 50S ribosomal protein L35 0.01 0.01 A0QSP8 rplM , MSMEG_1556, MSMEI_1519 50S ribosomal protein L13 0.08 0.07 A0QSD2 rplD , MSMEG_1437, MSMEI_1401 50S ribosomal protein L4 0.05 0.07 A0QSG6 rpsE...”

5nrg3 / Q2FXQ0 The crystal structure of the large ribosomal subunit of staphylococcus aureus in complex with rb02 (see paper)
Aligns to 1:63 / 65 (96.9%), covers 100.0% of TIGR00001, 87.5 bits

• Ligands: rna; manganese (ii) ion (5nrg3)

EKM74_RS01860 50S ribosomal protein L35 from Staphylococcus aureus
P66276 Large ribosomal subunit protein bL35 from Staphylococcus aureus (strain N315)
Q6GG26 Large ribosomal subunit protein bL35 from Staphylococcus aureus (strain MRSA252)
SA1503 50S ribosomal protein L35 from Staphylococcus aureus subsp. aureus N315
SAV1679 50S ribosomal protein L35 from Staphylococcus aureus subsp. aureus Mu50
MW1623 50S ribosomal protein L35 from Staphylococcus aureus subsp. aureus MW2
SACOL1726 ribosomal protein L35 from Staphylococcus aureus subsp. aureus COL
Aligns to 2:64 / 66 (95.5%), covers 100.0% of TIGR00001, 87.4 bits

• Transcriptomic Analysis Revealed Antimicrobial Mechanisms of Lactobacillus rhamnosus SCB0119 against Escherichia coli and Staphylococcus aureus
  Peng, International journal of molecular sciences 2022
  • “...ribosomal protein L21 EKM74_RS01855 19.42 10.05 621.08 94.23 4.999194 rplT ; 50S ribosomal protein L20 EKM74_RS01860 51.94 21.24 5478.49 45.03 6.720704 rpmI ; 50S ribosomal protein L35 EKM74_RS02080 80.66 17.27 3451.94 642.32 5.419314 rpsD ; 30S ribosomal protein S4 EKM74_RS05465 190.13 11.18 3317.01 500.37 4.124828 rpsI...”
• Identification of N-terminal protein processing sites by chemical labeling mass spectrometry
  Misal, Rapid communications in mass spectrometry : RCM 2019
  • “...24 M AIKKYKPITNGR R P60432 Ribosomal protein L2 Cytoplasm 21 19 25 M PKMKTHR G P66276 Ribosomal protein L35 Cytoplasm 5 5 26 M TKGILGR K P60449 Ribosomal protein L3 Cytoplasm 12 12 27 M TMTDPIADMLTR V P66630 Ribosomal protein S8 Cytoplasm 16 16 28 M...”
• Structural and Functional Dynamics of Staphylococcus aureus Biofilms and Biofilm Matrix Proteins on Different Clinical Materials
  Hiltunen, Microorganisms 2019
  • “...Q6GEI3 50S ribosomal protein L30 Q6GEK1 50S ribosomal protein L31 Q6GEV5 50S ribosomal protein L35 Q6GG26 50S ribosomal protein L4 Q6GEI4 50S ribosomal protein L5 Q99S33 50S ribosomal protein L6 Q99S36 50S ribosomal protein L7/L12 Q6GJC8 50S ribosomal protein L9 Q6GKT0 Elongation factor TuEfTU Q6GJC0 Elongation...”
• Transcriptional profiles of the response of methicillin-resistant Staphylococcus aureus to pentacyclic triterpenoids
  Chung, PloS one 2013
  • “...50S ribosomal protein L33 1,2,3 8.4 Translation SAS093 rpmH 50S ribosomal protein L34 6.3 Translation SA1503 rpmI 50S ribosomal protein L35 6.0 Translation SAS078 rpmJ 50S ribosomal protein L36 21.0 Translation SA2035 rplE 50S ribosomal protein L5 6.3 Translation SA0498 rplL 50S ribosomal protein L7/L12 8.3...”
• Staphylococcus aureus virulence expression is impaired by Lactococcus lactis in mixed cultures
  Even, Applied and environmental microbiology 2009
  • “...and cellular division genes SAV0535 SAV0547 SAV0548 SAV1678 SAV1679 SAV1128 IGS2 SAV1180 SAV0511 Corresponding ORF (MW2)c 4464 EVEN ET AL. APPL. ENVIRON....”
• Staphylococcus aureus virulence expression is impaired by Lactococcus lactis in mixed cultures
  Even, Applied and environmental microbiology 2009
  • “...SAV1433 SAV1474 SAV1261 SAV1228 MW0491 MW0502 MW0503 MW1622 MW1623 MW1010 nusG fus tufA rplT rpmI rpmF MW1063 MW0466 ftsL ftsH MW0284 MW1323 MW1363 MW1144...”
• Tea tree oil-induced transcriptional alterations in Staphylococcus aureus
  Cuaron, Phytotherapy research : PTR 2013
  • “...adenylosuccinate synthase SACOL0018 5-GAGGTTGGTCGTGAATACGG-3 5-TGGGTACTCAGTAATTTCTTTACCG-3 purM phosphoribosylaminoimidazole synthetase SACOL1080 5-AATATGGGTATTGGCTATACGG-3 5-CACAATATGACCAATTTGATAGGC-3 rpmI ribosomal protein L35 SACOL1726 5-TGCCAAAAATGAAAACTCACC-3 5-GAGATGTGAAAGCTCTTGAACG-3 tenA transcriptional regulator, TenA family SACOL2086 5-TAGGAGCTGACGCATTACGC-3 5-CCCATTGTTCTAGTGTCATAGCC-3 vraR DNA-binding response regulator VraR SACOL1942 5-AAAGAAGCAATTGCCAAAGC-3 5-TGAGTCGTCGCTTCTACACC-3 vraS histidine kinase sensor SACOL1943 5-AGTGCCGATGAAAGTTGTGC-3 5-TTTTGTACCGTTTGAATGACG-3 vraX VraX protein SACOL0625 5-TCGACAGTATCACCATGAAGG-3...”
  • “...dehydrogenase SACOL2628 7.0 1.5 1.6 hypothetical protein (191 aa) SACOL1086 7.0 rpmI ribosomal protein L35 SACOL1726 5.9 2.0 1.8 thiD phosphomethylpyrimidine kinase SACOL2085 5.1 purQ phosphoribosylformylglycinamidine synthase I SACOL1077 4.9 purC phosphoribosylaminoimidazole-succinocarboxamide synthase SACOL1075 4.6 thiE putative thiamine-phosphate pyrophosphorylase SACOL2083 3.8 thiM hydroxyethylthiazole kinase SACOL2084 3.2...”
• The Staphylococcus aureus LytSR two-component regulatory system affects biofilm formation
  Sharma-Kuinkel, Journal of bacteriology 2009
  • “...SACOL2234 SACOL2237 SACOL2228 SACOL2231 SACOL2221 SACOL1726 SACOL1274 SACOL2233 SACOL2222 SACOL0592 SACOL2240 SACOL2214 SACOL0591 SACOL2226 SACOL1292 SACOL2230...”

BPSL1943 50S ribosomal protein L35 from Burkholderia pseudomallei K96243
BTH_I2593 ribosomal protein L35 from Burkholderia thailandensis E264
bglu_1g21500 Ribosomal protein L35 from Burkholderia glumae BGR1
Aligns to 2:64 / 65 (96.9%), covers 98.4% of TIGR00001, 86.9 bits

• Unraveling the role of toxin-antitoxin systems in Burkholderia pseudomallei: exploring bacterial pathogenesis and interactions within the HigBA families
  Chapartegui-González, Microbiology spectrum 2024
  • “...and BPSS0390 (toxin HicA), and different genes that encodes for ribosomal-related proteins (BPSL0915, BPSL1461, BPSL1942, BPSL1943, BPSL2444, BPSL3194, BPSL3196, BPSL3197, BPSL3209, and BPSL3217). It is important to highlight a putative new TA system, encoded by BPSS1821-BPSS1820, that exhibits identity homology with the MbcTA system from M....”
• Genetic and transcriptional analysis of the siderophore malleobactin biosynthesis and transport genes in the human pathogen Burkholderia pseudomallei K96243
  Alice, Journal of bacteriology 2006
  • “...involved in protein biosynthesis (e.g., BPSS1716, BPSL0915, BPSL1943, and BPSL1962) were down-regulated. ORFs BPSS1162 and BPSS1163 showed the widest change in...”
• Gene and protein expression in response to different growth temperatures and oxygen availability in Burkholderia thailandensis
  Peano, PloS one 2014
  • “...4.92 2.3 150 All BTH_I2592 ( rplT ) L20 4.59 2.2 All rplT rpmI [33] BTH_I2593 ( rpmI ) L35 3.48 1.8 All rplT rpmI [33] BTH_I3041 ( rplQ ) L17 3.25 1.7 All BTH_I3043 ( rpsD ) S4 3.73 1.9 129.1 All [33] BTH_I3049BTH_I3058 (...”
• RNAseq-based Transcriptome Analysis of Burkholderia glumae Quorum Sensing
  Kim, The plant pathology journal 2013
  • “...0.6 2 1.4 bglu_1g18160 rpsU 1 1.5 0.2 0.5 bglu_1g21490 rplT 1 0.8 1.4 1.1 bglu_1g21500 rpmI 1.3 0.9 1.3 1.2 bglu_1g25990 rpsO 0.6 0.5 1.5 1.6 bglu_1g28680 rpmB 0.7 0.6 1. 1 bglu_1g28690 rpmG 0.5 0.4 1.5 1.1 bglu_1g29160 rpsT 0.9 0.8 1.8 1.4 bglu_1g31330...”

BB0189 ribosomal protein L35 (rpmI) from Borrelia burgdorferi B31
Aligns to 3:65 / 66 (95.5%), covers 98.4% of TIGR00001, 86.5 bits

• Norepinephrine mediates acquisition of transferrin-iron in Bordetella bronchiseptica
  Anderson, Journal of bacteriology 2008
  • “...February 16, 2017 by University of California, Berkeley BB0189 J. BACTERIOL. VOL. 190, 2008 NOREPINEPHRINE-MEDIATED IRON ACQUISITION 3943 FIG. 1. Analysis of...”
  • “...present study, three additional putative TonB-dependent receptors (BB0189, BB2179, and BB4457) were identified in the B. bronchiseptica genome sequence, based...”

PP_2467 50S ribosomal protein L35 from Pseudomonas putida KT2440
Aligns to 2:63 / 64 (96.9%), covers 98.4% of TIGR00001, 86.4 bits

• H-NS Family Proteins Drastically Change Their Targets in Response to the Horizontal Transfer of the Catabolic Plasmid pCAR1
  Nakamura, Frontiers in microbiology 2020
  • “...rpmF 50S ribosomal protein L32 PP_2465 thrS Threonyl-tRNA synthetase PP_2466 infC Translation initiation factor IF-3 PP_2467 rpmI 50S ribosomal protein L35 PP_4007 infA Translation initiation factor IF-1 PP_4794 leuS Leucyl-tRNA synthetase PP_4818 prmA 50S ribosomal protein L11 methyltransferase PP_4876 rpsR 30S ribosomal protein S18 PP_4877 rpsF...”
  • “...N (1)-)-methyltransferase PP_1465 rplS a,c 50S ribosomal protein L19 PP_1858 efp a,c Elongation factor P PP_2467 rpmI a 50S ribosomal protein L35 PP_3777 PP_3777 b Hypothetical protein PP_3784 PP_3784 b Hypothetical protein PP_4709 rpsO a 30S ribosomal protein S15 PP_4876 rpsR a 30S ribosomal protein S18...”

B0JSJ9 Large ribosomal subunit protein bL35 from Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Aligns to 2:66 / 67 (97.0%), covers 100.0% of TIGR00001, 86.3 bits

• Rapid Classification and Identification of Microcystis aeruginosa Strains Using MALDI-TOF MS and Polygenetic Analysis
  Sun, PloS one 2016 (no snippet)

ISORED2_02500 50S ribosomal protein L35 from Acetobacterium wieringae
Aligns to 2:64 / 67 (94.0%), covers 96.8% of TIGR00001, 86.1 bits

• Evidence for a Putative Isoprene Reductase in Acetobacterium wieringae
  Kronen, mSystems 2023
  • “...Stress response ISORED2_01001 VUZ28314.1 2.39 1.01 10 2 556 ENOG4105CKU Formyltetrahydrofolate synthetase One-carbon metabolic process ISORED2_02500 VUZ24737.1 2.44 2.62 10 2 67 ENOG4105VJV 50s ribosomal protein L35 Structural constituent of ribosome ISORED2_00772 VUZ28022.1 2.46 2.85 10 2 513 ENOG410ND7V Xylulokinase Carbohydrate metabolic process ISORED2_00996 VUZ28309.1 4.48...”

SCO1599 50S ribosomal protein L35 from Streptomyces coelicolor A3(2)
Aligns to 2:64 / 64 (98.4%), covers 98.4% of TIGR00001, 86.0 bits

• The Streptomyces coelicolor Small ORF trpM Stimulates Growth and Morphological Development and Exerts Opposite Effects on Actinorhodin and Calcium-Dependent Antibiotic Production
  Vassallo, Frontiers in microbiology 2020
  • “...10 2 Transcription; Stress response SCO1505 30S ribosomal protein S4 1.82 8.98 10 5 Translation SCO1599 50S ribosomal protein L35 1.59 3.90 10 3 SCO4702 50S ribosomal protein L3 1.47 1.65 10 2 SCO4702 50S ribosomal protein L3 1.30 3.66 10 2 SCO4702 50S ribosomal protein...”
• Conservation of thiol-oxidative stress responses regulated by SigR orthologues in actinomycetes
  Kim, Molecular microbiology 2012
  • “...relA GTP pyrophosphokinase for ppGpp synthesis (S1) 3 SCO1598 rplT 50S ribosomal protein L20 3 SCO1599 rpmI 50S ribosomal protein L35 3 SCO1600 * infC Translation initiation factor IF-3 S1 6 SCO1618 Hypothetical protein, similar to cobalamin binding protein BtuF 6 SCO1619 * Possible transcriptional regulatory...”
• Comparative genomics of Streptomyces avermitilis, Streptomyces cattleya, Streptomyces maritimus and Kitasatospora aureofaciens using a Streptomyces coelicolor microarray system
  Hsiao, Antonie van Leeuwenhoek 2008
  • “...protein S4 0.36 0.35 0.76 0.31 SCO1598 50S ribosomal protein L20 1.50 0.63 0.89 0.34 SCO1599 50S ribosomal protein L35 0.23 0.41 0.49 0.51 SCO1998 30S ribosomal protein S1 1.39 0.77 0.99 0.91 SCO2563 30s ribosomal protein S20 0.34 0.34 0.77 0.33 SCO2596 50S ribosomal protein...”

C9Z4H9 Large ribosomal subunit protein bL35 from Streptomyces scabiei (strain 87.22)
SCAB_73971 50S ribosomal protein L35 from Streptomyces scabiei 87.22
Aligns to 2:64 / 64 (98.4%), covers 98.4% of TIGR00001, 85.8 bits

• Comparative secretome analysis of Streptomyces scabiei during growth in the presence or absence of potato suberin
  Komeil, Proteome science 2014
  • “...30S ribosomal protein S1 0.070.06 nd nd C9Z316 SCAB_73401 d tRNA (adenine-N(1)-)-methyltransferase 0.020.03 0.070.07 0.070.04 C9Z4H9 SCAB_73971 50S ribosomal protein L35 0.570.00 0.900.44 0.480.28 C9Z4I0 SCAB_73981 d 50S ribosomal protein L20 0.380.35 0.420.25 0.300.13 Transcription C9Z8G5 SCAB_28931 d Transcription termination factor 0.030.04 nd nd C9YWA1 SCAB_37181...”
• Comparative secretome analysis of Streptomyces scabiei during growth in the presence or absence of potato suberin
  Komeil, Proteome science 2014
  • “...ribosomal protein S1 0.070.06 nd nd C9Z316 SCAB_73401 d tRNA (adenine-N(1)-)-methyltransferase 0.020.03 0.070.07 0.070.04 C9Z4H9 SCAB_73971 50S ribosomal protein L35 0.570.00 0.900.44 0.480.28 C9Z4I0 SCAB_73981 d 50S ribosomal protein L20 0.380.35 0.420.25 0.300.13 Transcription C9Z8G5 SCAB_28931 d Transcription termination factor 0.030.04 nd nd C9YWA1 SCAB_37181 d...”

7m4v2 / B7I693 A. Baumannii ribosome-eravacycline complex: 50s (see paper)
Aligns to 1:62 / 63 (98.4%), covers 98.4% of TIGR00001, 85.0 bits

• Ligand: rna (7m4v2)

Q728R7 Large ribosomal subunit protein bL35 from Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Aligns to 2:64 / 65 (96.9%), covers 100.0% of TIGR00001, 84.4 bits

• Synergy of Sodium Nitroprusside and Nitrate in Inhibiting the Activity of Sulfate Reducing Bacteria in Oil-Containing Bioreactors.
  Fida, Frontiers in microbiology 2018
  • “...et al., 2004 ). Proteins that showed decreased expression included ribosomal proteins (Q72CH7, Q72DH2, Q72CF7, Q728R7, Q728R8, Q72CS2, Q72DQ5, and Q72CF6), periplasmic-binding amino acid transporters (Q72E67, Q72F28, Q72F29, Q72EN0, Q72FN6, Q729Q3, and Q72CP5), tryptophan synthase (Q72EU7, Q72EU8, and Q72FX8), anthranilate synthase (Q72EV0, Q72EV1, Q72EV2, and Q72EV3),...”

CT834 L35 Ribosomal Protein from Chlamydia trachomatis D/UW-3/CX
Aligns to 2:64 / 64 (98.4%), covers 96.8% of TIGR00001, 83.8 bits

• Simultaneous transcriptional profiling of bacteria and their host cells
  Humphrys, PloS one 2013
  • “...assays were designed for genes CT81, CT500, CT229, CT875, CT734, CT446, CT577, CT18, CT864, CT665, CT834, CT391, CT216, CT705, and CT416. Chlamydial gene expression is plotted against the RPKM for each gene. qRT-PCR data is expressed as 1/log2 Ct and normalized to 16S rRNA. (PDF) Click...”

8uu97 / A0A660JIB9 8uu97 (see paper)
Aligns to 1:63 / 65 (96.9%), covers 96.8% of TIGR00001, 83.7 bits

• Ligand: rna (8uu97)

lmo1784 ribosomal protein L35 from Listeria monocytogenes EGD-e
Q71YN4 Large ribosomal subunit protein bL35 from Listeria monocytogenes serotype 4b (strain F2365)
Aligns to 2:64 / 66 (95.5%), covers 96.8% of TIGR00001, 83.6 bits

• Comparison of Surface Proteomes of Adherence Variants of Listeria Monocytogenes Using LC-MS/MS for Identification of Potential Surface Adhesins
  Tiong, Pathogens (Basel, Switzerland) 2016
  • “...protein S20 (9) CY CY 0.33 (E,C,CM) CY No No 0 No No <1.8 0.83 lmo1784 (3.7.1) 50S ribosomal protein L35 (8) CY CY 0.33 (E,C,CM) CY No No 0 Yes No <1.8 1.22 lmo2156 (5.1) Hypothetical protein (13) S M (Equal score to all) Unknown...”
  • “...--- 10 19 lmo1699 * ,1 lmo1699 Mobility and chemotaxis 1.5 --- >10 --- 20 lmo1784 rpmI Ribosomal proteins 3.7.1 --- --- 21 lmo1860 msrA Protein modification reductase A 3.8 --- 10x --- 22 lmo1953 pnp Metabolism of nucleotides and nucleic acids 2.3 --- >10 ---...”
• Characterisation of the transcriptomes of genetically diverse Listeria monocytogenes exposed to hyperosmotic and low temperature conditions reveal global stress-adaptation mechanisms
  Durack, PloS one 2013
  • “...lmo1707 1.95 *** 1.56 ** 1.10 *** 1.81 *** 1.08 *** 1.26 *** unknown protein lmo1784 rpmI 2.39 *** 1.32 *** 1.80 *** 1.66 ** 1.38 *** 2.32 *** ribosomal protein L35 lmo1816 rpmB 3.27 *** 4.34 *** 3.01 *** 3.58 ** 1.84 *** 4.11 ***...”
  • “...were rplK ( lmo0248 ), rplA ( lmo0249 ), rpsD ( lmo1596 ), rpmI ( lmo1784 ), rpmB ( lmo1816 ) and rpmE ( lmo2548 ). Although different physical stresses, both high Na + concentration and low temperature have a damaging effect on ribosome function. While...”
• Transcriptomic and phenotypic analyses suggest a network between the transcriptional regulators HrcA and sigmaB in Listeria monocytogenes
  Hu, Applied and environmental microbiology 2007
  • “...lmo1523 lmo1542 lmo1541 lmo1657 lmo1658 lmo1683 lmo1785 lmo1784 lmo1859 lmo1879 lmo1921 lmo1956 lmo2048 lmo2047 lmo2055 lmo2054 lmo2261 lmo2340 lmo2362 lmo2363...”
• Proteomic Exploration of Listeria monocytogenes for the Purpose of Vaccine Designing Using a Reverse Vaccinology Approach
  Srivastava, International journal of peptide research and therapeutics 2021
  • “...0.628 Non-allergen 133 Q721Y1 0.988 Non-allergen 134 Q71YM9 1.733 Non-allergen 135 Q71WG4 2.217 Non-allergen 136 Q71YN4 2.371 Non-allergen 137 Q71WH3 2.224 Non-allergen 138 Q71ZY7 0.968 Non-allergen 139 Q71XW7 1.979 Non-allergen 140 Q720A1 0.577 Non-allergen 141 Q723G3 2.038 Non-allergen 142 Q71WV3 0.925 Non-allergen 143 Q71ZJ5 0.952 Non-allergen...”
  • “...RRGKVRRAK 20.2 1.3055 Antigen DRB1_1301 LRGKAARIK 17.4 2.0521 Antigen Q71WG4 DRB1_1301 AKLEITLKR 51.3 1.1423 Antigen Q71YN4 DRB1_0701 FKRTGSGKL 34.3 1.1993 Antigen DRB1_1301 THRGSAKRF 43.7 1.0624 Antigen DRB1_1301 QKQKRKLRK 46.1 1.1816 Antigen Q71WH3 DRB1_1301 LGRTSSQRK 33.5 1.2846 Antigen Q71ZY7 DRB1_1301 LKKYCPRLR 50.8 2.0807 Antigen DRB1_1301 KKYCPRLRR 61.5...”

ACIAD3047 50S ribosomal protein L35 from Acinetobacter sp. ADP1
Aligns to 2:63 / 64 (96.9%), covers 98.4% of TIGR00001, 83.5 bits

• iTRAQ-Based Comparative Proteomic Analysis of Acinetobacter baylyi ADP1 Under DNA Damage in Relation to Different Carbon Sources
  Jiang, Frontiers in microbiology 2019
  • “...50S ribosomal protein L20 rplT ACIAD3046 0.32 0.56 0.44 0.44 50S ribosomal protein L35 rpmI ACIAD3047 0.28 0.42 0.44 0.47 30S ribosomal protein S4 rpsD ACIAD3195 0.44 0.59 0.41 0.58 30S ribosomal protein S11 rpsK ACIAD3196 0.6 0.67 0.51 0.66 30S ribosomal protein S13 rpsM ACIAD3197...”

Q9Z6R8 Large ribosomal subunit protein bL35 from Chlamydia pneumoniae
Aligns to 2:64 / 64 (98.4%), covers 96.8% of TIGR00001, 83.3 bits

• Prediction of Chlamydia pneumoniae protein localization in host mitochondria and cytoplasm and possible involvements in lung cancer etiology: a computational approach
  Alshamsan, Saudi pharmaceutical journal : SPJ : the official publication of the Saudi Pharmaceutical Society 2017
  • “...(Q9Z6V3), L4 (Q9Z7Q8), L5 (Q9Z7R9), L29 (Q9Z7R5), L27 (Q9Z807), L33 (Q9Z8T4), L34 (Q9Z6X1) and L35 (Q9Z6R8), L36 (Q9Z6X0), which potentially involved in various steps of translation and ribosome biogenesis in C. pneumoniae . Control of translation is a critical component for the progress and advancement of...”

Dde_2637 Ribosomal protein L35 from Desulfovibrio desulfuricans G20
Aligns to 2:64 / 65 (96.9%), covers 100.0% of TIGR00001, 83.2 bits

• Shotgun proteomic analysis of nanoparticle-synthesizing Desulfovibrio alaskensis in response to platinum and palladium
  Capeness, Microbiology (Reading, England) 2019
  • “...subunit 0.59 Transcription/translation Transcription/translation Transcription/translation Dde_1173 Protein of unknown function DUF306 Meta and HslJ 0.54 Dde_2637 Ribosomal protein L35 0.51 Dde_4007 50S ribosomal protein L32 0.31 Dde_2982 Ribosomal protein L31 0.66 Dde_1095 Ribosomal protein L19 0.52 Dde_0492 Hypothetical protein Dde_0492 0.45 Cell integrity/maintenance Dde_0327 Response regulator...”
  • “...dominated by ribosomal subunit proteins both small (Dde_2233, Dde_2608, Dde_2253, Dde_2232 and Dde_1133) and large (Dde_2637, Dde_1095, Dde_2254, Dde_2607 and Dde_2255). There are also other proteins involved in transcription and translation, such as the rRNA E-loop-binding protein (Dde_2127), the response regulator and CheY-like protein (Dde_0327), the...”

prpl35-1 / CAD24038.1 putative plastid ribosomal protein L35, partial from Zea mays (see paper)
Aligns to 50:112 / 120 (52.5%), covers 100.0% of TIGR00001, 83.0 bits

Rmet_1162 50S ribosomal protein L35 from Cupriavidus metallidurans CH34
Aligns to 2:64 / 65 (96.9%), covers 100.0% of TIGR00001, 82.6 bits

• Importance of RpoD- and Non-RpoD-Dependent Expression of Horizontally Acquired Genes in Cupriavidus metallidurans
  Große, Microbiology spectrum 2022
  • “...thrS 12.4 714 37 TTGCGTAACG 16 TATAAAATTC Rmet_1161 infC 10.8 2,673 36 TTGATAACGA 13 GTCAAATTCA Rmet_1162 rpmI 11.4 68 35 TTGCGTTCCG 14 AAGATACTGG Rmet_1166 ihfA 10.6 245 39 TTTGTTTGCG 15 GCTATAATTG Rmet_1975 dnaB 6.9 49 35 TTGCGGGAAG 13 GCTATACTCG Rmet_1979 rpsF 12.2 1,413 36 TGGAAAGCCT 15...”

Q67W51 50S ribosomal protein L35 from Oryza sativa subsp. japonica
Aligns to 76:138 / 146 (43.2%), covers 100.0% of TIGR00001, 82.5 bits

• Carbon and nitrogen partitioning of transgenic rice T2A-1 (Cry2A*) with different nitrogen treatments
  Ling, Scientific reports 2019
  • “...1 0.733 0.012 Uncharacterized protein B9FFK4 5.32 1 1 0.736 0.014 50S ribosomal protein L35 Q67W51 4.11 1 1 0.748 0.019 Os01g0717000 protein (Fragment) A0A0P0V7D0 9.09 1 1 0.751 0.020 ATP-dependent 6-phosphofructokinase A2ZQ69 12.33 1 5 0.757 0.024 Glutathione peroxidase B7FAE9 30.34 1 6 0.765 0.030...”

Psal182_RS02405 50S ribosomal protein L35 from Piscirickettsia salmonis
Aligns to 2:63 / 64 (96.9%), covers 96.8% of TIGR00001, 82.3 bits

• Cohabitation of Piscirickettsia salmonis genogroups (LF-89 and EM-90): synergistic effect on growth dynamics
  Carril, Frontiers in cellular and infection microbiology 2023
  • “...ATPase (Psal182_RS02460) 2.405-fold change, Protein kinase (Psal182_RS16425) with a2.225-fold change, and 50S ribosomal protein L35 (Psal182_RS02405) with a 2.087-fold change ( Figure5C ). 4 Discussion Intensive fish farming has led to the increased occurrence of infectious diseases in aquaculture-related species ( Sundberg etal., 2016 ). Moreover,...”

TPANIC_0849 50S ribosomal protein L35 from Treponema pallidum subsp. pallidum str. Nichols
TP0849 ribosomal protein L35 (rpmI) from Treponema pallidum subsp. pallidum str. Nichols
Aligns to 2:65 / 66 (97.0%), covers 98.4% of TIGR00001, 81.8 bits

• In-Depth Proteome Coverage of In Vitro-Cultured Treponema pallidum and Quantitative Comparison Analyses with In Vivo-Grown Treponemes
  Houston, Journal of proteome research 2024
  • “...only one treponemal protein was detected exclusively from in vivo-cultured T. pallidum . This protein, TPANIC_0849 (50S ribosomal protein L35), was detected previously in a single sample, based on the detection of a single tryptic peptide. 25 TPANIC_0849 is also a lysine-rich miniprotein (66 amino acid...”
• Characterizing the Syphilis-Causing Treponema pallidum ssp. pallidum Proteome Using Complementary Mass Spectrometry
  Osbak, PLoS neglected tropical diseases 2016
  • “...Inner membrane none TP0198 R9USD7 30S ribosomal protein S17 10 9.8 1.5 Translation Ribosome none TP0849 R9UU63 50S ribosomal protein L35 8 9.7 7.1 Translation Ribosome no_hit TP0490 O83503 Uncharacterized protein 7 9.6 0.7 Unknown no_hit TP0649 O83655 Hemolysin (TlyC) 30 9.5 0.6 Inner membrane P...”
• Transcriptome of Treponema pallidum: gene expression profile during experimental rabbit infection
  Smajs, Journal of bacteriology 2005
  • “...TP0792 TP0971 TP0356 TP0868 TP0319 TP0925 TP0844 TP0030 TP0919 TP0849 TP0243 TP0748 TP0768 TP0171 TP0758 TP1024 TP0362 TP0862 16.0 15.5 13.9 13.8 12.6 10.7 10.4...”

9c4g2 / Q6A7V2 Cutibacterium acnes 50s ribosomal subunit with clindamycin bound (see paper)
Aligns to 1:63 / 67 (94.0%), covers 96.8% of TIGR00001, 81.7 bits

• Ligand: rna (9c4g2)

8cd15 / Q9I0A1 8cd15 (see paper)
Aligns to 1:62 / 63 (98.4%), covers 96.8% of TIGR00001, 81.6 bits

• Ligand: rna (8cd15)

Q9I0A1 Large ribosomal subunit protein bL35 from Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
PA2742 50S ribosomal protein L35 from Pseudomonas aeruginosa PAO1
Aligns to 2:63 / 64 (96.9%), covers 96.8% of TIGR00001, 81.5 bits

• Proteomic Analysis of Vesicle-Producing Pseudomonas aeruginosa PAO1 Exposed to X-Ray Irradiation
  Zhang, Frontiers in microbiology 2020
  • “...Q9I0S3 PA2562 1.591 0.703 2.2562 Uncharacterized protein Q9I0H1 PA2667 MvaU 1.832 0.713 2.569 Uncharacterized protein Q9I0A1 PA2742 RpmI 1.243 0.179 6.944 50S ribosomal protein L35 Q9HZZ0 PA2854 1.662 0.608 2.73 Uncharacterized protein Q00514 PA3101 XcpT 1.293 0.567 2.28 Type II secretion system protein G Q9HZ35 PA3205...”
• Top-Down LESA Mass Spectrometry Protein Analysis of Gram-Positive and Gram-Negative Bacteria
  Kocurek, Journal of the American Society for Mass Spectrometry 2017
  • “...L33 Q9HTN9 31 Incubation and storage: 4 days, room temperature 723.8214 +10 7228.14 -2.0 L35 Q9I0A1 41 -Met 739.5860 +6 4431.47 -1.2 L36 Q9HWF6 45 759.9734 +11 8348.63 -1.4 S21 Q9I5V8 29 -Met 826.5565 +11 9081.04 -0.3 HU- P05384 51 Incubation: 48 h, 37 C Sampled...”
• The AraC-Type Transcriptional Regulator GliR (PA3027) Activates Genes of Glycerolipid Metabolism in Pseudomonas aeruginosa
  Kotecka, International journal of molecular sciences 2021
  • “...universal stress protein 11 intra 09845 PA3083 1.51 8.26 2,055,622 TPTMD aminopeptidase 12 intra 11,685 PA2742 1.20 3.10 2,411,617 TPTMD 50S ribosomal protein L35 13 prom 12,415 PA2601 1.04 3.90 2,570,649 TR LysR family transcriptional regulator 12,420 PA2602 1.75 HUU 3-mercaptopropionate dioxygenase 14 term 12,415 PA2601...”
• Proteomic Analysis of Vesicle-Producing Pseudomonas aeruginosa PAO1 Exposed to X-Ray Irradiation
  Zhang, Frontiers in microbiology 2020
  • “...PA2562 1.591 0.703 2.2562 Uncharacterized protein Q9I0H1 PA2667 MvaU 1.832 0.713 2.569 Uncharacterized protein Q9I0A1 PA2742 RpmI 1.243 0.179 6.944 50S ribosomal protein L35 Q9HZZ0 PA2854 1.662 0.608 2.73 Uncharacterized protein Q00514 PA3101 XcpT 1.293 0.567 2.28 Type II secretion system protein G Q9HZ35 PA3205 1.249...”
• The Pseudomonas aeruginosa CreBC two-component system plays a major role in the response to β-lactams, fitness, biofilm growth, and global regulation
  Zamorano, Antimicrobial agents and chemotherapy 2014
  • “...PA0519 PA0523 PA0524 PA0525 PA0918 PA1557 PA1582 PA1588 PA2742 PA3205 PA3392 PA3393 PA3394 PA3395 PA3872 PA3873 PA3874 PA3875 PA3876 PA3877 PA3915 PA4110 PA4238...”

HI1319m ribosomal protein L35 from Haemophilus influenzae Rd KW20
Aligns to 2:64 / 65 (96.9%), covers 100.0% of TIGR00001, 81.0 bits

• Initial proteome analysis of model microorganism Haemophilus influenzae strain Rd KW20
  Kolker, Journal of bacteriology 2003
  • “...HI0779 HI0789 HI1630 HI0879 HI0951 HI0785 HI0796 HI0758 HI0158 HI0950 HI0998 HI1319m HI0798.1 550 252 236 207 167 131 157 131 131 119 130 125 123 102 90 83 86...”

HSM_1355 50S ribosomal protein L35 from Haemophilus somnus 2336
HSM_1355 50S ribosomal protein L35 from Histophilus somni 2336
Aligns to 2:64 / 65 (96.9%), covers 100.0% of TIGR00001, 79.9 bits

• RNA-seq based transcriptional map of bovine respiratory disease pathogen "Histophilus somni 2336"
  Kumar, PloS one 2012
  • “.... 10.1371/journal.pone.0029435.g005 Figure 5 Identification of a novel operon structure comprised of three genes: HSM_1354, HSM_1355, and HSM_1356. The RNA-Seq coverage shows three genes annotated as ribosomal proteins (IF3, L35, and L20) being expressed as a transcription unit. Discussion In this study using RNA-Seq we describe...”

RK35_ARATH / Q8VZ55 Large ribosomal subunit protein bL35c; 50S ribosomal protein L35, chloroplastic from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT2G24090 ribosomal protein L35 family protein from Arabidopsis thaliana
Aligns to 75:137 / 145 (43.4%), covers 100.0% of TIGR00001, 79.5 bits

• subunit: Part of the 50S ribosomal subunit.
  disruption phenotype: Embryonic lethality. Embryo development arrested at the globular stage.
• Identification of a highly efficient chloroplast-targeting peptide for plastid engineering
  Thagun, PLoS biology 2024
  • “...leaf cells, particularly chloroplasts. A highly efficient cTP derived from Arabidopsis plastid ribosomal protein L35 (At2g24090) displayed remarkable effectiveness in chloroplast localization. This cTP facilitated the activities of chloroplast-targeted RNA-processing proteins and metabolic enzymes within plastids. This cTP could serve as an ideal transit peptide for...”
  • “...using in vitro import assays [ 33 ]. We primarily focused on At1g63970, At2g20920, and At2g24090 cTPs due to their exceptional chloroplast translocation capabilities, as demonstrated in our in planta expression experiment ( Fig 2 ). AtRbcS1A cTP was used as a reference cTP. Our initial...”
• Plastid ribosome protein L5 is essential for post-globular embryo development in Arabidopsis thaliana
  Dupouy, Plant reproduction 2022
  • “...cold stress Rogalski et al. ( 2008 ) L34 Non-essential AT1G29070 NA NA L35 NA AT2G24090 Essential Romani et al. ( 2012 ) L36 NA ATCG00760/ AT5G20180 Non-essential Fleischmann et al. ( 2011 ) Overview of experimentally demonstrated essentiality of Plastid Ribosomal Proteins (PRPs) for embryogenesis...”
• Separation and Paired Proteome Profiling of Plant Chloroplast and Cytoplasmic Ribosomes
  Firmino, Plants (Basel, Switzerland) 2020
  • “...NA AT1G75350 plastid 50S bL31c RPL31 + NA ATCG01020 plastid 50S bL32c RPL32 + NA AT2G24090 plastid 50S bL35c RPL35 family + NA AT3G56910 plastid 50S cL37 PSRP-5 + NA AT5G17870 plastid 50S cL38 PSRP-6 + NA AT5G30510 plastid 30S bS1c RPS1 + NA ATCG00160 plastid...”
• Spaceflight induces novel regulatory responses in Arabidopsis seedling as revealed by combined proteomic and transcriptomic analyses
  Kruse, BMC plant biology 2020
  • “...0.002 AT5G20180 Ribosomal protein L36 1.03 0.019 AT5G40950 50S ribosomal protein L27, chloroplastic 1.05 0.002 AT2G24090 Ribosomal protein L35 1.06 0.001 AT4G11175 Translation initiation factor IF-1, chloroplastic 1.08 0.002 AT3G27160 Ribosomal protein S21 family protein 1.11 0.001 AT1G68590 30S ribosomal protein 31, chloroplastic 1.13 0.025 AT1G32990...”
• Integrated Transcriptional and Proteomic Profiling Reveals Potential Amino Acid Transporters Targeted by Nitrogen Limitation Adaptation
  Liao, International journal of molecular sciences 2020
  • “...protein 2.52 0.003 4.68 0.004 At3g15190 chloroplast 30S ribosomal protein S20 2.53 0.002 7.40 0.003 At2g24090 ribosomal protein L35 family protein 2.54 0.001 6.40 0.003 At4g24770 RNA-binding protein cp31 2.59 0.001 5.50 0.004 At3g52380 RNA-binding protein cp33 2.78 0.003 4.46 0.003 At2g33450 chloroplast 50S ribosomal protein...”
• Genetic Architecture of Resistance to Alternaria brassicae in Arabidopsis thaliana: QTL Mapping Reveals Two Major Resistance-Conferring Loci
  Rajarammohan, Frontiers in plant science 2017
  • “...from the CZ population approximately lies in the same physical interval flanked by the genes At2g24090 and At2g26880. Subsequently, these QTL intervals were examined for genes with known functions in disease resistance. A GO term enrichment analysis of the genes in each QTL interval was carried...”
• Transcriptional analysis of sweet orange trees co-infected with 'Candidatus Liberibacter asiaticus' and mild or severe strains of Citrus tristeza virus
  Fu, BMC genomics 2017
  • “...family protein 1.32 RPL34 orange1.1g031306m AT1G29070 ribosomal protein L34 family protein 1.01 2.10 RPL35 orange1.1g031865m AT2G24090 ribosomal protein L35 family protein 1.29 RPL3A orange1.1g038172m AT1G43170 Arabidopsis ribosomal protein 1 1.61 RPL6B orange1.1g026764m AT1G74060 60S ribosomal protein L6 (RPL6B) 1.17 RPL7C orange1.1g026093m AT2G44120 60S ribosomal protein L7...”
• Co-infection of Sweet Orange with Severe and Mild Strains of Citrus tristeza virus Is Overwhelmingly Dominated by the Severe Strain on Both the Transcriptional and Biological Levels
  Fu, Frontiers in plant science 2017
  • “...Orange1.1g034124m AT5G44710 Molecular_function unknown 1.01 RPS21 Orange1.1g030080m AT3G27160 Structural constituent of ribosome 1.23 RPL35 Orange1.1g031865m AT2G24090 Ribosomal protein L35 family protein 1.18 RPS4B Orange1.1g024793m AT5G07090 40S Ribosomal protein S4 (RPS4B) 1.05 RPS20B Orange1.1g033482m AT3G47370 40S Ribosomal protein S20 (RPS20B) 1.18 RPS24B Orange1.1g032727m AT5G28060 40S Ribosomal protein...”
• More

FN0326 LSU ribosomal protein L35P from Fusobacterium nucleatum subsp. nucleatum ATCC 25586
Aligns to 2:64 / 68 (92.6%), covers 100.0% of TIGR00001, 79.1 bits

• Proteomics of Fusobacterium nucleatum within a model developing oral microbial community
  Hendrickson, MicrobiologyOpen 2014
  • “...1 Covers FN0327, FN0720, FN1287, FN1332, FN1546, FN1555, FN1556, FN1621, FN2020. 2 Covers FN0284, FN0325, FN0326, FN0329, FN0330, FN0430, FN0482, FN1117, FN1119, FN1282, FN1284, FN1285, FN1286, FN1364, FN1392, FN1437, FN1557, FN1558, FN1620, FN1623, FN1625, FN1626, FN1627, FN1628, FN1629, FN1630, FN1631, FN1632, FN1634, FN1635, FN1637, FN1638, FN1639,...”

RL35_THET8 / Q5SKU1 Large ribosomal subunit protein bL35; 50S ribosomal protein L35 from Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8) (see paper)
Aligns to 2:64 / 65 (96.9%), covers 100.0% of TIGR00001, 78.8 bits

• subunit: Part of the 50S ribosomal subunit

Alvin_0982 ribosomal protein L35 from Allochromatium vinosum DSM 180
Aligns to 2:64 / 65 (96.9%), covers 100.0% of TIGR00001, 78.6 bits

• Genome-wide transcriptional profiling of the purple sulfur bacterium Allochromatium vinosum DSM 180T during growth on different reduced sulfur compounds
  Weissgerber, Journal of bacteriology 2013
  • “...Alvin_0629 Alvin_0741 Alvin_0742 Alvin_0852 Alvin_0913 Alvin_0982 Alvin_1093 Alvin_1095 Alvin_1196 Alvin_1197 Alvin_1420 Alvin_1436 Alvin_1525 Alvin_1527...”

CTL0206 LSU ribosomal protein L35P from Chlamydia trachomatis 434/Bu
Aligns to 1:61 / 61 (100.0%), covers 93.7% of TIGR00001, 77.8 bits

• Robust Heat Shock Response in Chlamydia Lacking a Typical Heat Shock Sigma Factor
  Huang, Frontiers in microbiology 2021
  • “...methyltransferase 2.17 nd na rbfA CTL0350 Ribosome-binding factor A 1.89 nd na Subunit assembly rpmI CTL0206 50S ribosomal protein L35 1.60 nd na rpsP CTL0281 30S ribosomal protein S16 2.38 (1.670.16) 8.00E-03 rplS CTL0283 50S ribosomal protein L19 2.37 (1.550.15) 2.99E-03 rpsA CTL0353 30S ribosomal protein...”
• Genomewide Transcriptional Responses of Iron-Starved Chlamydia trachomatis Reveal Prioritization of Metabolic Precursor Synthesis over Protein Translation
  Brinkworth, mSystems 2018
  • “...Amino acid biosynthesis B0B7J8 CTL0680 CTL0680 2.14 1.59E3 Putative rRNA processing peptide Translation A0A0H3MHB1 rpmL CTL0206 2.14 1.75E3 Ribosomal subunit Translation A0A0H3MCP7 fer CTL0315 2.26 6.48E5 Ferredoxin Redox homeostasis A0A0H3MCW5 CTL0552 CTL0552 2.27 1.09E3 TPR-containing domain Hypothetical Pseudogene CTL0222 CTL0222 2.27 6.58E3 Hypothetical Hypothetical A0A0H3MK96 infA2...”

7ood1 / P75447 Mycoplasma pneumoniae 50s subunit of ribosomes in chloramphenicol- treated cells (see paper)
MPN116 ribosomal protein L35 from Mycoplasma pneumoniae M129
Aligns to 1:59 / 59 (100.0%), covers 92.1% of TIGR00001, 76.9 bits

• Ligand: rna (7ood1)
• FASTQINS and ANUBIS: two bioinformatic tools to explore facts and artifacts in transposon sequencing and essentiality studies
  Miravet-Verde, Nucleic acids research 2020
  • “...terminal regions for E and F genes becomes shorter with each cell passage. For example, mpn116 is predicted to be a F gene ( Poisson model, default) up to P06, at which point it starts to be classified as E using the arbitrary threshold of 5%...”
  • “...the CPD algorithm. Base-pair scales are shown below the gene name. ( A ) Gene mpn116 at different passages, for passages 02, 06 and 08 (darker to lighter colors), presents and extended C-terminal of 50% (passage 1 and 2) that becomes shorter with selection (15% for...”
• Development of a Multilocus Sequence Typing Scheme for Molecular Typing of Mycoplasma pneumoniae
  Brown, Journal of clinical microbiology 2015
  • “...MPN016b MPN017b MPN020 MPN103 MPN105 MPN108 MPN109 MPN113 MPN116 MPN118 MPN120 MPN122 MPN136 MPN004 MPN104c MPN106c MPN110c MPN124 MPN131 MPN111 MPN011 MPN112...”
  • “...MPN113 MPN111 MPN108 MPN118 MPN103 MPN120 MPN136 MPN130 MPN116 MPN105 MPN109 MPN122 MPN101 MPN106 MPN124 MPN110 MPN131 MPN104 MPN126 MPN128 MPN102 MPN129 MPN134...”

BAB1_2123 Ribosomal protein L35 from Brucella melitensis biovar Abortus 2308
Aligns to 2:64 / 66 (95.5%), covers 98.4% of TIGR00001, 76.7 bits

• Proteomics-based confirmation of protein expression and correction of annotation errors in the Brucella abortus genome
  Lamontagne, BMC genomics 2010
  • “...membrane BAB1_0659 Omp2a BAB1_0707 OstA BAB1_0963 TolC Unknown localization BAB1_0030 Unknown BAB1_0991 Unknown BAB1_1543 DUF526 BAB1_2123 RpmI; L35 BAB1_0170 GrpE BAB1_1070 WrbA BAB1_1559 FbcF BAB1_2176 YaeC/NLPA lipoprotein BAB1_0389 CcoP BAB1_1113 Unknown; conserved BAB1_1641 Unknown BAB1_2186 RpsT; S20 BAB1_0413 AtpB BAB1_1152 PdhA BAB1_1647 FabG domain BAB2_0207 Unknown...”

A4VVU6 Large ribosomal subunit protein bL35 from Streptococcus suis (strain 05ZYH33)
SSU05_1269 50S ribosomal protein L35 from Streptococcus suis 05ZYH33
Aligns to 2:64 / 66 (95.5%), covers 96.8% of TIGR00001, 76.2 bits

• DivIVA Interacts with the Cell Wall Hydrolase MltG To Regulate Peptidoglycan Synthesis in Streptococcus suis
  Jiang, Microbiology spectrum 2023
  • “...Uncharacterized protein conserved in bacteria 14.605 1.9804 ++ A4VXU5 SSU05_1968 DNA nuclease 113.94 1.9637 ++ A4VVU6 SSU05_1269 rpmI 50S ribosomal protein L35 7.6911 1.9 ++ A4VW87 SSU05_1410 ftsX Cell division protein FtsX 35.393 1.8979 ++ A4VSW9 SSU05_0240 msrA Multifunctional fusion protein 35.624 1.7385 + A4VSW2 SSU05_0233...”
• DivIVA Interacts with the Cell Wall Hydrolase MltG To Regulate Peptidoglycan Synthesis in Streptococcus suis
  Jiang, Microbiology spectrum 2023
  • “...protein conserved in bacteria 14.605 1.9804 ++ A4VXU5 SSU05_1968 DNA nuclease 113.94 1.9637 ++ A4VVU6 SSU05_1269 rpmI 50S ribosomal protein L35 7.6911 1.9 ++ A4VW87 SSU05_1410 ftsX Cell division protein FtsX 35.393 1.8979 ++ A4VSW9 SSU05_0240 msrA Multifunctional fusion protein 35.624 1.7385 + A4VSW2 SSU05_0233 Uncharacterized...”

MHO_1280 50S ribosomal protein L35 from Mycoplasma hominis
Aligns to 2:62 / 62 (98.4%), covers 95.2% of TIGR00001, 76.1 bits

• Characterisation of mobile genetic elements in Mycoplasma hominis with the description of ICEHo-II, a variant mycoplasma integrative and conjugative element
  Henrich, Mobile DNA 2020
  • “...(IA)) and ICEF-II-A (AAN85259.1 (II-A)). Two chromosomal proteins of M. hominis PG21 (MHO_0070 (CAX37141.1) and MHO_1280 (CAX37262.1)) were used as unrelated ICE-outliners in ClustalW-based Multiple Sequence Alignment. A. Phylogenetic tree; B. Percent amino acid identities and divergences; and C. Multiple Sequence Alignment of CDS6 encoded proteins....”
• Genome-wide Analysis of Mycoplasma hominis for the Identification of Putative Therapeutic Targets
  Parvege, Drug target insights 2014
  • “...Novel 27 MHO_1120 30S ribosomal protein S6 Cytoplasm 0 No (59) 32 No Novel 28 MHO_1280 50S ribosomal protein L35 Cytoplasm 0 No (72) 31 No Novel 29 MHO_1180 Phenylalanyl-trna synthetase subunit beta Cytoplasm 0 Yes (116) 32 No Druggable 30 MHO_0050 DNA polymerase III subunit...”

NCgl1325 50S ribosomal protein L35 from Corynebacterium glutamicum ATCC 13032
cg1564 50S ribosomal protein L35 from Corynebacterium glutamicum ATCC 13032
Aligns to 1:63 / 64 (98.4%), covers 96.8% of TIGR00001, 76.0 bits

• Transcriptome analysis of Corynebacterium glutamicum in the process of recombinant protein expression in bioreactors
  Sun, PloS one 2017
  • “...proteins. Eleven genes encoded ribosomal proteins (NCgl1304, NCgl0538, NCgl1901, NCgl2261, NCgl0518, NCgl0515, NCgl0495, NCgl0487, NCgl0833, NCgl1325, NCgl0488); however, most of them were down-regulated under C . glutamicum EGFP, indicating that the translation process was suppressed with EGFP expression. There were two genes (NCgl0303, NCgl1526) up-regulated in...”
• Functional genomics of pH homeostasis in Corynebacterium glutamicum revealed novel links between pH response, oxidative stress, iron homeostasis and methionine synthesis
  Follmann, BMC genomics 2009
  • “...Ketol-acid reductoisomerase 0 -1.44 -0.91 4.0 3.8 3.9 2.9 3.9 3.3 -0.9 1.7 -0.6 58 cg1564 u rpmI 50S ribosomal protein L35 0 -1.04 -0.31 - -0.8 - 1.6 1.4 2.4 - - - 59 cg1565 u rplT 50S ribosomal protein L20 0 -1.26 -0.29 1.2...”

HP0125 ribosomal protein L35 (rpl35) from Helicobacter pylori 26695
Aligns to 2:63 / 64 (96.9%), covers 98.4% of TIGR00001, 75.9 bits

• Genome-wide survey of mutual homologous recombination in a highly sexual bacterial species
  Yahara, Genome biology and evolution 2012
  • “...19 564 A HP0389 sodF Iron-dependent superoxide dismutase Cellular processes 0.033 0.033 21 642 A HP0125 rpmI 50S ribosomal protein L35 Translation 0.022 0.026 5 195 A HP1196 rpsG 30S ribosomal protein S7 Translation 0.022 0.026 12 468 A HP0651 futB Alpha-(1,3)-fucosyltransferase Cell envelope 0.108 0.058...”

spr0862 50S Ribosomal protein L35 from Streptococcus pneumoniae R6
Aligns to 2:64 / 66 (95.5%), covers 98.4% of TIGR00001, 75.4 bits

• Transcriptional regulation and signature patterns revealed by microarray analyses of Streptococcus pneumoniae R6 challenged with sublethal concentrations of translation inhibitors
  Ng, Journal of bacteriology 2003
  • “...spr0194 spr0196 spr0197 spr0200 spr0201 spr0204 spr0205 spr0555 spr0682 spr0862 spr0863 spr1212 spr1394 1.9 1.4 1.5 1.6 1.6 1.6 1.7 1.8 1.7 1.7 1.9 1.7 1.7 1.6...”

Q3K0C9 Large ribosomal subunit protein bL35 from Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Aligns to 2:64 / 66 (95.5%), covers 98.4% of TIGR00001, 75.2 bits

• Downregulation of Ribosomal Contents and Kinase Activities Is Associated with the Inhibitive Effect on the Growth of Group B Streptococcus Induced by Placental Extracellular Vesicles
  Gao, Biology 2021
  • “...30S ribosomal protein S1, nucleic acid binding A0A6A4TZH8 down 50S ribosomal protein L3, rRNA binding Q3K0C9 down 50S ribosomal protein L35, structural constituent of ribosome Q8DYG1 down 50S ribosomal protein L11, large ribosomal subunit rRNA binding Q8DZZ2 down 30S ribosomal protein S20, rRNA binding R4Z934 down...”

lpp2768 50S ribosomal protein L35 from Legionella pneumophila str. Paris
Aligns to 2:65 / 66 (97.0%), covers 96.8% of TIGR00001, 74.4 bits

• Two small ncRNAs jointly govern virulence and transmission in Legionella pneumophila
  Sahr, Molecular microbiology 2009
  • “...- lpp2828 NADH-quinone oxidoreductase chain I 1.99 - lpp2827 NADH-quinone oxidoreductase chain J 2.42 - lpp2768 50S ribosomal protein L35 3.06 2.88 lpp2689 30S ribosomal subunit protein S2 3.33 1.78 lpp2026 Peptidoglycan-associated lipoprotein precursor 1.79 4.52 lpp1958 Major outer membrane protein 2.16 6.57 lpp1773 Similar to...”

D0R5D2 Large ribosomal subunit protein bL35 from Lactobacillus johnsonii (strain FI9785)
Aligns to 2:64 / 66 (95.5%), covers 98.4% of TIGR00001, 74.3 bits

• Identification of Genes Required for Glucan Exopolysaccharide Production in Lactobacillus johnsonii Suggests a Novel Biosynthesis Mechanism
  Mayer, Applied and environmental microbiology 2020
  • “...aminoacylation D0R3G2 30S ribosomal protein S16 rpsP 5 11 227 0.73 1.66 0.60 X Translation D0R5D2 50S ribosomal protein L35 rpmL 7 8 80 0.69 1.61 0.62 X Translation D0R4W9 ATP synthase subunit b atpF 7 18 42 0.65 1.57 0.64 X ATP biosynthetic process; ion...”

SPy0805 50S ribosomal protein L35 from Streptococcus pyogenes M1 GAS
Aligns to 2:64 / 65 (96.9%), covers 96.8% of TIGR00001, 73.1 bits

• Characterization of the RofA regulon in the pandemic M1_global and emergent M1_UK lineages of Streptococcus pyogenes
  Zhi, Microbial genomics 2023
  • “...protein 1.392 0.003 1.176 0.002 Spy0635 rpmA LSU ribosomal protein L27P 0.710 0.020 0.659 0.037 Spy0805 srtK Nisin biosynthesis sensor protein 0.655 0.011 0.680 0.017 Spy0985 na phnA protein 0.947 0.006 0.894 0.012 Spy1087 na Putative cytosolic protein 1.889 0.005 2.208 <0.001 Spy1089 na Hypothetical protein...”

RL35_RHOPA / Q6NDR5 Large ribosomal subunit protein bL35; 50S ribosomal protein L35; RRP-L35 from Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009) (see paper)
RPA0039 50S ribosomal protein L35 from Rhodopseudomonas palustris CGA009
Aligns to 2:65 / 66 (97.0%), covers 98.4% of TIGR00001, 72.9 bits

• ATP Is a Major Determinant of Phototrophic Bacterial Longevity in Growth Arrest
  Yin, mBio 2023
  • “...an individual gene under light and dark-incubated conditions. From left to right, 50S ribosome: RPA0038, RPA0039, RPA0158, RPA0159, RPA0241, RPA0493, RPA0526, RPA0634, RPA0918, RPA2767, RPA3080, RPA3129, RPA3225, RPA3231, RPA3232, RPA3234, RPA3235, RPA3238, RPA3239, RPA3240, RPA3242, RPA3243, RPA3245, RPA3247-RPA3250, RPA3269, RPA3270, RPA3272, RPA3273, RPA4197, RPA4356; 30S ribosome:...”

5dm63 / Q9RSW6 Crystal structure of the 50s ribosomal subunit from deinococcus radiodurans (see paper)
Aligns to 1:63 / 65 (96.9%), covers 98.4% of TIGR00001, 72.1 bits

• Ligand: rna (5dm63)

RL35_DEIRA / Q9RSW6 Large ribosomal subunit protein bL35; 50S ribosomal protein L35 from Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1) (see 6 papers)
Aligns to 2:64 / 66 (95.5%), covers 98.4% of TIGR00001, 72.1 bits

• function: Binds the 23S rRNA
  subunit: Part of the 50S ribosomal subunit. Contacts proteins L15 and L33.

5myjB7 / A2RMR2 of 70S ribosome from Lactococcus lactis (see paper)
Aligns to 1:63 / 64 (98.4%), covers 96.8% of TIGR00001, 71.9 bits

• Ligand: rna (5myjB7)

ruthe_01785 50S ribosomal protein L35 from Rubellimicrobium thermophilum DSM 16684
Aligns to 2:64 / 66 (95.5%), covers 100.0% of TIGR00001, 70.0 bits

• Genome sequence of the reddish-pigmented Rubellimicrobium thermophilum type strain (DSM 16684(T)), a member of the Roseobacter clade
  Fiebig, Standards in genomic sciences 2013
  • “...[ 45 ]. Several other genes involved in this process were also detected (e.g. ruthe_01784, ruthe_01785 and ruthe_01786). Genome analysis of strain R. thermophilum DSM 16684 T further revealed the presence of several genes encoding proteins associated with the utilization of urease (ruthe_02149 to 02151, ruthe_02153...”

YSS_RS08275 50S ribosomal protein L35 from Campylobacter coli RM4661
CJJ81176_0269 ribosomal protein L35 from Campylobacter jejuni subsp. jejuni 81-176
Aligns to 2:63 / 63 (98.4%), covers 96.8% of TIGR00001, 69.7 bits

• Proteotyping as alternate typing method to differentiate Campylobacter coli clades
  Emele, Scientific reports 2019
  • “...YSS_RS09385 RpsN/S14 ACACGACGACCTGGTTTAGA TCGGTCTTGATGAGCAGTTGA 611 YSS_RS09410 RpmC/L29 GGTCTGCATTCAACCGCTAC GCCAAATTGAAGCAGCTCGT 668 YSS_RS02020 RpmB/L28 CGTCAAGTTCATTATGGCGCT TGGAACAAAATGCCCGTCCA 742 YSS_RS08275 RpmI/L35 GCAAGCAGCATTGATACGCA GCTTGGCTATTTTGCAAAGGATT 715 YSS_RS08510 RpmE/L31 GCAAGGTTTTTCCTGATGCTGT TGGCATACCCGCATCACTC 756 YSS_RS09395 RplX/L24 TCGGAACTCGTATCTTTGGGC CAGGAAAACCTTCACGCACT 578 YSS_RS02035 DUF465 GCTGCTGGGTAAGATTTTGGT TCGTGTAACCCTAGAAGATGGC 584 YSS_RS00440 RpmA/L27 AGTTAGCGTTGGCGATGAGTT AACGAAGATGATATCCCCGCC 783 YSS_RS00790 RpsT/S20 GCTCTTCTTCGAGTTTGGGTT GGTGGATTGGGTGTTATGCT 765 YSS_RS04540...”
• Campylobacter jejuni Virulence Factors Identified by Modulating Their Synthesis on Ribosomes With Altered rRNA Methylation
  Sałamaszyńska-Guz, Frontiers in cellular and infection microbiology 2021
  • “...protein CJJ81176_0922 Flagellin CJJ81176_1339 Cytochrome c553, Cyf CJJ81176_1170 Uncharacterized protein CJJ81176_1458 50S ribosomal protein L35 CJJ81176_0269 Lipoprotein, putative CJJ81176_1045 Acetyltransferase, GNAT family CJJ81176_0985 Flagellin modification protein, PseA CJJ81176_1333 Uncharacterized protein CJJ81176_1104 Anthranilate synthase component I, TrpE CJJ81176_0369 50S ribosomal protein L34 CJJ81176_0984 Basal-body rod modification protein,...”

CLIBASIA_01020 50S ribosomal protein L35 from Candidatus Liberibacter asiaticus str. psy62
Aligns to 2:65 / 67 (95.5%), covers 98.4% of TIGR00001, 69.3 bits

• MESSA: MEta-Server for protein Sequence Analysis
  Cong, BMC biology 2012
  • “...was essential to ensure reliable predictions. In one case, the hypothetical ribosomal protein L35 (locus: CLIBASIA_01020; gi: 254780319) [ 46 ] is predicted to have a signal peptide by three out of four predictors. However, all the closely related proteins and protein families identified by MESSA...”

A8JEP1 50S ribosomal protein L35 from Chlamydomonas reinhardtii
Aligns to 46:108 / 114 (55.3%), covers 96.8% of TIGR00001, 67.7 bits

• Scaling-up and proteomic analysis reveals photosynthetic and metabolic insights toward prolonged H₂ photoproduction in Chlamydomonas hpm91 mutant lacking proton gradient regulation 5 (PGR5)
  Liu, Photosynthesis research 2022
  • “...KEGG pathway Uniprot accession Gene ID Protein name Ratio (Mu0/Wt0) p -value (<0.05) Ribosomal proteins A8JEP1 PRPL35 50S ribosomal protein L35 1.80 3.73E02 A8IQE3 RPL14 Ribosomal protein L14 1.60 2.06E02 A8J9D9 PRPL24 Plastid ribosomal protein L24 1.63 2.23E03 A8JGK1 RPS17 Ribosomal protein S17 3.41 3.43E03 A8HVP2...”

lp_1516 ribosomal protein L35 from Lactobacillus plantarum WCFS1
Aligns to 2:64 / 64 (98.4%), covers 98.4% of TIGR00001, 67.6 bits

• Response of Lactobacillus plantarum WCFS1 to the Gram-Negative Pathogen-Associated Quorum Sensing Molecule N-3-Oxododecanoyl Homoserine Lactone
  Spangler, Frontiers in microbiology 2019
  • “...0.19 RL28_LACPL lp_1624 rpmB 50S ribosomal protein L28 -0.18 0.016 -0.24 0.27 0.27 0.15 RL35_LACPL lp_1516 rpmI 50S ribosomal protein L35 0.046 0.44 -0.33 0.22 0.08 0.15 RL6_LACPL lp_1051 rplF 50S ribosomal protein L6 0.079 0.935 -0.58 2.37 0.62 0.31 RS11_LACPL lp_1061 rpsK 30S ribosomal protein...”

SMc00363 PROBABLE 50S RIBOSOMAL PROTEIN L35 from Sinorhizobium meliloti 1021
Aligns to 2:65 / 67 (95.5%), covers 98.4% of TIGR00001, 66.8 bits

• Antimicrobial nodule-specific cysteine-rich peptides induce membrane depolarization-associated changes in the transcriptome of Sinorhizobium meliloti
  Tiricz, Applied and environmental microbiology 2013
  • “...ribosomes SMc01049 SMc02695 SM_b20995 SMc00323 SMc00335 SMc00363 SMc00364 SMc00485 SMc00565 SMc00567 SMc00568 SMc00704 SMc01152 SMc01283 SMc01286 SMc01287...”
• Sinorhizobium meliloti ExoR and ExoS proteins regulate both succinoglycan and flagellum production
  Yao, Journal of bacteriology 2004
  • “...control genes (sma1118, smb21183, smb21295, smc00323, smc00335, smc00363, smc00646, smc01106, smc02857, smc03859, smc03979, and smc04040), which were printed in...”

ECH_0198 ribosomal protein L35 from Ehrlichia chaffeensis str. Arkansas
Aligns to 2:64 / 66 (95.5%), covers 100.0% of TIGR00001, 66.5 bits

• Ehrlichia chaffeensis transcriptome in mammalian and arthropod hosts reveals differential gene expression and post transcriptional regulation
  Kuriakose, PloS one 2011
  • “...36.Ribosomal protein L20 ECH_0197 2.5, 2.7 37.Ribosomal protein L34 ECH_0440 2.8, 2.5 38.Ribosomal protein L35 ECH_0198 5.7, 5.1 39.Ribosomal protein S13 ECH_0430 2.2, 2.3 40.Ribosomal protein S15 ECH_0727 4.6, 4.0 41.Ribosomal protein S19 ECH_0413 2.2, 2.5 42.Ribosomal protein S6 ECH_0308 2.6, 2.4 43.Ribosomal protein S8 ECH_0423...”

CCNA_01098 LSU ribosomal protein L35P from Caulobacter crescentus NA1000
CC1046 ribosomal protein L35 from Caulobacter crescentus CB15
Aligns to 2:64 / 66 (95.5%), covers 100.0% of TIGR00001, 65.8 bits

• Evolutionary Convergence of Pathway-Specific Enzyme Expression Stoichiometry
  Lalanne, Cell 2018
  • “...from C. crescentus (CCNA_00370 and CCNA_00371) were included, and ribosomal protein L35 from C. crescentus (CCNA_01098) was included. We note that the S12 operon (including EF-G and EF-Tu) displayed in Fig. 2E and S4FH was assembled outside of the current described framework due to the multiple...”
• Comparative genomic evidence for a close relationship between the dimorphic prosthecate bacteria Hyphomonas neptunium and Caulobacter crescentus
  Badger, Journal of bacteriology 2006
  • “...Putative lipoprotein CC0136 CC3602 CC3601 CC1116 CC1485 CC0224 CC1046 CC0241 CC2977 CC1840 CC2493 CC3309 CC3551 CC0356 CC1285 CC1987 CC0948 CC0922 CC0699 CC0636...”
• Use of the Caulobacter crescentus genome sequence to develop a method for systematic genetic mapping
  West, Journal of bacteriology 2002
  • “...(phenylalanyl-tRNA synthetase subunits). Product 2 contained CC1045 and CC1046 (ribosomal subunits L20 and L35). Product 3 contained CC1049 to CC1052. Product 4...”

7nhk7 / A0A1B4XM73 7nhk7 (see paper)
Aligns to 1:63 / 64 (98.4%), covers 96.8% of TIGR00001, 64.2 bits

• Ligand: rna (7nhk7)

IUJ47_RS07500 50S ribosomal protein L35 from Enterococcus faecalis
Aligns to 2:64 / 66 (95.5%), covers 96.8% of TIGR00001, 64.1 bits

• Antibacterial Components and Modes of the Methanol-Phase Extract from Commelina communis Linn
  Liu, Plants (Basel, Switzerland) 2023
  • “...ribosomal protein L29 IUJ47_RS04640 0.195 50S ribosomal protein L36 IUJ47_RS04530 0.201 50S ribosomal protein L4 IUJ47_RS07500 0.222 50S ribosomal protein L35 IUJ47_RS01420 0.226 50S ribosomal protein L33 IUJ47_RS04645 0.229 30S ribosomal protein S13 IUJ47_RS04540 0.233 50S ribosomal protein L2 IUJ47_RS04560 0.233 50S ribosomal protein L16 IUJ47_RS04520...”

GOX0264 LSU ribosomal protein L35P from Gluconobacter oxydans 621H
Aligns to 2:64 / 67 (94.0%), covers 98.4% of TIGR00001, 61.9 bits

• Engineering a tunable bicistronic TetR autoregulation expression system in Gluconobacter oxydans
  Bertucci, PeerJ 2022
  • “...R Kovach et al. 1995 ) pBBR1p264-SP pelB -Streplong pBBR1MCS-2 derivative containing the 5-UTR of gox0264 , an elongated C-terminal Streptag II and the signal sequence of pelB; Kan R ( Zeiser et al. 2014 ) pBBRp452-ST pBBR1MCS-2 ( Kovach et al. 1995 ) derivative containing...”
• On the way toward regulatable expression systems in acetic acid bacteria: target gene expression and use cases
  Fricke, Applied microbiology and biotechnology 2021
  • “...G. oxydans 621H; gfp membrane-bound PQQ-dependent polyol DH; green fluorescent protein P GOX0169 , P GOX0264 , P GOX0452 , P tufB promoter strength analysis and 5-keto- d -gluconate accumulation using combinatorial metabolic engineering strategies in industrial strain G. oxydans ZJU2 Yuan et al. 2016a ga2dh...”
  • “...and treA from E. coli DH5 alkaline phosphatase and trehalase fused to selected SPs P GOX0264 SP screening in G. oxydans and broadening the substrate range of G. oxydans for growth on trehalose Kosciow et al. 2014 sldhAB from G. oxydans WSH-003 membrane-bound PQQ-dependent sorbitol DH...”
• Novel plasmid-free Gluconobacter oxydans strains for production of the natural sweetener 5-ketofructose
  Battling, Microbial cell factories 2020
  • “...(data not shown). We therefore used the gene for a ribosomal protein as reference, namely GOX0264 encoding the ribosomal protein L35. The results obtained for the fdhSCL /GOX0264 mRNA ratios are shown in Fig. 7 , normalized to the mRNA ratio of the plasmid-based strain (5.03),...”
  • “...and GOX0039 This work Plasmids pBBR1p264- fdhSCL -ST pBBR1MCS-2 derivative containing the promoter region of GOX0264 upstream of the fdhSCL genes of G. japonicus NBRC3260 with a C-terminal Strep-tag II-encoding sequence fused to the 3-end of fdhL [ 30 ] pAJ63a Km R , FU S...”
• A tunable L-arabinose-inducible expression plasmid for the acetic acid bacterium Gluconobacter oxydans
  Fricke, Applied microbiology and biotechnology 2020
  • “...Other G. oxydans promoters classified as strong, moderate, and weak are the constitutive promoters P GOX0264 , P GOX0452 , and P GOX0384 from genes encoding ribosomal proteins (Kallnik et al. 2010 ). Expression from moderate P GOX0452 has been used to successfully produce membrane-bound PQQ-dependent...”
  • “...pBBR1MCS-2- araC -P BAD -uidA using reporter gene mNG instead of uidA This work pBBR1MCS-2-P GOX0264 -mNG Derivative of pBBR1MCS-2 carrying reporter gene mNG controlled by the strong constitutive promoter of GOX0264 This work pBBR1MCS-5 Derivative of pBBR1MCS; Gm R Kovach et al. ( 1995 )...”
• Combinatorial metabolic engineering of industrial Gluconobacter oxydans DSM2343 for boosting 5-keto-D-gluconic acid accumulation
  Yuan, BMC biotechnology 2016 (no snippet)

BL1366a 50S ribosomal protein L35 from Bifidobacterium longum NCC2705
Aligns to 2:64 / 64 (98.4%), covers 98.4% of TIGR00001, 59.9 bits

• Genomics of Actinobacteria: tracing the evolutionary history of an ancient phylum
  Ventura, Microbiology and molecular biology reviews : MMBR 2007
  • “...initiation factor If3; PFAM_ID, IF3 BL1366a ....................................RpmI; COG family, ribosomal protein L35; PFAM_ID, Ribosomal_L35p BL1367...”

RB7117 similar to 50S ribosomal protein L35 from Pirellula sp. 1
Aligns to 116:178 / 181 (34.8%), covers 95.2% of TIGR00001, 53.5 bits

• Transcriptional response of the model planctomycete Rhodopirellula baltica SH1(T) to changing environmental conditions
  Wecker, BMC genomics 2009
  • “...- RB7042 91 hypothetical protein 10.4 + RB7116 59 hypothetical protein 11.7 + ribosomal machinery RB7117 181 Ribosomal protein L35 11.4 - RB7557 327 von Willebrand factor type A domain protein 4.9 + RB7646 62 hypothetical protein 10.5 + RB7647 73 hypothetical protein 7.4 + RB7837...”
  • “...genome, 18 genes encoding proteins of the small- and large subunit (RB1233, RB12821, RB12824, RB12839, RB7117, RB7837 - RB7841, RB7849, RB7850, RB7852, RB7854, RB7856, RB7857, RB7859 and RB7899) were repressed. Additionally, a set of genes involved in RNA metabolism, protein synthesis, as well as R. baltica's...”

Or search for genetic data about TIGR00001 in the Fitness Browser