PaperBLAST

Full List of Papers Linked to NP_465159.1

NP_465159 bifunctional acetaldehyde-CoA/alcohol dehydrogenase from Listeria monocytogenes EGD-e
lmo1634 similar to Alcohol-acetaldehyde dehydrogenase from Listeria monocytogenes EGD-e
LM6179_2386 adhesion-mediating acetaldehyde/alcohol dehydrogenase LAP from Listeria monocytogenes 6179

• Functional genomic insights into Floricoccus penangensis ML061-4 isolated from leaf surface of Assam tea
  Rungsirivanich, Scientific reports 2025
  • “...183,518183,732 80 3e-18 WP_002376666 VFG006717 lap Listeria adhesion protein Lap Adherence 1,998,874- 1,998,938 90 3e-12 NP_465159 VFG000077 clpP ATP-dependent Clp protease proteolytic subunit Stress survival 290,069290,161 86 3e-12 NP_465991 VFG001855 htpB Hsp60, 60K heat shock protein HtpB Adherence 1,720,195- 1,720,355 81 3e-12 WP_197535493 VFG001967 glf UDP-galactopyranose...”
• First Report on the Finding of Listeria mnocytogenes ST121 Strain in a Dolphin Brain
  Sévellec, Pathogens (Basel, Switzerland) 2020
  • “...0/0 367 99.62 100.00 NP_464816 (oatA) peptidoglycan O-acetyltransferase lap 1-2601/2601 =============== 0/0 324 99.92 100.00 NP_465159 (lap) Listeria adhesion protein Lap lapB 1-5136/5136 =============== 0/0 329 99.10 100.00 NP_465191 (lapB) Listeria adhesion protein LapB inlC 1-891/891 =============== 0/0 362 99.89 100.00 NP_465311 (inlC) internalin C fbpA...”
• LAP, an alcohol acetaldehyde dehydrogenase enzyme in Listeria, promotes bacterial adhesion to enterocyte-like Caco-2 cells only in pathogenic species.
  Jagadeesan, Microbiology (Reading, England) 2010 (PubMed)
  • GeneRIF: Alcohol acetaldehyde dehydrogenase (lmo1634) promotes bacterial adhesion to enterocyte.
• Addition of lime juice and NaCl to minced seafood may stimulate the expression of Listeria monocytogenes virulence, adhesion, and stress response genes
  Hosseini, Food science & nutrition 2024
  • “...Reverse primer (53) 16s GATGCATAGCCGACCTGAGA CTCCGTCAGACTTTCGTCCA hly TACATTAGTGGAAAGATGG ACATTCAAGCTATTATTTACA Plc CTAGAAGCAGGAATACGGTACA ATTGAGTAATCGTTTCTAAT inlA TGTTACAAGAACCTACGGCACCAACAA TTGGCGCTATATTGGGCATATAAGGTGATG lmo1634 GTTGTTGCCGGCGTTACAC CGCGATAATTGCTTTGAAAAGA lmo1847 GCGTGGATCCGCATGAAT GCATCCGCAGCACTTTGAAT sigB CCAAGAAAATGGCGATCAAGAC CGTTGCATCATATCTTCTAATAGCT 2.6 RNA extraction, purification, and quality control The total RNA of inoculated L . monocytogenes cells (>7 log CFU/g or ml) in...”
• Inactivation of lmo0946 (sif) induces the SOS response and MGEs mobilization and silences the general stress response and virulence program in Listeria monocytogenes
  Ładziak, Frontiers in microbiology 2023
  • “...the mobilome of L. monocytogenes. The most highly down-regulated gene in the lmo0946* mutant was lmo1634 . It encodes the Listeria adhesion protein (LAP), a putative bifunctional acetaldehyde-CoA/alcohol dehydrogenase involved in pyruvate metabolism. Three pyruvate-formate lyase encoding genes were found to be downregulated as well (...”
  • “...inlA and inlB ( Milohanic et al., 2003 ). Additionally, the most highly downregulated gene, lmo1634 , encodes the LAP protein that promotes bacterial translocation across the intestinal epithelial barrier ( Drolia et al., 2018 ). Furthermore, among the highly downregulated genes were arpJ and pplA...”
• Petri-plate, bacteria, and laser optical scattering sensor
  Bhunia, Frontiers in cellular and infection microbiology 2022
  • “...Wiedmann, 2016 ) using Listeria species-specific PCR assays. PCR assay amplified a housekeeping gene ( lmo1634 ) encoding acetaldehyde alcohol dehydrogenase (AdhE), also known as Listeria adhesion protein (LAP) ( Drolia etal., 2018 ). Both PCR and BARDOT were complementary in their abilities to detect Listeria...”
• SecA2 Associates with Translating Ribosomes and Contributes to the Secretion of Potent IFN-β Inducing RNAs
  Teubner, International journal of molecular sciences 2022
  • “...beta subunit Transcription 0.05 0.06 lmo1003 ptsI Phosphoenolpyruvate-protein phosphotransferase Carbohydrate transport and metabolism 0.05 0.06 lmo1634 * lap Aldehyde-alcohol dehydrogenase Energy production and conversion 0.05 0.06 lmo0259 * rpoC DNA-directed RNA polymerase subunit beta Transcription 0.05 0.05 lmo1504 alaS AlaninetRNA ligase Translation 0.04 0.05 lmo2019 ileS...”
• A Whole Genome Sequencing-Based Epidemiological Investigation of a Pregnancy-Related Invasive Listeriosis Case in Central Italy
  Russini, Pathogens (Basel, Switzerland) 2022
  • “...(lmo1821) 5 inlJ (lmo2821) 172 svpA (lmo2185) 10 inlK (lmo1290) 14 tagB (lmo1088) 8 lap (lmo1634) 13 vip (lmo0320) 50 lapB (lmo1666) 11 virR (lmo1745) 4 lgt (lmo2482) 6 virS (lmo1741) 6 * New allele found. pathogens-11-00667-t002_Table 2 Table 2 Food and environmental samples collected for...”
• Alternative σ Factors Regulate Overlapping as Well as Distinct Stress Response and Metabolic Functions in Listeria monocytogenes under Stationary Phase Stress Condition
  Orsi, Pathogens (Basel, Switzerland) 2021
  • “...interactions among alternative factors, but that did not meet our predefined criteria, included LMRG_01332 ( lmo1634 ), which encodes for an alcohol acetaldehyde dehydrogenase known as the Listeria adhesion protein, LAP [ 57 , 58 ]. This gene presented an FC = 54.1 in the mutant...”
  • “...and fine-tuning of the expression of specific pts genes [ 48 ]. Among those genes, lmo1634 encodes the Listeria adhesion protein (LAP), which has been shown to play a role in L. monocytogenes virulence by promoting paracellular translocation of the bacterial pathogen through intestinal epithelial cell...”
• Systematic identification of a panel of strong promoter regions from Listeria monocytogenes for fine-tuning gene expression
  Ji, Microbial cell factories 2021
  • “...promoter regions Gene id Name No. Description Length (bp) TPM (28 C) TPM (37 C) lmo1634 lmo1634 1 Bifunctional acetaldehyde-CoA/alcohol dehydrogenase 501 63189.35 50511.48 lmo2637 lmo2637 2 Hypothetical protein 447 36304.9 46430.03 lmo2459 gap 3 Glyceraldehyde-3-phosphate dehydrogenase 441 33735.74 18075.69 lmo2653 tuf 4 Elongation factor Tu...”
• Anaerobic Growth of Listeria monocytogenes on Rhamnose Is Stimulated by Vitamin B₁₂ and Bacterial Microcompartment-Dependent 1,2-Propanediol Utilization
  Zeng, mSphere 2021
  • “...suggests four putative candidates annotated as alcohol dehydrogenase in L. monocytogenes EGDe, including lmo1166, lmo1171, lmo1634, and lmo1737, detected in the proteomes of both pdu -noninduced and pdu -induced cells (for details see Text S1 in the supplemental material). Since the discovery of the role of...”
• Identification and evaluation of a panel of strong constitutive promoters in Listeria monocytogenes for improving the expression of foreign antigens
  Ma, Applied microbiology and biotechnology 2021
  • “...EGD-e selected by RNA-seq Number Gene Length CDS product FPKM pH 5.5 pH 7.4 1 lmo1634 501 Aldehyde-alcohol dehydrogenase 13,392.83 52,369.24 2 lmo2653 108 Elongation factor Tu 41,554.43 23,758.48 3 lmo2637 447 Hypothetical protein 5134.74 48,137.68 4 lmo2459 441 Glyceraldehyde-3-phosphate dehydrogenase 23,215.88 18,740.49 5 lmo0045 278...”
• The redox-responsive transcriptional regulator Rex represses fermentative metabolism and is required for Listeria monocytogenes pathogenesis
  Halsey, PLoS pathogens 2021
  • “...results. 10.1371/journal.ppat.1009379.t001 Table 1 Rex-repressed genes-of-interest. 10403S EGD-e Gene Function Fold change in rex LMRG_01332 lmo1634 lap bifunctional acetaldehyde-CoA/alcohol dehydrogenase 342.30 LMRG_00859 lmo1407 pflC pyruvate formate-lyase 1-activating enzyme 88.30 LMRG_00858 lmo1406 pflB formate acetyltransferase 59.84 LMRG_00046 lmo0355 frdA fumarate reductase flavoprotein subunit 85.24 LMRG_01064 lmo1917 pflA...”
  • “...This information will give more insight into the impact of Rex. The lap gene (LMRG_01332, lmo1634) found in this study as Rex-dependent (342-fold; Tables 1 and S1) is probably one of most abundant in expression even in WT bacteria. Wurtzel et al (2012) showed its hyperexpression...”
• Transcriptomic and Phenotypic Analyses of the Sigma B-Dependent Characteristics and the Synergism between Sigma B and Sigma L in Listeria monocytogenes EGD-e
  Mattila, Microorganisms 2020
  • “...sigBL compared to the wildtype strain during exponential growth in BHI at 3 C were lmo1634 , which encodes aldehydealcohol dehydrogenase and lmo1847 , which encodes endocarditis specific antigen. Genes that were downregulated during exponential cold growth in sigBL, but not in sigB or sigL [...”
  • “...decarboxylase 3.1 3.4 Energy metabolism lmo0210 Llactate dehydrogenase 3.2 1.3 lmo0913 succinatesemialdehyde dehydrogenase 2.1 1.6 lmo1634 aldehydealcohol dehydrogenase 6.1 1.7 lmo2674 ribose 5phosphate isomerase B 2 1.6 Protein fate lmo1407 pyruvate formatelyase activating enzyme 3.3 1.5 Protein synthesis lmo0250 ribosomal protein L10 2.2 1.3 lmo0251 ribosomal...”
• Receptor-targeted engineered probiotics mitigate lethal Listeria infection
  Drolia, Nature communications 2020
  • “...translocation across the epithelial barrier 31 . LAP is a housekeeping alcohol acetaldehyde dehydrogenase ( lmo1634 ) present in both pathogenic and nonpathogenic Listeria species 36 . However, LAP exhibits virulent attributes only in pathogenic Listeria because of a lack of secretion and surface re-association of...”
• The transcriptome of Listeria monocytogenes during co-cultivation with cheese rind bacteria suggests adaptation by induction of ethanolamine and 1,2-propanediol catabolism pathway genes
  Anast, PloS one 2020
  • “...of L . monocytogenes has yet to be elucidated. The Listeria adhesion protein (LAP, LM6179_2386, Lmo1634), was significantly upregulated in all co-cultivation conditions save for co-cultivation with Brevibacterium S111 for two h in broth and 24 h on plates where very few or no DE genes...”
• Initial Transcriptomic Response and Adaption of Listeria monocytogenes to Desiccation on Food Grade Stainless Steel
  Kragh, Frontiers in microbiology 2019
  • “...(RT-qPCR) amplification of four genes: (1) qoxB which exhibited >fourfold higher expression during desiccation, (2) lmo1634 which consistently exhibited >fourfold lower expression during desiccation, (3) inlH which exhibited >fourfold higher expression during desiccation in Lm 08-5578 , but a non-significant downregulation in Lm 568 at all...”
  • “...The 2 CT method was used to determine the relative expression levels of qoxB , lmo1634 , and inlH , with recJ used as the reference gene ( Livak and Schmittgen, 2001 ). TABLE 1 Primers used for RT-qPCR validation of RNA-seq data. Gene Name Primer...”
• Inhibitory Effect of Thymoquinone on Listeria monocytogenes ATCC 19115 Biofilm Formation and Virulence Attributes Critical for Human Infection
  Miao, Frontiers in cellular and infection microbiology 2019
  • “...showed that trans-cinnamaldehyde, carvacrol, and thymol down-regulated the transcription of genes encoding Listeria adhesion ( lmo1634, lmo1666 , and lmo1847 ) and invasion ( iap and lmo1076 ) proteins, resulting in decreased host-cell adherence and invasion. RT-qPCR analysis conducted in the current study showed that SICs...”
• Transcriptome Sequencing of Listeria monocytogenes Reveals Major Gene Expression Changes in Response to Lactic Acid Stress Exposure but a Less Pronounced Response to Oxidative Stress
  Cortes, Frontiers in microbiology 2019
  • “...Here, we also observe a potential link between Rli47 and the Listeria adhesion protein (LAP, lmo1634 ). LAP is a bifunctional, highly conserved alcohol-acetaldehyde dehydrogenase which is essential in promoting the systemic spread of L. monocytogenes during infection ( Pandiripally et al., 1999 ; Drolia et...”
  • “...hrtAB to resist Heme toxicity and uses heme as a signal to induce Transcription of lmo1634 , encoding Listeria Adhesion protein. Front. Microbiol. 9 : 3090 . 10.3389/fmicb.2018.03090 30619169 Drolia R. Tenguria S. Durkes A. C. Turner J. R. Bhunia A. K. ( 2018 ). Listeria...”
• Lactobacillus casei expressing Internalins A and B reduces Listeria monocytogenes interaction with Caco-2 cells in vitro
  Mathipa, Microbial biotechnology 2019
  • “...; Radoshevich and Cossart, 2018 ). Listeria adhesion protein is an alcohol acetaldehyde dehydrogenase ( lmo1634 ) that promotes adhesion of Listeria during the intestinal infection phase (Pandiripally etal ., 1999 ; Jagadeesan etal ., 2010 ; Bailey etal ., 2017 ). It interacts with the...”
• The σ^B-dependent regulatory sRNA Rli47 represses isoleucine biosynthesis in Listeria monocytogenes through a direct interaction with the ilvA transcript
  Marinho, RNA biology 2019 (secret)
• Listeria monocytogenes Relies on the Heme-Regulated Transporter hrtAB to Resist Heme Toxicity and Uses Heme as a Signal to Induce Transcription of lmo1634, Encoding Listeria Adhesion Protein
  Dos, Frontiers in microbiology 2018
  • “...hrtAB to Resist Heme Toxicity and Uses Heme as a Signal to Induce Transcription of lmo1634 , Encoding Listeria Adhesion Protein dos Santos Patrcia Teixeira Larsen Pernille Tholund Menendez-Gil Pilar Lillebk Eva Maria Sternkopf Kallipolitis Birgitte Haahr * Department of Biochemistry and Molecular Biology, University of...”
  • “...monocytogenes to resist heme toxicity. Curiously, the most highly up-regulated gene upon heme stress was lmo1634 , encoding the Listeria adhesion protein, LAP, which acts to promote the translocation of L. monocytogenes across the intestinal barrier. Additionally, LAP is predicted to act as a bifunctional acetaldehyde-CoA/alcohol...”
• Genome Sequence of Listeria monocytogenes Strain F4244, a 4b Serotype
  Bailey, Genome announcements 2017
  • “...of this pathogenic phenotype across different L.monocytogenes strains influenced by the gene product of locus lmo1634 , an AdhE homolog called the Listeria adhesion protein ( 3 7 ). The genome of L.monocytogenes strain F4244, serotype 4b, isolated from cerebrospinal fluid of a patient and obtained...”
  • “...respectively, all of serotype 1/2a group of lineage II ( 9 ). Analysis of the lmo1634 locus (AdhE or LAP) from F4244 with these genomes demonstrates 99% sequence identity with Clip80459 and F2365 and 97% with EGD-e and EGD. This corresponds to a two-amino-acid substitution in...”
• Sublethal Concentrations of Antibiotics Cause Shift to Anaerobic Metabolism in Listeria monocytogenes and Induce Phenotypes Linked to Antibiotic Tolerance
  Knudsen, Frontiers in microbiology 2016
  • “...anaerobic metabolism and higher ethanol production. A mutant in the bifunctional acetaldehyde-CoA/alcohol dehydrogenase encoded by lmo1634 did not have altered antibiotic tolerance. However, a mutant in lmo1179 ( eutE ) encoding an aldehyde oxidoreductase where rerouting caused increased ethanol production was tolerant to three of four...”
  • “...characteristics Source or reference Listeria strains EGD L. monocytogenes virulent wild-type, MLST ST35 W. Goebel lmo1634 Inframe deletion of lmo1634 This study lmo1179 Inframe deletion of lmo1179 This study lmo1634/ lmo1179 Inframe deletion of lmo1634 and lmo1179 This study lmaDCBA Inframe deletion of lmaDCBA This study...”
• Comparison of Surface Proteomes of Adherence Variants of Listeria Monocytogenes Using LC-MS/MS for Identification of Potential Surface Adhesins
  Tiong, Pathogens (Basel, Switzerland) 2016
  • “...factor) [ 64 ], main glycolytic pathways (lmo2455, enolase) [ 65 ], and specific pathways (lmo1634, alcohol acetaldehyde dehydrogenase) [ 66 ]. Burkholder et al. [ 67 ] reported a surface localization pathway ( i.e. , SecA2) used by Listeria cells to localize lmo1634 on the...”
  • “...identified that a database has been established [ 68 ]. In our study, both the lmo1634 and lmo2653 gene products were detected in all cell surface extracts (planktonic and sessile) with the total spectrum count ratio of planktonic extracts 99-38/CW35 <2-fold. Other main glycolytic pathway proteins,...”
• Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food
  Kim, Sensors (Basel, Switzerland) 2015
  • “...study was to develop the Listeria species-specific PCR assays based on a house-keeping gene ( lmo1634 ) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology)....”
  • “...in prokaryotes plays an important role in pathogenesis [ 5 , 6 ]. The Aad (Lmo1634) is also known as Listeria adhesion protein (LAP) and its homolog is present in all species of Listeria sensu stricto ( i.e. , in the narrow or strict sense) also...”
• Two-dimensional fluorescence difference gel electrophoresis analysis of Listeria monocytogenes submitted to a redox shock
  Ignatova, Journal of proteomics 2013 (PubMed)
  • “...protein synthesis), detoxification (kat) or adhesion (Lmo1634). 0 false false Proteomics Two-dimensional fluorescence difference gel electrophoresis (2D-DIGE)...”
  • “...downregulated following exposure to both LIRP and HIRP 3 lmo1634 67.7 6.3 lmo1634 Aldehyde-alcohol dehydrogenase 1.9 10 6 12.6 3.5 4.3 10 4 9.5 4.0 10 5...”
• The transcriptome of Listeria monocytogenes during co-cultivation with cheese rind bacteria suggests adaptation by induction of ethanolamine and 1,2-propanediol catabolism pathway genes
  Anast, PloS one 2020
  • “...life-cycle of L . monocytogenes has yet to be elucidated. The Listeria adhesion protein (LAP, LM6179_2386, Lmo1634), was significantly upregulated in all co-cultivation conditions save for co-cultivation with Brevibacterium S111 for two h in broth and 24 h on plates where very few or no DE...”

New Search

Statistics

How It Works

PaperBLAST builds a database of protein sequences that are linked to scientific articles. These links come from automated text searches against the articles in EuropePMC and from manually-curated information from GeneRIF, UniProtKB/Swiss-Prot, BRENDA, CAZy (as made available by dbCAN), BioLiP, CharProtDB, MetaCyc, EcoCyc, TCDB, REBASE, the Fitness Browser, and a subset of the European Nucleotide Archive with the /experiment tag. Given this database and a protein sequence query, PaperBLAST uses protein-protein BLAST to find similar sequences with E < 0.001.

To build the database, we query EuropePMC with locus tags, with RefSeq protein identifiers, and with UniProt accessions. We obtain the locus tags from RefSeq or from MicrobesOnline. We use queries of the form "locus_tag AND genus_name" to try to ensure that the paper is actually discussing that gene. Because EuropePMC indexes most recent biomedical papers, even if they are not open access, some of the links may be to papers that you cannot read or that our computers cannot read. We query each of these identifiers that appears in the open access part of EuropePMC, as well as every locus tag that appears in the 500 most-referenced genomes, so that a gene may appear in the PaperBLAST results even though none of the papers that mention it are open access. We also incorporate text-mined links from EuropePMC that link open access articles to UniProt or RefSeq identifiers. (This yields some additional links because EuropePMC uses different heuristics for their text mining than we do.)

For every article that mentions a locus tag, a RefSeq protein identifier, or a UniProt accession, we try to select one or two snippets of text that refer to the protein. If we cannot get access to the full text, we try to select a snippet from the abstract, but unfortunately, unique identifiers such as locus tags are rarely provided in abstracts.

PaperBLAST also incorporates manually-curated protein functions:

• Proteins from NCBI's RefSeq are included if a GeneRIF entry links the gene to an article in PubMed^®. GeneRIF also provides a short summary of the article's claim about the protein, which is shown instead of a snippet.
• Proteins from Swiss-Prot (the curated part of UniProt) are included if the curators identified experimental evidence for the protein's function (evidence code ECO:0000269). For these proteins, the fields of the Swiss-Prot entry that describe the protein's function are shown (with bold headings).
• Proteins from BRENDA, a curated database of enzymes, are included if they are linked to a paper in PubMed and their full sequence is known.
• Every protein from the non-redundant subset of BioLiP, a database of ligand-binding sites and catalytic residues in protein structures, is included. Since BioLiP itself does not include descriptions of the proteins, those are taken from the Protein Data Bank. Descriptions from PDB rely on the original submitter of the structure and cannot be updated by others, so they may be less reliable. (For SitesBLAST and Sites on a Tree, we use a larger subset of BioLiP so that every ligand is represented among a group of structures with similar sequences, but for PaperBLAST, we use the non-redundant set provided by BioLiP.)
• Every protein from EcoCyc, a curated database of the proteins in Escherichia coli K-12, is included, regardless of whether they are characterized or not.
• Proteins from the MetaCyc metabolic pathway database are included if they are linked to a paper in PubMed and their full sequence is known.
• Proteins from the Transport Classification Database (TCDB) are included if they have known substrate(s), have reference(s), and are not described as uncharacterized or putative. (Some of the references are not visible on the PaperBLAST web site.)
• Every protein from CharProtDB, a database of experimentally characterized protein annotations, is included.
• Proteins from the CAZy database of carbohydrate-active enzymes are included if they are associated with an Enzyme Classification number. Even though CAZy does not provide links from individual protein sequences to papers, these should all be experimentally-characterized proteins.
• Proteins from the REBASE database of restriction enzymes are included if they have known specificity.
• Every protein with an evidence-based reannotation (based on mutant phenotypes) in the Fitness Browser is included.
• Sequence-specific transcription factors (including sigma factors and DNA-binding response regulators) with experimentally-determined DNA binding sites from the PRODORIC database of gene regulation in prokaryotes.
• Putative transcription factors from RegPrecise that have manually-curated predictions for their binding sites. These predictions are based on conserved putative regulatory sites across genomes that contain similar transcription factors, so PaperBLAST clusters the TFs at 70% identity and retains just one member of each cluster.
• Coding sequence (CDS) features from the European Nucleotide Archive (ENA) are included if the /experiment tag is set (implying that there is experimental evidence for the annotation), the nucleotide entry links to paper(s) in PubMed, and the nucleotide entry is from the STD data class (implying that these are targeted annotated sequences, not from shotgun sequencing). Also, to filter out genes whose transcription or translation was detected, but whose function was not studied, nucleotide entries or papers with more than 25 such proteins are excluded. Descriptions from ENA rely on the original submitter of the sequence and cannot be updated by others, so they may be less reliable.

Except for GeneRIF and ENA, the curated entries include a short curated description of the protein's function. For entries from BioLiP, the protein's function may not be known beyond binding to the ligand. Many of these entries also link to articles in PubMed.

For more information see the PaperBLAST paper (mSystems 2017) or the code. You can download PaperBLAST's database here.

Changes to PaperBLAST since the paper was written:

• November 2023: incorporated PRODORIC and RegPrecise. Many PRODORIC entries were not linked to a protein sequence (no UniProt identifier), so we added this information.
• February 2023: BioLiP changed their download format. PaperBLAST now includes their non-redundant subset. SitesBLAST and Sites on a Tree use a larger non-redundant subset that ensures that every ligand is represented within each cluster. This should ensure that every binding site is represented.
• June 2022: incorporated some coding sequences from ENA with the /experiment tag.
• March 2022: incorporated BioLiP.
• April 2020: incorporated TCDB.
• April 2019: EuropePMC now returns table entries in their search results. This has expanded PaperBLAST's database, but most of the new entries are of low relevance, and the resulting snippets are often just lists of locus tags with annotations.
• February 2018: the alignment page reports the conservation of the hit's functional sites (if available from from Swiss-Prot or UniProt)
• January 2018: incorporated BRENDA.
• December 2017: incorporated MetaCyc, CharProtDB, CAZy, REBASE, and the reannotations from the Fitness Browser.
• September 2017: EuropePMC no longer returns some table entries in their search results. This has shrunk PaperBLAST's database, but has also reduced the number of low-relevance hits.

Many of these changes are described in Interactive tools for functional annotation of bacterial genomes.

Secrets

PaperBLAST cannot provide snippets for many of the papers that are published in non-open-access journals. This limitation applies even if the paper is marked as "free" on the publisher's web site and is available in PubmedCentral or EuropePMC. If a journal that you publish in is marked as "secret," please consider publishing elsewhere.

Omissions from the PaperBLAST Database

Many important articles are missing from PaperBLAST, either because the article's full text is not in EuropePMC (as for many older articles), or because the paper does not mention a protein identifier such as a locus tag, or because of PaperBLAST's heuristics. If you notice an article that characterizes a protein's function but is missing from PaperBLAST, please notify the curators at UniProt or add an entry to GeneRIF. Entries in either of these databases will eventually be incorporated into PaperBLAST. Note that to add an entry to UniProt, you will need to find the UniProt identifier for the protein. If the protein is not already in UniProt, you can ask them to create an entry. To add an entry to GeneRIF, you will need an NCBI Gene identifier, but unfortunately many prokaryotic proteins in RefSeq do not have corresponding Gene identifers.

References

PaperBLAST: Text-mining papers for information about homologs.
M. N. Price and A. P. Arkin (2017). mSystems, 10.1128/mSystems.00039-17.

Europe PMC in 2017.
M. Levchenko et al (2017). Nucleic Acids Research, 10.1093/nar/gkx1005.

Gene indexing: characterization and analysis of NLM's GeneRIFs.
J. A. Mitchell et al (2003). AMIA Annu Symp Proc 2003:460-464.

UniProt: the universal protein knowledgebase.
The UniProt Consortium (2016). Nucleic Acids Research, 10.1093/nar/gkw1099.

BRENDA in 2017: new perspectives and new tools in BRENDA.
S. Placzek et al (2017). Nucleic Acids Research, 10.1093/nar/gkw952.

The EcoCyc database: reflecting new knowledge about Escherichia coli K-12.
I. M. Keeseler et al (2016). Nucleic Acids Research, 10.1093/nar/gkw1003.

The MetaCyc database of metabolic pathways and enzymes.
R. Caspi et al (2018). Nucleic Acids Research, 10.1093/nar/gkx935.

CharProtDB: a database of experimentally characterized protein annotations.
R. Madupu et al (2012). Nucleic Acids Research, 10.1093/nar/gkr1133.

The carbohydrate-active enzymes database (CAZy) in 2013.
V. Lombard et al (2014). Nucleic Acids Research, 10.1093/nar/gkt1178.

The Transporter Classification Database (TCDB): recent advances
M. H. Saier, Jr. et al (2016). Nucleic Acids Research, 10.1093/nar/gkv1103.

REBASE - a database for DNA restriction and modification: enzymes, genes and genomes.
R. J. Roberts et al (2015). Nucleic Acids Research, 10.1093/nar/gku1046.

Deep annotation of protein function across diverse bacteria from mutant phenotypes.
M. N. Price et al (2016). bioRxiv, 10.1101/072470.