PaperBLAST

Full List of Papers Linked to VIMSS10084193

PTR16_ARATH / Q93VV5 Protein NRT1/ PTR FAMILY 4.3; AtNPF4.3; Nitrate transporter 1.14 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AT1G59740 proton-dependent oligopeptide transport (POT) family protein from Arabidopsis thaliana

• Natural variation in root exudate composition in the genetically structured Arabidopsis thaliana in the Iberian Peninsula
  Subrahmaniam, The New phytologist 2025
  • “...GXM3 Metabolism Fatty acids 1 N.V1092 1 17345313 AT1G47317 Stress Alkaloids 2 N.V831 1 21976138 AT1G59740 NPF4.3 Nutrient Alkaloids 2 N.V831 1 21976138 AT1G59740 ARF1 Signaling Amino acids 1 N.V313* 1 22280140 AT1G60470 GOLS4 Stress Carbohydrates 1 N.V554 1 22319649 AT1G60600 ABC4 Nutrient Amino acid 2...”
• BPB1 regulates rice (Oryza sative L.) panicle length and panicle branch development by promoting lignin and inhibiting cellulose accumulation
  Li, Molecular breeding : new strategies in plant improvement 2023
  • “...13 41 Page 10 of 17 Arabidopsis homologous gene At1g59740 (NRT1/ PTR FAMILY 4.3), and At1g33440 (NRT1/ PTR FAMILY 4.4) clustered into the same clade (Fig. 5c;...”
  • “...showed that BPB1 was highly homologous to Os04g0441800, At1g59740, and At1g33440, especially the PTR2 domain region (Fig. S5c). The mutations in BPB1 (403 aa)...”
• Analysis of the impact of indole-3-acetic acid (IAA) on gene expression during leaf senescence in Arabidopsis thaliana
  Gören-Sağlam, Physiology and molecular biology of plants : an international journal of functional plant biology 2020
  • “...1 At3g52340 SUCROSE-PHOSPHATASE 2 (SPP2) 2 2 At4g18250 At1g59740 Receptor Serine/Threonine kinase-like protein NRT1/PTR FAMILY 4.3 2 2 2 2 At5g65920 ARM repeat...”
• Partial Activation of SA- and JA-Defensive Pathways in Strawberry upon Colletotrichum acutatum Interaction
  Amil-Ruiz, Frontiers in plant science 2016
  • “...AT2G38470 WRKY DNA-binding protein 33 Transcription factor, JA pathway 2.41 (3.58 1.52) 7.93E-03 M14B5 gene29081 AT1G59740 Peptide transporter PTR Protein secretion 2.39 7.93E-03 M5B8 gene24582 AT5G22950 Vacuolar protein sorting-associated protein 24 Protein secretion 2.22 7.93E-03 M12E12 * # gene21365 AT3G56400 WRKY DNA-binding protein 70 Transcription factor,...”
• Transcriptional programs regulated by both LEAFY and APETALA1 at the time of flower formation
  Winter, Physiologia plantarum 2015
  • “...AP1 direct high-confidence targets, three showed abnormal expression upon the shift to inductive photoperiod. OPT (At1g59740) is very strongly downregulated by photoperiod and is dependent on LFY and AP1 for this response. Three other transporters of this family were among the 196 LFY/AP1 targets: AT1g22540, AT1g52190...”
• Pre-symptomatic transcriptome changes during cold storage of chilling sensitive and resistant peach cultivars to elucidate chilling injury mechanisms
  Pons, BMC genomics 2015
  • “...NRT1-2 AT1G18880 NRT1.9 Oligopepetide transport PPN005F03 Oligopeptide transporter 7 AT4G10770 OPT7 PPN064F08 POT family, putative AT1G59740 NRT1/NPF4.3 Unknown transporter PPN066F09 Putative integral membrane protein AT5G19980 GONST4 Sugar partioning and homeostasis Is probably involved in the provision of GDP- sugars into the Golgi for CW polysaccharide synthesis...”
• Apomictic and sexual germline development differ with respect to cell cycle, transcriptional, hormonal and epigenetic regulation
  Schmidt, PLoS genetics 2014
  • “...; (HJ) AT1G76580, Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein), an oligopeptide transporter (AT1G59740, Figure 3 K,L ), and a HIGH MOBILITY GROUP A protein (HMGA, AT1G14900, Figure 3 MO ). The probes were designed to have significant sequence homologies only to the respective...”
  • “...AT1G76580 a Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein (HJ), an oligopeptide transporter, AT1G59740 (K,L), and AT1G14900, encoding the HIGH MOBILITY GROUP A protein. Gene expression and gene ontology enrichment analysis uncovers upregulation of spermidine metabolism in the apomictic initial cell Between sexual and...”
• In silico mining of microsatellites in coding sequences of the date palm (Arecaceae) genome, characterization, and transferability
  Aberlenc-Bertossi, Applications in plant sciences 2014
  • “...thaliana R: GTCCCAGCATGATTGCAGTA mPdIRD22 F: GGCTGTATGGGAAAGACCTG (GAA) 6 231271 PDK_20s1726541 2878 2895 Probable peptide/nitrate transporter At1g59740 4.00E-40 Arabidopsis thaliana R: CCTGCTGCATATTCTTCGTG mPdIRD24 F: GCTCCTGCAGAACCTGAAAC (AAG) 6 184 PDK_20s1762671 5194 5211 Probable nucleolar protein 5-1 2.00E-46 Arabidopsis thaliana R: GGACATCACCGTCCAATTCT mPdIRD25 F: CACTGGAAATTCAGGGCCTA (AGG) 6 193205 PDK_20s1831761...”
• Shoot chloride exclusion and salt tolerance in grapevine is associated with differential ion transporter expression in roots
  Henderson, BMC plant biology 2014
  • “...Nitrate transporter 2.7 NG2_12101_30038 VIT_03s0097g00510 GSVIVT01038513001 AT5G64410 0.87 1.65E-06 Oligopeptide transporter OPT4 NG12_21396_16431 VIT_12s0035g01820 GSVIVT01023146001 AT1G59740 0.52 2.47E-05 Proton-dependent oligopeptide transport (POT) family protein NG11_4749_12704 VIT_17s0000g05550 GSVIVT01008072001 AT3G47960 0.54 1.88E-04 Glucosinolate transporter 1 (GTR1) NG11_7897_10153 VIT_14s0066g02020 GSVIVT01032550001 AT5G14940 0.64 3.31E-07 Proton-dependent oligopeptide transport (POT) family protein...”
• Response to long-term NaHCO3-derived alkalinity in model Lotus japonicus Ecotypes Gifu B-129 and Miyakojima MG-20: transcriptomic profiling and physiological characterization
  Babuin, PloS one 2014
  • “...induced of these transcripts in MG-20 (chr4.cm0046.61_at; 4,3-fold) is similar to an Arabidopsis nitrate transporter (AT1G59740) which functions in nitrate removal from xylem sap [58] . These results suggest a better nitrate assimilation in MG-20 compared to Gifu B-129, which is in line with the fact...”
• Expression profiling of tomato pre-abscission pedicels provides insights into abscission zone properties including competence to respond to abscission signals
  Nakano, BMC plant biology 2013
  • “...membrane protein, putative / sugar transporter family protein 3.8 0.014 4.1 0.016 Solyc01g103030 A_96_P114407 AK325211 AT1G59740 proton-dependent oligopeptide transport (POT) family protein 1.9 0.023 2.0 0.034 Solyc10g084950 a A_96_P231269 DB697130 AT2G37900 proton-dependent oligopeptide transport (POT) family protein 2.6 0.005 2.5 0.026 Solyc07g063930 A_96_P137262 AI778966 AT3G20660 AtOCT4...”
• Genome-wide analysis of the auxin-responsive transcriptome downstream of iaa1 and its expression analysis reveal the diversity and complexity of auxin-regulated gene expression
  Lee, Journal of experimental botany 2009
  • “...0.312 1 1 At1g58340 256024_at MATE efflux protein-related (ZF14) 3.6 0.022 2.4 0.047 2 0 At1g59740 262912_at Proton-dependent oligopeptide transport protein 3.5 0.005 2.8 0.160 0 4 At2g21050 264025_at Amino acid permease 3.2 0.022 2.9 0.126 2 0 At5g27000 246802_at Kinesin 4 (ATK4) 2.7 0.040 1.7...”

New Search

Statistics

How It Works

PaperBLAST builds a database of protein sequences that are linked to scientific articles. These links come from automated text searches against the articles in EuropePMC and from manually-curated information from GeneRIF, UniProtKB/Swiss-Prot, BRENDA, CAZy (as made available by dbCAN), BioLiP, CharProtDB, MetaCyc, EcoCyc, TCDB, REBASE, the Fitness Browser, and a subset of the European Nucleotide Archive with the /experiment tag. Given this database and a protein sequence query, PaperBLAST uses protein-protein BLAST to find similar sequences with E < 0.001.

To build the database, we query EuropePMC with locus tags, with RefSeq protein identifiers, and with UniProt accessions. We obtain the locus tags from RefSeq or from MicrobesOnline. We use queries of the form "locus_tag AND genus_name" to try to ensure that the paper is actually discussing that gene. Because EuropePMC indexes most recent biomedical papers, even if they are not open access, some of the links may be to papers that you cannot read or that our computers cannot read. We query each of these identifiers that appears in the open access part of EuropePMC, as well as every locus tag that appears in the 500 most-referenced genomes, so that a gene may appear in the PaperBLAST results even though none of the papers that mention it are open access. We also incorporate text-mined links from EuropePMC that link open access articles to UniProt or RefSeq identifiers. (This yields some additional links because EuropePMC uses different heuristics for their text mining than we do.)

For every article that mentions a locus tag, a RefSeq protein identifier, or a UniProt accession, we try to select one or two snippets of text that refer to the protein. If we cannot get access to the full text, we try to select a snippet from the abstract, but unfortunately, unique identifiers such as locus tags are rarely provided in abstracts.

PaperBLAST also incorporates manually-curated protein functions:

• Proteins from NCBI's RefSeq are included if a GeneRIF entry links the gene to an article in PubMed^®. GeneRIF also provides a short summary of the article's claim about the protein, which is shown instead of a snippet.
• Proteins from Swiss-Prot (the curated part of UniProt) are included if the curators identified experimental evidence for the protein's function (evidence code ECO:0000269). For these proteins, the fields of the Swiss-Prot entry that describe the protein's function are shown (with bold headings).
• Proteins from BRENDA, a curated database of enzymes, are included if they are linked to a paper in PubMed and their full sequence is known.
• Every protein from the non-redundant subset of BioLiP, a database of ligand-binding sites and catalytic residues in protein structures, is included. Since BioLiP itself does not include descriptions of the proteins, those are taken from the Protein Data Bank. Descriptions from PDB rely on the original submitter of the structure and cannot be updated by others, so they may be less reliable. (For SitesBLAST and Sites on a Tree, we use a larger subset of BioLiP so that every ligand is represented among a group of structures with similar sequences, but for PaperBLAST, we use the non-redundant set provided by BioLiP.)
• Every protein from EcoCyc, a curated database of the proteins in Escherichia coli K-12, is included, regardless of whether they are characterized or not.
• Proteins from the MetaCyc metabolic pathway database are included if they are linked to a paper in PubMed and their full sequence is known.
• Proteins from the Transport Classification Database (TCDB) are included if they have known substrate(s), have reference(s), and are not described as uncharacterized or putative. (Some of the references are not visible on the PaperBLAST web site.)
• Every protein from CharProtDB, a database of experimentally characterized protein annotations, is included.
• Proteins from the CAZy database of carbohydrate-active enzymes are included if they are associated with an Enzyme Classification number. Even though CAZy does not provide links from individual protein sequences to papers, these should all be experimentally-characterized proteins.
• Proteins from the REBASE database of restriction enzymes are included if they have known specificity.
• Every protein with an evidence-based reannotation (based on mutant phenotypes) in the Fitness Browser is included.
• Sequence-specific transcription factors (including sigma factors and DNA-binding response regulators) with experimentally-determined DNA binding sites from the PRODORIC database of gene regulation in prokaryotes.
• Putative transcription factors from RegPrecise that have manually-curated predictions for their binding sites. These predictions are based on conserved putative regulatory sites across genomes that contain similar transcription factors, so PaperBLAST clusters the TFs at 70% identity and retains just one member of each cluster.
• Coding sequence (CDS) features from the European Nucleotide Archive (ENA) are included if the /experiment tag is set (implying that there is experimental evidence for the annotation), the nucleotide entry links to paper(s) in PubMed, and the nucleotide entry is from the STD data class (implying that these are targeted annotated sequences, not from shotgun sequencing). Also, to filter out genes whose transcription or translation was detected, but whose function was not studied, nucleotide entries or papers with more than 25 such proteins are excluded. Descriptions from ENA rely on the original submitter of the sequence and cannot be updated by others, so they may be less reliable.

Except for GeneRIF and ENA, the curated entries include a short curated description of the protein's function. For entries from BioLiP, the protein's function may not be known beyond binding to the ligand. Many of these entries also link to articles in PubMed.

For more information see the PaperBLAST paper (mSystems 2017) or the code. You can download PaperBLAST's database here.

Changes to PaperBLAST since the paper was written:

• November 2023: incorporated PRODORIC and RegPrecise. Many PRODORIC entries were not linked to a protein sequence (no UniProt identifier), so we added this information.
• February 2023: BioLiP changed their download format. PaperBLAST now includes their non-redundant subset. SitesBLAST and Sites on a Tree use a larger non-redundant subset that ensures that every ligand is represented within each cluster. This should ensure that every binding site is represented.
• June 2022: incorporated some coding sequences from ENA with the /experiment tag.
• March 2022: incorporated BioLiP.
• April 2020: incorporated TCDB.
• April 2019: EuropePMC now returns table entries in their search results. This has expanded PaperBLAST's database, but most of the new entries are of low relevance, and the resulting snippets are often just lists of locus tags with annotations.
• February 2018: the alignment page reports the conservation of the hit's functional sites (if available from from Swiss-Prot or UniProt)
• January 2018: incorporated BRENDA.
• December 2017: incorporated MetaCyc, CharProtDB, CAZy, REBASE, and the reannotations from the Fitness Browser.
• September 2017: EuropePMC no longer returns some table entries in their search results. This has shrunk PaperBLAST's database, but has also reduced the number of low-relevance hits.

Many of these changes are described in Interactive tools for functional annotation of bacterial genomes.

Secrets

PaperBLAST cannot provide snippets for many of the papers that are published in non-open-access journals. This limitation applies even if the paper is marked as "free" on the publisher's web site and is available in PubmedCentral or EuropePMC. If a journal that you publish in is marked as "secret," please consider publishing elsewhere.

Omissions from the PaperBLAST Database

Many important articles are missing from PaperBLAST, either because the article's full text is not in EuropePMC (as for many older articles), or because the paper does not mention a protein identifier such as a locus tag, or because of PaperBLAST's heuristics. If you notice an article that characterizes a protein's function but is missing from PaperBLAST, please notify the curators at UniProt or add an entry to GeneRIF. Entries in either of these databases will eventually be incorporated into PaperBLAST. Note that to add an entry to UniProt, you will need to find the UniProt identifier for the protein. If the protein is not already in UniProt, you can ask them to create an entry. To add an entry to GeneRIF, you will need an NCBI Gene identifier, but unfortunately many prokaryotic proteins in RefSeq do not have corresponding Gene identifers.

References

PaperBLAST: Text-mining papers for information about homologs.
M. N. Price and A. P. Arkin (2017). mSystems, 10.1128/mSystems.00039-17.

Europe PMC in 2017.
M. Levchenko et al (2017). Nucleic Acids Research, 10.1093/nar/gkx1005.

Gene indexing: characterization and analysis of NLM's GeneRIFs.
J. A. Mitchell et al (2003). AMIA Annu Symp Proc 2003:460-464.

UniProt: the universal protein knowledgebase.
The UniProt Consortium (2016). Nucleic Acids Research, 10.1093/nar/gkw1099.

BRENDA in 2017: new perspectives and new tools in BRENDA.
S. Placzek et al (2017). Nucleic Acids Research, 10.1093/nar/gkw952.

The EcoCyc database: reflecting new knowledge about Escherichia coli K-12.
I. M. Keeseler et al (2016). Nucleic Acids Research, 10.1093/nar/gkw1003.

The MetaCyc database of metabolic pathways and enzymes.
R. Caspi et al (2018). Nucleic Acids Research, 10.1093/nar/gkx935.

CharProtDB: a database of experimentally characterized protein annotations.
R. Madupu et al (2012). Nucleic Acids Research, 10.1093/nar/gkr1133.

The carbohydrate-active enzymes database (CAZy) in 2013.
V. Lombard et al (2014). Nucleic Acids Research, 10.1093/nar/gkt1178.

The Transporter Classification Database (TCDB): recent advances
M. H. Saier, Jr. et al (2016). Nucleic Acids Research, 10.1093/nar/gkv1103.

REBASE - a database for DNA restriction and modification: enzymes, genes and genomes.
R. J. Roberts et al (2015). Nucleic Acids Research, 10.1093/nar/gku1046.

Deep annotation of protein function across diverse bacteria from mutant phenotypes.
M. N. Price et al (2016). bioRxiv, 10.1101/072470.