PaperBLAST

PaperBLAST – Find papers about a protein or its homologs

PaperBLAST

PaperBLAST Hits for BRENDA::Q8P8J6 acetylglutamate kinase (EC 2.7.2.8) (Xanthomonas campestris) (426 a.a., MASAKEISQY...)

Other sequence analysis tools:

Find functional residues: SitesBLAST

Search for conserved domains

Find the best match in UniProt

Compare to protein structures

Predict transmenbrane helices: Phobius

Predict protein localization: PSORTb

Find homologs in fast.genomics

Fitness BLAST: loading...

Show query sequence

Found 163 similar proteins in the literature:

A0A0H2X8L7 acetylglutamate kinase (EC 2.7.2.8) from Xanthomonas campestris (see paper)
100% identity, 95% coverage

Q8P8J6 acetylglutamate kinase (EC 2.7.2.8) from Xanthomonas campestris (see 2 papers)
100% identity, 100% coverage

E2P69_RS08790 acetylglutamate kinase from Xanthomonas perforans
96% identity, 95% coverage

Transcriptome profiling of type VI secretion system core gene tssM mutant of Xanthomonas perforans highlights regulators controlling diverse functions ranging from virulence to metabolism
Ramamoorthy, Microbiology spectrum 2024
- “...De novo synthesis of histidine plays an essential role in cellular metabolism. Similarly, five genes (E2P69_RS08790, E2P69_RS08775, E2P69_RS08795, E2P69_RS08780, and E2P69_RS21025) associated with the arginine biosynthesis pathway were significantly upregulated in the mutant strain at 16 hours. Arginine biosynthesis was considered a virulence trait as demonstrated...”

WP_010893520 acetylglutamate kinase from Xylella fastidiosa 9a5c
81% identity, 97% coverage

Structures of the N-acetyltransferase domain of Xylella fastidiosa N-acetyl-L-glutamate synthase/kinase with and without a His tag bound to N-acetyl-L-glutamate.
Zhao, Acta crystallographica. Section F, Structural biology communications 2015
- GeneRIF: The dimeric structure of the X. fastidiosa N-acetytransferase (xfNAT) domain is very similar to that of human N-acetyltransferase (hNAT0.

Q87EL2 amino-acid N-acetyltransferase (EC 2.3.1.1) from Xylella fastidiosa (see paper)
80% identity, 100% coverage

ABZR86_RS08705 N-acetylglutamate synthase; N-acetylglutamate kinase (EC 2.3.1.1; EC 2.7.2.8) from Dyella japonica UNC79MFTsu3.2
79% identity, 100% coverage

mutant phenotype: Important for fitness in most defined media, except when arginine is provided. Contains both acetylglutamate kinase (TIGR00761) and N-acetylglutamate synthase (PF04768) domains.

AZL_c01370 N-acetyl-gamma-glutamyl-phosphate reductase from Azospirillum sp. B510
67% identity, 95% coverage

The N-Acetylglutamate Synthase Family: Structures, Function and Mechanisms
Shi, International journal of molecular sciences 2015
- “...be the vestiges during this evolution. In the Azospirillum sp. B510 genome, the NAGS gene (AZL_c01370 is incorrectly annotated as argC , since argC encodes N -acetyl--glutamyl-phosphate reductase), which has close sequence similarity with human (41.8%) and xcNAGS/K (76.7%), has lost its NAGK activity as a...”

Hoch_4300 N-acetyl-gamma-glutamyl-phosphate reductase from Haliangium ochraceum DSM 14365
55% identity, 51% coverage

The N-Acetylglutamate Synthase Family: Structures, Function and Mechanisms
Shi, International journal of molecular sciences 2015
- “...for NAGS appears fused to the argC gene for N -acetyl--glutamyl-phosphate reductase. Thus, this gene (Hoch_4300, incorrectly annotated as argC only) resembles the yeast gene encoding NAGK and N -acetyl--glutamyl-phosphate reductase. Whether this protein in H. ochraceum undergoes proteolytic processing to cleave the argC domain as...”

Q0ASS9 amino-acid N-acetyltransferase (EC 2.3.1.1); acetylglutamate kinase (EC 2.7.2.8) from Maricaulis maris (see 3 papers)
52% identity, 96% coverage

3s6hA / Q0ASS9 Crystal structure of native mmnags/k (see paper)
52% identity, 97% coverage

Ligands: glutamic acid; coenzyme a (3s6hA)

Q4WCZ1 Arginine-requiring protein 2 from Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
AFUA_6G02910, Afu6g02910 acetylglutamate kinase, putative from Aspergillus fumigatus Af293
42% identity, 46% coverage

Unveiling fungal strategies: Mycoremediation in multi-metal pesticide environment using proteomics
Dey, Scientific reports 2024
- “...biogenesis Glutamyl-tRNA synthetase Nucleus 0.0004 B0XND8 3.5 Energy production and conversion Endo-1,3-beta-glucanase Engl1 Extracellular 0.002 Q4WCZ1 3.5 Carbohydrate transport and metabolism Acetylglutamate kinase Mitochondria 0.0004 Q4WHV3 3.5 Secondary metabolites biosynthesis, transport and catabolism GPR/FUN34 family protein Plasma membrane 4.16141E05 Q40E9 3.5 Amino acid transport and metabolism...”
Arginine Auxotrophy Affects Siderophore Biosynthesis and Attenuates Virulence of Aspergillus fumigatus
Dietl, Genes 2020
- “...siderophore production. ArgJ (AFUA_5G08120, in blue), bifunctional acetylglutamate synthase/ornithine acetyltransferase; Arg2 (AFUA_2G11490), acetylglutamate synthase; ArgEF (AFUA_6G02910), bifunctional acetylglutamate kinase and N-acetyl-gamma-glutamyl-phosphate reductase; Arg8 (AFUA_2G12470), acetylornithine aminotransferase; ArgB (AFUA_4G07190; in red), ornithine carbamoyltransferase; AmcA (AFUA_8G02760), mitochondrial ornithine exporter; AgaA (AFUA_3G11430), arginase; Cap1 (AFUA_5G06780), carbamoyl-phosphate synthase. Dashed lines...”
AmcA-a putative mitochondrial ornithine transporter supporting fungal siderophore biosynthesis
Schafferer, Frontiers in microbiology 2015
- “...catabolism and cytosolic ornithine production under these growth conditions. Expression of the ornithine-biosynthetic gene argEF (AFUA_6G02910, acetylglutamate kinase/N-acetyl--glutamyl-phosphate reductase) was upregulated during iron starvation compared to iron sufficiency, as previously reported (Schrettl et al., 2007 ), and unaffected by AmcA-deficiency. Expression of the arginine-biosynthetic gene argB...”
Characterization of the Link between Ornithine, Arginine, Polyamine and Siderophore Metabolism in Aspergillus fumigatus
Beckmann, PloS one 2013
- “...link between ornithine, arginine, polyamines and siderophores in A. fumigatus . ArgEF: acetylglutamate kinase, acetylglutamyl-phosphate-reductase (AFUA_6g02910); ArgB: ornithine transcarbamoyl transferase (Afu4g07190); AmcA: mitochondrial ornithine exporter (AFUA_8g02760); ODC: ornithine decarboxylase (AFUA_4g08010); SidA: L-ornithine N5-oxygenase (AFUA_2g07680). Reductive iron assimilation and siderophore biosynthesis (SB) are upregulated during iron starvation...”
- “...were amplified by PCR using the primers listed in Table S3 . Deletion of argEF (AFUA_6g02910) and reconstitution of the argEF strain For generation of a argEF mutant strain, the bipartite marker technique was used [29] . Briefly, A. fumigatus strain Cea17 -akuB was co-transformed with...”
HapX-mediated adaption to iron starvation is crucial for virulence of Aspergillus fumigatus
Schrettl, PLoS pathogens 2010
- “...the Northern analysis in (B): 1, acetylglutamate synthetase (Afu2g11490) 2, acetylglutamate kinase and glutamate-5-semialdehyde dehydrogenase (Afu6g02910); 3, acetylornithine aminotransferase (Afu2g12470); 4, arginine biosynthesis bifunctional enzyme (Afu5g08120); 5, carbamoylphosphate synthase(Afu5g06780); 6, ornithine carbamoyltransferase (Afu4g07190); 7, arginase (Afu3g11430); 8, ornithine aminotransferase (Afu4g09140); 9, ornithine decarboxylase (Afu4g08010); 10, pyrroline...”

ARG56_YEAST / Q01217 Protein ARG5,6, mitochondrial; EC 1.2.1.38; EC 2.7.2.8 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 3 papers)
Q01217 acetylglutamate kinase (EC 2.7.2.8) from Saccharomyces cerevisiae (see paper)
ARG5,6 / CAA40336.1 acetylglutamate kinase from Saccharomyces cerevisiae (see paper)
NP_010992 bifunctional acetylglutamate kinase/N-acetyl-gamma-glutamyl-phosphate reductase from Saccharomyces cerevisiae S288C
YER069W Arg5,6p from Saccharomyces cerevisiae
42% identity, 49% coverage

catalytic activity: N-acetyl-L-glutamate 5-semialdehyde + phosphate + NADP(+) = N- acetyl-L-glutamyl 5-phosphate + NADPH + H(+) (RHEA:21588)
catalytic activity: N-acetyl-L-glutamate + ATP = N-acetyl-L-glutamyl 5-phosphate + ADP (RHEA:14629)
Knockout of the Hmt1p Arginine Methyltransferase in Saccharomyces cerevisiae Leads to the Dysregulation of Phosphate-associated Genes and Processes
Chia, Molecular & cellular proteomics : MCP 2018
- “...valued Coveragee P50109 P53334 P53250 P40024 P28007 Q01217 P27466 Q04201 P23641 Q06405 P24783 P38822 P40363 Uncharacterized protein Probable family 17...”
Insight on an arginine synthesis metabolon from the tetrameric structure of yeast acetylglutamate kinase
de, PloS one 2012
- “...is produced in yeast mitochondria by proteolytic processing of the polyprotein precursor (Uniprot database code Q01217) encoded by the ARG5,6 gene, has the unexplained peculiarity, which is shared by the NAGKs of other ascomycetes, of having, in addition to the AAK domain, a C-terminal domain of...”
Regulation of gene expression by a metabolic enzyme.
Hall, Science (New York, N.Y.) 2004 (PubMed)
- GeneRIF: associated with specific nuclear and mitochondrial loci in vivo; binds to specific fragments in vitro; deletion of Arg5,6 causes altered transcript levels of both nuclear and mitochondrial target genes
Generation of a Yeast Cell Model Potentially Useful to Identify the Mammalian Mitochondrial N-Acetylglutamate Transporter
Gorgoglione, Biomolecules 2023
- “...https://www.yeastgenome.org/ (accessed on 21 April 2023)) reports that the single deletion of ARG2 (YJL071w), ARG5,6 (YER069w) and ARG7 (YMR062c) genes leads to an arginine auxotrophy [ 56 , 57 , 58 ]. The deletion of ARG2 or ARG7 is not helpful for our project since both...”
Differential requirements for Gcn5 and NuA4 HAT activities in the starvation-induced versus basal transcriptomes
Zheng, Nucleic acids research 2023
- “...YDL182W YDR127W YDR354W YDR379C-A YDR380W YER052C YER055C YER069W YER175C YFL026W YGL032C YGL117W YGL186C YGL202W YGR161C YHR018C YHR022C YIL015W YIL051C...”
New data and collaborations at the Saccharomyces Genome Database: updated reference genome, alleles, and the Alliance of Genome Resources
Engel, Genetics 2022
- “...software-friendly by removing unnecessary punctuation ORF Old gene name New gene name YGL234W ADE5,7 ADE57 YER069W ARG5,6 ARG56 YBR208C DUR1,2 DUR12 YIL154C IMP2 IMP21 Although nonstandard historical names are maintained in SGD, any new names for yeast genes must conform to the standard format. The SGD...”
Global translational impacts of the loss of the tRNA modification t⁶A in yeast
Thiaville, Microbial cell (Graz, Austria) 2016
- “...*Under control of Gcn4 (see Table S5), & Arginine biosynthesis. Systematic name Standard name Description YER069W ARG5,6 Acetylglutamate kinase and N-acetyl-gamma-glutamyl-phosphate reductase* & YER175C TMT1 Trans-aconitate methyltransferase YGL117W Putative protein of unknown function YJL079C PRY1 Sterol binding protein involved in the export of acetylated sterols YJR025C...”
RSC Chromatin-Remodeling Complex Is Important for Mitochondrial Function in Saccharomyces cerevisiae
Imamura, PloS one 2015
- “...Amino acid biosynthesis YLR027C AAT2 Aspartate AminoTransferase YJL071W ARG2 ARGinine requiring YJL088W ARG3 ARGinine requiring YER069W ARG5 , 6 ARGinine requiring YDR127W ARO1 AROmatic amino acid requiring YOR303W CPA1 Carbamyl Phosphate synthetase A YAL012W CYS3 CYStathionine gamma-lyase YEL046C GLY1 GLYcine requiring YDR158W HOM2 HOMoserine requiring YER052C...”
- “...Amino acids YDR305C HNT2 -1.300467492 Histidine triad NucleoTide-binding YER019W ISC1 -1.104381351 Inositol phosphoSphingolipid phospholipase C YER069W ARG5 , 6 -1.052067786 ARGinine requiring YER183C FAU1 -1.260016198 Folinic Acid Utilization YFL030W AGX1 -1.11633377 Alanine:Glyoxylate aminotrans(X)ferase YGL059W PKP2 -1.169211802 Protein Kinase of PDH YGR102C GTF1 -3.704929047 Glutaminyl Transamidase subunit...”
Transcriptional profiling of cross pathway control in Neurospora crassa and comparative analysis of the Gcn4 and CPC1 regulons
Tian, Eukaryotic cell 2007
- “...Yes TRP3 NCU00554.2 NCU00567.2 orf19.1559 orf19.4788 YDR158W YER069W Yes HOM2 ARG5,6 NCU01412.2 NCU01667.2 orf19.6779 orf19.5610 YOR323C YJL088W Yes PRO2 ARG3...”
Global analysis of the relationship between the binding of the Bas1p transcription factor and meiosis-specific double-strand DNA breaks in Saccharomyces cerevisiae
Mieczkowski, Molecular and cellular biology 2006
- “...0.7455 0.8294 0.7829 0.7422 8.89E01 2.92E01 NS NS ARG5,6 YER069W 1.29 0.2476 0.270 8.14E01 NS MOT3 YMR070W 1.26 0.9518 0.9575 6.64E01 NS VHT1 YGR065C 1.19 0.607...”
Modulation of yeast genome expression in response to defective RNA polymerase III-dependent transcription
Conesa, Molecular and cellular biology 2005
- “...brf1-II.6 YBR218C YCL009C YCL030C YDR035W YDR158W YER053C YER069W YER175C YHR018C YHR208W YIL116W YJL088W YJR109C YKL218C YMR062C YMR094W YMR095C YMR096W...”
More

4ab7H / Q01217 Crystal structure of a tetrameric acetylglutamate kinase from saccharomyces cerevisiae complexed with its substrate n- acetylglutamate (see paper)
42% identity, 97% coverage

Ligand: n-acetyl-l-glutamate (4ab7H)

ARG56_SCHPO / P31318 Protein arg11, mitochondrial; EC 1.2.1.38; EC 2.7.2.8 from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see paper)
arg11 / GI|1204210 N-acetyl-gamma-glutamyl-phosphate reductase/acetylglutamate kinase; EC 1.2.1.38; EC 2.7.2.8 from Schizosaccharomyces pombe (see 2 papers)
SPAC4G9.09c N-acetyl-gamma-glutamyl-phosphate reductase/acetylglutamate kinase from Schizosaccharomyces pombe
41% identity, 47% coverage

catalytic activity: N-acetyl-L-glutamate 5-semialdehyde + phosphate + NADP(+) = N- acetyl-L-glutamyl 5-phosphate + NADPH + H(+) (RHEA:21588)
catalytic activity: N-acetyl-L-glutamate + ATP = N-acetyl-L-glutamyl 5-phosphate + ADP (RHEA:14629)
CharProtDB Source (per GeneDB): GeneDB_Spombe
Thiol-independent action of mitochondrial thioredoxin to support the urea cycle of arginine biosynthesis in Schizosaccharomyces pombe
Song, Eukaryotic cell 2008
- “...indicated in parentheses (arg6, SPBC725.14; arg11, SPAC4G9.09c; arg1, SPCC777.09c; arg3, and SPAC4G9.10; arg12, SPBC428.05c; arg7, SPBC1773.14; car1,...”

ARG5,6 arginine biosynthetic enzyme activities from Candida albicans (see 3 papers)
40% identity, 47% coverage

CharProtDB CGD description: arginine biosynthetic enzyme activities; in S. cerevisiae, processed into distinct polypeptides with acetylglutamate kinase (Arg6p) activity and acetylglutamate-phosphate reductase (Arg5p) activity; Gcn4p regulated; alkaline downregulated

E3KL13 Acetylglutamate kinase from Puccinia graminis f. sp. tritici (strain CRL 75-36-700-3 / race SCCL)
41% identity, 46% coverage

Label-Free Quantitative Proteomic Analysis of Puccinia psidii Uredospores Reveals Differences of Fungal Populations Infecting Eucalyptus and Guava
Quecine, PloS one 2016
- “...CoA acetyltransferase 5467.85 1.71 0.54 0.13 1.00 E3KLM7 Acetyl-CoA acyltransferase 2220,71 1.62 0.48 0.15 1.00 E3KL13 Acetylglutamate kinase 256.81 1.14 0.37 0.19 0.99 E3K4I1 Actin 25906.00 1.16 0.15 0.05 1.00 E3JQQ0 Acyl coenzymeA oxidase 384.27 1.46 0.38 0.15 1.00 E3JUV4 Acyl-CoA dehydrogenase 259.56 1.80 0.59 0.22...”

4nexA / Q87EL2 Structure of the n-acetyltransferase domain of x. Fastidiosa nags/k (see paper)
69% identity, 38% coverage

Ligand: n-acetyl-l-glutamate (4nexA)

NAGS_HUMAN / Q8N159 N-acetylglutamate synthase, mitochondrial; Amino-acid acetyltransferase; EC 2.3.1.1 from Homo sapiens (Human) (see 6 papers)
Q8N159 amino-acid N-acetyltransferase (EC 2.3.1.1) from Homo sapiens (see 4 papers)
35% identity, 77% coverage

function: Plays a role in the regulation of ureagenesis by producing the essential cofactor N-acetylglutamate (NAG), thus modulating carbamoylphosphate synthase I (CPS1) activity.
catalytic activity: L-glutamate + acetyl-CoA = N-acetyl-L-glutamate + CoA + H(+) (RHEA:24292)
subunit: Homodimer. Homotetramer.
Use of pure recombinant human enzymes to assess the disease-causing potential of missense mutations in urea cycle disorders, applied to N-acetylglutamate synthase deficiency.
Gougeard, Journal of inherited metabolic disease 2024
- “...constructions and the absence of unwanted sequence changes (reference sequence, GenBank NM_153006.3; Uniprot KB entry Q8N159). 2.2 Variants studied and sitedirected mutagenesis For comparative purposes, all the variants studied here (22 amino acid substitutions and a Cterminal truncating mutation that removes the last 37 residues) were...”
- “...0.998 Likely pathog Note : GenBank mRNA reference sequence NM_153006.3. Uniprot KB protein reference sequence Q8N159. For the nucleotide changes, the genotypes of patients and families, a summary of clinical data (when available) and reference to the publications originally reporting these variants, see Ref. 14 Unless...”
Identify Molecular Mechanisms of Jiangzhi Decoction on Nonalcoholic Fatty Liver Disease by Network Pharmacology Analysis and Experimental Validation.
Wang, BioMed research international 2020
- “...210 ALAD Aminolevulinate dehydratase 20 P82251 11136 SLC7A9 Solute carrier family 7 member 9 21 Q8N159 162417 NAGS N-Acetylglutamate synthase 22 P21549 189 AGXT Alanine-glyoxylate and serine-pyruvate aminotransferase 23 P34896 6470 SHMT1 Serine hydroxymethyltransferase 1 24 Q08828 107 ADCY1 Adenylate cyclase 1 25 O43708 2954 GSTZ1...”
A Network Pharmacology Study of the Multi-Targeting Profile of an Antiarrhythmic Chinese Medicine Xin Su Ning.
Wang, Frontiers in pharmacology 2019
- “...Enzyme Transferase CTNNB1 Xuanyun 1.020829585 P35222 CHEMBL5866 Catenin beta-1 Other Unclassified protein NAGS Xiongmen 1.020829585 Q8N159 N-acetylglutamate synthase, mitochondrial Enzyme Transferase TTR Maijiedai 1.001902474 P02766 CHEMBL3194 Transthyretin Other Other COL3A1 Xuanyun 0.45282272 P02461 CHEMBL2364188 Collagen Other Other SLC1A3 Xuanyun 0.520835938 P43003 CHEMBL3085 Excitatory amino acid transporter...”
Identification of potential mitochondrial CLPXP protease interactors and substrates suggests its central role in energy metabolism
Fischer, Scientific reports 2015
- “...HSD17B8 Estradiol 17-beta-dehydrogenase 8 Pa_1_17280 3.3 5.0 Q12428 PDH1 Probable 2-methylcitrate dehydratase Pa_1_14630 3.0 6.3 Q8N159 NAGS N-acetylglutamate synthase Pa_4_7010 3.0 3.7 Q16698 DECR1 2.4-dienoyl-CoA reductase Pa_3_10910 3.0 3.3 P15937 acu-8 Acetyl-CoA hydrolase Pa_4_8600 3.0 3.0 O15382 BCAT2 Branched-chain-amino-acid aminotransferase Pa_2_6200 2.3 5.0 P23434 GCSH Glycine...”

D4A904 N-acetylglutamate synthase from Rattus norvegicus
34% identity, 78% coverage

Integrative proteomics and metabolomics of Guizhou Miao Sour Soup affecting simple obese rats.
Yuan, Frontiers in nutrition 2022
- “...Acly Down 0.633 0.0180745 Up 1.534 0.0444326 D4A605 Nnmt Down 0.606 0.0110026 Up 1.564 0.0141326 D4A904 Nags Down 0.711 0.0011298 Up 1.361 0.003964 A0A0G2JSK9 Bhmt Down 0.474 0.0013865 Up 1.855 0.0053504 D4A147 Ugt2a3 Down 0.591 0.007114 Up 1.68 0.0134986 P13221 Got1 Down 0.672 0.0005016 Up 1.652...”

NAGS_MOUSE / Q8R4H7 N-acetylglutamate synthase, mitochondrial; Amino-acid acetyltransferase; EC 2.3.1.1 from Mus musculus (Mouse) (see 3 papers)
Q8R4H7 amino-acid N-acetyltransferase (EC 2.3.1.1) from Mus musculus (see 3 papers)
NP_665828 N-acetylglutamate synthase, mitochondrial precursor from Mus musculus
34% identity, 78% coverage

function: Plays a role in the regulation of ureagenesis by producing the essential cofactor N-acetylglutamate (NAG), thus modulating carbamoylphosphate synthase I (CPS1) activity.
catalytic activity: L-glutamate + acetyl-CoA = N-acetyl-L-glutamate + CoA + H(+) (RHEA:24292)
subunit: Homodimer (By similarity). Homotetramer (PubMed:23894642).
Gene delivery corrects N-acetylglutamate synthase deficiency and enables insights in the physiological impact of L-arginine activation of N-acetylglutamate synthase.
Sonaimuthu, Scientific reports 2021
- GeneRIF: Gene delivery corrects N-acetylglutamate synthase deficiency and enables insights in the physiological impact of L-arginine activation of N-acetylglutamate synthase.
A novel UPLC-MS/MS based method to determine the activity of N-acetylglutamate synthase in liver tissue.
Dercksen, Molecular genetics and metabolism 2016 (PubMed)
- GeneRIF: The specificity of the assay was validated by demonstrating a complete deficiency of NAGS in liver homogenates from Nags -/- mice. CONCLUSION: The novel NAGS enzyme assay reported herein can be used for the diagnosis of inherited NAGS deficiency and may also be of value in the study of secondary hyperammonemia present in various inborn errors of metabolism as well as drug treatment.
Transcriptional regulation of N-acetylglutamate synthase.
Heibel, PloS one 2012
- GeneRIF: Sp1, CREB, HNF-1, and NF-Y, known to be responsive to hormones and diet, regulate NAGS transcription
Biochemical properties of recombinant human and mouse N-acetylglutamate synthase.
Caldovic, Molecular genetics and metabolism 2006 (PubMed)
- GeneRIF: The biochemical properties of purified recombinant human and mouse NAGS-M and NAGS-C were determined in this study with the goal of better understanding the role of the variable domain in NAGS function.
Mammalian N-acetylglutamate synthase.
Morizono, Molecular genetics and metabolism 2004
- GeneRIF: Is a mitochondrial enzyme that catalyzes the formation of N-acetylglutamate (NAG)
Identification, cloning and expression of the mouse N-acetylglutamate synthase gene.
Caldovic, The Biochemical journal 2002
- GeneRIF: identification, cloning and expression
The Urine Proteome as a Biomarker of Radiation Injury: Submitted to Proteomics- Clinical Applications Special Issue: "Renal and Urinary Proteomics (Thongboonkerd)".
Sharma, Proteomics. Clinical applications 2008

A4GTP3 amino-acid N-acetyltransferase (EC 2.3.1.1) from Sus scrofa (see paper)
38% identity, 74% coverage

NAGS_DANRE / E7FCP8 N-acetylglutamate synthase, mitochondrial; EC 2.3.1.1 from Danio rerio (Zebrafish) (Brachydanio rerio) (see paper)
XP_685919 N-acetylglutamate synthase, mitochondrial isoform X1 from Danio rerio
32% identity, 78% coverage

function: Plays a role in the regulation of ureagenesis by producing the essential cofactor N-acetylglutamate (NAG), thus modulating carbamoylphosphate synthase I (cps1) activity.
catalytic activity: L-glutamate + acetyl-CoA = N-acetyl-L-glutamate + CoA + H(+) (RHEA:24292)
subunit: Homodimer (By similarity). Homotetramer (PubMed:24465614).
Expression pattern and biochemical properties of zebrafish N-acetylglutamate synthase.
Caldovic, PloS one 2014
- GeneRIF: Data indicate that under physiological conditions N-acetylglutamate synthase (NAGS) catalyzes formation of N-acetylglutamate at the maximal rate.

XP_011522740 N-acetylglutamate synthase, mitochondrial isoform X1 from Homo sapiens
33% identity, 68% coverage

NAGS, CPS1, and SLC25A13 (Citrin) at the Crossroads of Arginine and Pyrimidines Metabolism in Tumor Cells.
Owusu-Ansah, International journal of molecular sciences 2023
- GeneRIF: NAGS, CPS1, and SLC25A13 (Citrin) at the Crossroads of Arginine and Pyrimidines Metabolism in Tumor Cells.
Noncoding sequence variants define a novel regulatory element in the first intron of the N-acetylglutamate synthase gene.
Häberle, Human mutation 2021
- GeneRIF: Noncoding sequence variants define a novel regulatory element in the first intron of the N-acetylglutamate synthase gene.
N-Acetylglutamate Synthase Deficiency Due to a Recurrent Sequence Variant in the N-acetylglutamate Synthase Enhancer Region.
Williams, Scientific reports 2018
- GeneRIF: Variation in the N-acetylglutamate Synthase Enhancer Region is associated with N-Acetylglutamate Synthase Deficiency.
Understanding N-Acetyl-L-Glutamate Synthase Deficiency: Mutational Spectrum, Impact of Clinical Mutations on Enzyme Functionality, and Structural Considerations.
Sancho-Vaello, Human mutation 2016 (PubMed)
- GeneRIF: Results identified 36 NAGS mutations in NAGSD patients; 61% of which are missense mutations. Phenotypes associated with these mutations in the GNAT domain are more severe than phenotypes of that of amino acid kinase domain. Enzyme activity and stability assays with 12 mutations, together with in silico structural analysis, support the pathogenic role of most NAGSD-associated mutations found.
A novel UPLC-MS/MS based method to determine the activity of N-acetylglutamate synthase in liver tissue.
Dercksen, Molecular genetics and metabolism 2016 (PubMed)
- GeneRIF: The specificity of the assay was validated by demonstrating a complete deficiency of NAGS in liver homogenates from Nags -/- mice. CONCLUSION: The novel NAGS enzyme assay reported herein can be used for the diagnosis of inherited NAGS deficiency and may also be of value in the study of secondary hyperammonemia present in various inborn errors of metabolism as well as drug treatment.
Inhibition of N-acetylglutamate synthase by various monocarboxylic and dicarboxylic short-chain coenzyme A esters and the production of alternative glutamate esters.
Dercksen, Biochimica et biophysica acta 2014 (PubMed)
- GeneRIF: Data indicate the formation of alternative N-acylglutamates by N-acetylglutamate synthase (NAGS).
Transcriptional regulation of N-acetylglutamate synthase.
Heibel, PloS one 2012
- GeneRIF: Sp1, CREB, HNF-1, and NF-Y, known to be responsive to hormones and diet, regulate NAGS transcription
Favourable long-term outcome after immediate treatment of neonatal hyperammonemia due to N-acetylglutamate synthase deficiency.
Gessler, European journal of pediatrics 2010 (PubMed)
- GeneRIF: After the human NAGS gene was identified, mutation analysis revealed that the older sibling on NCG therapy was homozygous for a 971G>A (W324X) mutation.
More

Q6V1L5 acetylglutamate kinase (EC 2.7.2.8) from Synechococcus elongatus (see paper)
35% identity, 61% coverage

Interaction of N-acetyl-l-glutamate kinase with the PII signal transducer in the non-photosynthetic alga Polytomella parva: Co-evolution towards a hetero-oligomeric enzyme
Selim, The FEBS journal 2020
- “...Arabidopsis thaliana (Q9 SCL 7), red algae Porphyra purpurea (P69365), cyanobacteria Synechococcus elongatus PCC 7942 (Q6V1L5) and Synechocystis sp. PCC 6803 (P73326), and bacteria Thermotoga maritima (Q9X2A4) and Escherichiacoli (P0A6C8). Highlighted residues in black are invariant in at least 55% of aligned NAGK proteins. Amino acids...”

2v5hB / Q6V1L5 Controlling the storage of nitrogen as arginine: the complex of pii and acetylglutamate kinase from synechococcus elongatus pcc 7942 (see paper)
35% identity, 61% coverage

Ligand: n-acetyl-l-glutamate (2v5hB)

DJ41_2686, HMPREF0010_01382 acetylglutamate kinase from Acinetobacter baumannii ATCC 19606 = CIP 70.34 = JCM 6841
33% identity, 61% coverage

Metabolic Responses to Polymyxin Treatment in Acinetobacter baumannii ATCC 19606: Integrating Transcriptomics and Metabolomics with Genome-Scale Metabolic Modeling
Zhu, mSystems 2019
- “...biosynthesis, the upregulation of amino acid N -acetyltransferase (DJ41_3725, argA , 7.6-fold) and acetylglutamate kinase (DJ41_2686, argB , 2.0-fold) resulted in upregulated arginine biosynthesis flux and a decreased intermediate metabolite pool of N -acetyl- l -glutamate (3.5-fold) and l -argininosuccinate (3.4-fold, Fig.4D ). The acetylglutamate synthesis...”
Constraint-based modeling identifies new putative targets to fight colistin-resistant A. baumannii infections
Presta, Scientific reports 2017
- “...no no no no no yes HMPREF0010_01215 ArgJ protein no no no no no yes HMPREF0010_01382 acetylglutamate kinase no no no no no yes HMPREF0010_01506 methionine synthase no no no no no yes HMPREF0010_01669 3-methyl-2-oxobutanoate hydroxymethyltransferase no no no no no yes HMPREF0010_01887 2-heptaprenyl-14-naphthoquinone methyltransferase no...”
- “...encoding for glutamate-N-acetyltransferase (member of the ornithine acetyltransferase, OAT, family), HMPREF0010_00419, encoding for N-acetyl-gamma-glutamyl-phosphate reductase, HMPREF0010_01382 encoding for N-acetyl-L-glutamate-kinase, all of which are involved in the arginine biosynthesis pathway, HMPREF0010_0275979 that encodes for a glutamate-racemase and HMPREF0010_02344 that encodes for an adenosylhomocysteinase. This group of 4...”

PMN2A_1832 Aspartokinase superfamily:Acetylglutamate kinase from Prochlorococcus marinus str. NATL2A
34% identity, 61% coverage

Heterotroph Interactions Alter Prochlorococcus Transcriptome Dynamics during Extended Periods of Darkness
Biller, mSystems 2018
- “..., ppnK 2.0E02 Other amino acid biosynthesis argC , lysC , met17 , thrA , PMN2A_1832 8.0E02 Polymer/polysaccharide degradation glgP , glk , malQ , pgm 9.0E02 Pyrimidine nucleotide de novo biosynthesis carA , ndk , nrdA , pyrB , pyrC , pyrD , thyX ,...”

CGUJ_01846, WSI_01760 acetylglutamate kinase from Candidatus Liberibacter asiaticus str. Ishi-1
31% identity, 62% coverage

Unique features of a Japanese 'Candidatus Liberibacter asiaticus' strain revealed by whole genome sequencing
Katoh, PloS one 2014
- “...psy62, although it is present in Ca. L. solanacearum CLso-ZC1 [37] . However, Japanese Ishi-1 (CGUJ_01846) and Chinese gxpsy (WSI_01760, [28] ) encode identical full-length NAGK. Within the three Ca. L. asiaticus strains, psy62 lacks an adenine between 406695 and 406696, thus truncating the sequence. The...”
- “...present in Ca. L. solanacearum CLso-ZC1 [37] . However, Japanese Ishi-1 (CGUJ_01846) and Chinese gxpsy (WSI_01760, [28] ) encode identical full-length NAGK. Within the three Ca. L. asiaticus strains, psy62 lacks an adenine between 406695 and 406696, thus truncating the sequence. The presence of an NAGK...”

4k30A / Q8N159 Structure of the n-acetyltransferase domain of human n-acetylglutamate synthase (see paper)
42% identity, 33% coverage

Ligand: n-acetyl-l-glutamate (4k30A)

Teth39_0225 acetylglutamate kinase from Thermoanaerobacter ethanolicus ATCC 33223
33% identity, 62% coverage

A comparative multidimensional LC-MS proteomic analysis reveals mechanisms for furan aldehyde detoxification in Thermoanaerobacter pseudethanolicus 39E
Clarkson, Biotechnology for biofuels 2014
- “...synthase 0.015 Teth39_0223 4.31 N-acetyl-gamma-glutamyl-phosphate reductase 0.001 Teth39_0224 6.61 Arginine biosynthesis bifunctional protein ArgJ 0.000 Teth39_0225 2.50 Acetylglutamate kinase 0.010 Teth39_0226 2.65 Acetylornithine and succinylornithine aminotransferase 0.038 Teth39_0227 7.69 Carbamoyl phosphate synthase, small subunit 0.010 Teth39_0228 12.73 Carbamoyl phosphate synthase, large subunit 0.008 Teth39_0229 5.74 Argininosuccinate...”

NMB1074 acetylglutamate kinase from Neisseria meningitidis MC58
28% identity, 62% coverage

Transcriptional regulation of the nadA gene in Neisseria meningitidis impacts the prediction of coverage of a multicomponent meningococcal serogroup B vaccine
Fagnocchi, Infection and immunity 2013
- “...the two converging open reading frames (ORFs) NMB1074 and NMB1075, flanked on both sides with transcriptional terminators, plasmid pSL-LuxFla was constructed...”
Role of Hfq in iron-dependent and -independent gene regulation in Neisseria meningitidis
Mellin, Microbiology (Reading, England) 2010
- “...hfqcomp primers (Table 1 ). JM30 carries the hfq gene in the IG region between NMB1074 and NMB1075. Strain JM44 was generated by transforming a derivative of the pLES94 plasmid ( Silver & Clark, 1995 ) into wild-type MC58 (Supplementary Fig. S1, available with the online...”
- “...Complemented hfq mutant in which the hfq gene was cloned into the IG region between NMB1074 and NMB1075 under the control of its own promoter This study JM44 MC58 with the sdhC : lacZ transcriptional fusion inserted into the proA/B genes This study JM45 JM23 with...”
A novel phase variation mechanism in the meningococcus driven by a ligand-responsive repressor and differential spacing of distal promoter elements
Metruccio, PLoS pathogens 2009
- “...insertion of nadA promoter variants and mutants fused to gfp in single copy between ORF nmb1074 and NMB1075 in the N. meningitidis chromosome, Amp R , Ery R [61] pGX-1 Derivative pSC101 containing the gfp gene, CmR [62] pGX-nad-gfp Derivative of pGX-1 with the nadA promoters...”
The RNA chaperone Hfq is involved in stress response and virulence in Neisseria meningitidis and is a pleiotropic regulator of protein expression
Fantappiè, Infection and immunity 2009
- “...into the chromosome of MC58 derivative strains between the NMB1074 and NMB1075 converging genes, Ampr Eryr Derivative of pFlaEryPind with the hfq gene cloned as...”
A novel fur- and iron-regulated small RNA, NrrF, is required for indirect fur-mediated regulation of the sdhA and sdhC genes in Neisseria meningitidis
Mellin, Journal of bacteriology 2007
- “...and its promoter flanked by a 510-bp region of the NMB1074 gene and a 909-bp region of the NMB1075 gene pSLFur-C1 derivative with a 592-bp SpeI-Xho PCR fragment...”
- “...gene inserted heterologously into the chromosome between the NMB1074 and NMB1075 genes. The construction and characterization of both of these strains was...”
CrgA is an inducible LysR-type regulator of Neisseria meningitidis, acting both as a repressor and as an activator of gene transcription
Ieva, Journal of bacteriology 2005
- “...position 179, fused to lacZ, is inserted between ORFs NMB1074 and NMB1075; Eryr crgA promoter region from position 15 to position 179, fused to lacZ, is...”
- “...position 179, fused to lacZ, is inserted between ORFs NMB1074 and NMB1075; Eryr crgA promoter region from position 44 to position 179, fused to lacZ, is...”
The iron-responsive regulator fur is transcriptionally autoregulated and not essential in Neisseria meningitidis
Delany, Journal of bacteriology 2003
- “...an erythromycin cassette in the noncoding region between the NMB1074 and NMB1075 genes; fur Kmr Eryr Derivative of MC58 containing 317 bp consisting of the 5...”
- “...to a promoterless lacZ gene chromosomally located between the NMB1074 and NMB1075-genes; Eryr Derivative of MC58 containing 277 bp consisting of the 5 end of...”

HMPREF0389_01569 acetylglutamate kinase from Filifactor alocis ATCC 35896
30% identity, 63% coverage

Filifactor alocis--a new emerging periodontal pathogen
Aruni, Microbes and infection 2015
- “...It is also important to note that the proteins ornithine transaminase (HMPREF0389_01570), acetyl glutamate kinase (HMPREF0389_01569), glutamate racemase (HMPRE F0389_00100) and aminotransferase (HMPREF0389_00478) involved in ornithine biosynthesis were identified in F. alocis . In fact, arginine deiminase (HMPREF0389_01584) involved in ornithine catabolism and urea breakdown was...”
Proteome variation among Filifactor alocis strains
Aruni, Proteomics 2012
- “...is important to note that protein spots corresponding to ornithine transaminase (HMPREF0389_01570), acetyl glutamate kinase (HMPREF0389_01569), glutamate racemase (HMPREF0389_00100), and amidotransferase (HMPREF0389_00478) involved in ornithine biosynthesis were identified. These proteins were found both in the membrane and the extracellular fraction of the D-62D strain. Proteins involved...”
- “...32.3 67/0.25 7 Unknown No conserved domains 2.21 Signal peptide at the N terminal 35. HMPREF0389_01569 Acetyl glutamate kinase 31.03 42/0.08 7 EC-0.73 Arginine amino acid kinase Nonsecretory 36. HMPREF0389_01545 Copper amine oxidase N-domain protein 30.5 43/0.13 6 Unknown Precursor signal domain 1.96 N terminal signal...”

A8HPI1 Aspartate/glutamate/uridylate kinase domain-containing protein from Chlamydomonas reinhardtii
32% identity, 61% coverage

Quantitative Phosphoproteomic and System-Level Analysis of TOR Inhibition Unravel Distinct Organellar Acclimation in Chlamydomonas reinhardtii
Roustan, Frontiers in plant science 2018
- “...proteins related to purine metabolism were found to be significantly up-regulated during rapamycin treatment (A8JGY3, A8HPI1, A8IXD1, and A8IJJ8). Finally, we also investigated the 199 other proteins presenting a significant difference in treatment factor, but also with time and interaction factors. Previously published transcriptomics data corroborate...”

O67848 UDP-3-O-acyl-N-acetylglucosamine deacetylase (EC 3.5.1.108) from Aquifex aeolicus (see paper)
30% identity, 63% coverage

LIMLP_06420 acetylglutamate kinase from Leptospira interrogans serovar Manilae
27% identity, 95% coverage

Leptospira interrogans biofilm transcriptome highlights adaption to starvation and general stress while maintaining virulence
Davignon, NPJ biofilms and microbiomes 2024
- “...While two genes of the arginine biosynthesis pathway were upregulated, argC (LIMLP_08670, FC 1.6) and LIMLP_06420 (FC 1.8), four showed downregulation, argJ (LIMLP_16730, FC 1.9), argD (LIMLP_08770, FC 1.5), argB (LIMLP_18295, FC 1.6), and glnA (LIMLP_11985, FC 2.0). A similar profile was observed in histidine metabolism,...”

slr1898 N-acetylglutamate kinase from Synechocystis sp. PCC 6803
P73326 Acetylglutamate kinase from Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
32% identity, 61% coverage

The genome sequence of Synechocystis sp. PCC 6803 substrain GT-T and its implications for the evolution of PCC 6803 substrains
Koskinen, FEBS open bio 2023
- “...PCC Del 154bp 831302 M T C Intergenic and slr2031 847733 M A G Asn2Ser slr1898 argB Nacetylglutamate kinase 938130 T T C Gln589Arg sll1732 ndhF3 NAD(P)Hquinone oxidoreductase subunit F 1070494 M A T Lys298Asn sll1359 Hypothetical protein 1203086 PCC A G Tyr95Cys slr1865 Hypothetical protein...”
The Signal Transduction Protein P_II Controls Ammonium, Nitrate and Urea Uptake in Cyanobacteria
Watzer, Frontiers in microbiology 2019
- “...10 6 9.1 10 7 PphA Sll1771 28.47 4.2 10 4 9.1 10 5 NAGK Slr1898 31.53 9.4 10 4 6.5 10 5 Amt1 Sll0108 53.58 1.2 10 8 2.9 10 8 NrtA Sll1450 48.97 1.1 10 5 1.4 10 6 NrtB Sll1451 29.72 8.8 10...”
Integrated OMICS guided engineering of biofuel butanol-tolerance in photosynthetic Synechocystis sp. PCC 6803
Zhu, Biotechnology for biofuels 2013
- “...bifunctional ornithine acetyltransferase/N-acetylglutamate synthase protein, sll0461 encoding gamma-glutamyl phosphate reductase, slr0288 encoding glutamate--ammonia ligase, and slr1898 encoding acetylglutamate kinase that are involved in metabolism of glutamate family amino acids (Table 5 ). Moreover, metabolomic analysis showed the increased abundances of intermediates in the glycolysis pathway, such...”
Microevolution in cyanobacteria: re-sequencing a motile substrain of Synechocystis sp. PCC 6803
Trautmann, DNA research : an international journal for rapid publication of reports on genes and genomes 2012
- “...8 S 848 078 848 078 1 G A AGC AAC S N AA change slr1898 argB N -acetylglutamate kinase 9 S 943 495 943 495 1 G A GTC ATC V I AA change a slr1834 psaA P700 apoprotein subunit Ia 10 S 1 012...”
- “...of the 4.2 region can directly interact with DNA. 29 Another transversion, in argB ( slr1898 ; #8 in Table 1 ), leads to an S2N amino acid substitution in N -acetylglutamate kinase, the enzyme performing the first committed step of Arg biosynthesis. Transitions in sll1359...”
Comparative analysis of chloroplast genomes: functional annotation, genome-based phylogeny, and deduced evolutionary patterns
De, Genome research 2002
- “...CyaPar) 0.0822 sll0728 accA 0.0822 slr0435 accB 0.0822 slr1898 argB 0.0822 sll1214 AT103 0.0822 sll1498 carA 0.0822 slr2051 cpcG 0.0822 sll0698 dfr 0.0822...”
Interaction of N-acetyl-l-glutamate kinase with the PII signal transducer in the non-photosynthetic alga Polytomella parva: Co-evolution towards a hetero-oligomeric enzyme
Selim, The FEBS journal 2020
- “...algae Porphyra purpurea (P69365), cyanobacteria Synechococcus elongatus PCC 7942 (Q6V1L5) and Synechocystis sp. PCC 6803 (P73326), and bacteria Thermotoga maritima (Q9X2A4) and Escherichiacoli (P0A6C8). Highlighted residues in black are invariant in at least 55% of aligned NAGK proteins. Amino acids in blue represent similar residues. Box...”

LHK_02337 ArgB from Laribacter hongkongensis HLHK9
32% identity, 54% coverage

General metabolism of Laribacter hongkongensis: a genome-wide analysis
Curreem, Cell & bioscience 2011
- “...in the biosynthesis (amino-acid acetyltransferase gene argA : LHK_02338, LHK_02366 ; acetylglutamate kinase gene argB: LHK_02337, LHK_02829) and catabolism (whole operon of arginine deiminase arcB / A / C / D : LHK_02727-LHK_02734) of arginine are duplicated in L. hongkongensis , suggesting the importance of arginine...”
The complete genome and proteome of Laribacter hongkongensis reveal potential mechanisms for adaptations to different temperatures and habitats
Woo, PLoS genetics 2009
- “...Methylenetetrahydro-folate dehydrogenase/cyclohydrolase Coenzyme transport and metabolism 45 14 6.67e+007 <0.05 Higher expression at 37C 8 LHK_02337 31.5 5.12 Acetylglutamate kinase, NAGK-37 Amino acid transport and metabolism 38 13 3.48e+004 2.09 <0.005 9 LHK_02119 23.7 9.22 Hypothetical protein 41 8 1.24e+004 3.06 <0.005 Only at 37C 10...”

PFLU5987 acetylglutamate kinase from Pseudomonas fluorescens SBW25
29% identity, 64% coverage

Mapping global effects of the anti-sigma factor MucA in Pseudomonas fluorescens SBW25 through genome-scale metabolic modeling
Borgos, BMC systems biology 2013
- “...in the algC mutant, whereas in the mucA TT algD strain, only algC and the PFLU5987 gene are regulated above the significance cut-off, both up in the mutant strain. The latter gene encodes an acetylglutamate kinase ArgB (EC 2.7.2.9). However, this gene is localized immediately downstream...”

Cj0226 acetylglutamate kinase from Campylobacter jejuni subsp. jejuni NCTC 11168
28% identity, 61% coverage

Adaptive mechanisms of Campylobacter jejuni to erythromycin treatment
Xia, BMC microbiology 2013
- “...system permease and a periplasmic binding proteins. Down-regulated genes in this category included argB ( cj0226 ), cysE ( cj0763c ), cj0731 , cj1582c, and cj1583c . Fewer than 3 genes were differentially expressed in other categories (Table 2 ). Different from the inhibitory treatment, the...”
Common genomic features of Campylobacter jejuni subsp. doylei strains distinguish them from C. jejuni subsp. jejuni
Parker, BMC microbiology 2007
- “...- + Cj0224 N-acetyl--glutamylphosphate reductase Arg C - - - - - - - + Cj0226 Acetylglutamate kinase Arg B - - - - - - - + Cj0339 Cj0340 MFS transporter, nucleoside hydrolase - - - - - - - - Cj0548 Flagellar hook-associated protein...”
Campylobacter jejuni gene expression in the chick cecum: evidence for adaptation to a low-oxygen environment
Woodall, Infection and immunity 2005
- “...expression level (n-fold) P value Cj0037c Cj0874c Cj0226 Cj0453 Possible cytochrome c Possible cytochrome Probable acetylglutamate kinase, argB Thiamin...”

ARGB_THEMA / Q9X2A4 Acetylglutamate kinase; N-acetyl-L-glutamate 5-phosphotransferase; NAG kinase; NAGK; EC 2.7.2.8 from Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8) (see 2 papers)
Q9X2A4 acetylglutamate kinase (EC 2.7.2.8) from Thermotoga maritima (see 2 papers)
2btyA / Q9X2A4 Acetylglutamate kinase from thermotoga maritima complexed with its inhibitor arginine (see paper)
TM1784 acetylglutamate kinase from Thermotoga maritima MSB8
32% identity, 62% coverage

function: Catalyzes the ATP-dependent phosphorylation of N-acetyl-L- glutamate.
catalytic activity: N-acetyl-L-glutamate + ATP = N-acetyl-L-glutamyl 5-phosphate + ADP (RHEA:14629)
subunit: Homohexamer.
Ligands: arginine; n-acetyl-l-glutamate (2btyA)
Arginine biosynthesis in Thermotoga maritima: characterization of the arginine-sensitive N-acetyl-L-glutamate kinase
Fernández-Murga, Journal of bacteriology 2004
- “...The putative T. maritima argB gene, corresponding to gene TM1784 of the T. maritima gene list (33; http://www.TIGR.org), was PCR-cloned from the genomic DNA of...”
- “...from nucleotides 1760682 to 1760714 of TM1784 (5GGAGGTACAGCATATGAGGATCGACACGGTCA3), and the reverse primer derived from the complementary antiparallel sequence...”
Evolution of mosaic operons by horizontal gene transfer and gene displacement in situ
Omelchenko, Genome biology 2003
- “...Lactococcus lactis L0104-0108 Arginine biosynthesis L0107 Gram-negative bacteria Acetylglutamate kinase Thermotoga maritima TM1780-1785 Arginine biosynthesis TM1784 Archaea Acetylglutamate kinase Cluster 48 Borrelia burgdorferi BB0054-0061 Carbohydrate metabolism (glycolysis, gluconeogenesis) BB0057 Gram-positive bacteria Glyceraldehyde-3-phosphate dehydrogenase Cluster 54 Thermotoga maritima TM1780-1785 Arginine biosynthesis TM1780 Gram-negative bacteria Argininosuccinate synthase Cluster...”
Interaction of N-acetyl-l-glutamate kinase with the PII signal transducer in the non-photosynthetic alga Polytomella parva: Co-evolution towards a hetero-oligomeric enzyme
Selim, The FEBS journal 2020
- “...Synechococcus elongatus PCC 7942 (Q6V1L5) and Synechocystis sp. PCC 6803 (P73326), and bacteria Thermotoga maritima (Q9X2A4) and Escherichiacoli (P0A6C8). Highlighted residues in black are invariant in at least 55% of aligned NAGK proteins. Amino acids in blue represent similar residues. Box I refers to plastidtargeting signal...”

NE1005 Aspartokinase superfamily:Acetylglutamate kinase from Nitrosomonas europaea ATCC 19718
30% identity, 62% coverage

Candidate stress genes of Nitrosomonas europaea for monitoring inhibition of nitrification by heavy metals
Park, Applied and environmental microbiology 2008
- “...NE2324 NE1035 NE0854 NE0951 Amino acid transport and metabolism NE1005 NE0872 Others NE1176* NE0090 NE2325 NE2326 NE0218 a glnS hupB rnc cysB argB hisD lepB...”
- “...could help the cell to resist oxidative stresses. NE1005 (argB) and NE0872 (hisD), encoding an amino acid transport, were upregulated under Cd2. Biosynthesis of...”

LIMLP_18295 acetylglutamate kinase from Leptospira interrogans serovar Manilae
29% identity, 62% coverage

Leptospira interrogans biofilm transcriptome highlights adaption to starvation and general stress while maintaining virulence
Davignon, NPJ biofilms and microbiomes 2024
- “...LIMLP_06420 (FC 1.8), four showed downregulation, argJ (LIMLP_16730, FC 1.9), argD (LIMLP_08770, FC 1.5), argB (LIMLP_18295, FC 1.6), and glnA (LIMLP_11985, FC 2.0). A similar profile was observed in histidine metabolism, with one gene being upregulated ( hisI /LIMLP_02360, FC 2.4), and three genes being downregulated...”

LHK_02829 ArgB from Laribacter hongkongensis HLHK9
31% identity, 62% coverage

General metabolism of Laribacter hongkongensis: a genome-wide analysis
Curreem, Cell & bioscience 2011
- “...the biosynthesis (amino-acid acetyltransferase gene argA : LHK_02338, LHK_02366 ; acetylglutamate kinase gene argB: LHK_02337, LHK_02829) and catabolism (whole operon of arginine deiminase arcB / A / C / D : LHK_02727-LHK_02734) of arginine are duplicated in L. hongkongensis , suggesting the importance of arginine metabolism...”
The complete genome and proteome of Laribacter hongkongensis reveal potential mechanisms for adaptations to different temperatures and habitats
Woo, PLoS genetics 2009
- “...and 4B ). These two homologous copies of argB encode two isoenzymes of NAGK [NAGK-20 (LHK_02829) and NAGK-37 (LHK_02337)], which catalyze the second step of the arginine biosynthesis pathway. 10.1371/journal.pgen.1000416.g003 Figure 3 2D gel electrophoresis patterns of proteins extracted from L. hongkongensis HLHK9 cells grown at...”
- “...(%) Peptide matched MOWSE score 20C/37C ratio a p value Higher expression at 20C 1 LHK_02829 30.0 5.03 Acetylglutamate kinase, NAGK-20 Amino acid transport and metabolism 24 6 9.49e+003 +2.50 <0.005 2 LHK_01819 39.0 6.30 Probable porin protein Cell wall/membrane/envelope biogenesis 36 9 3.86e+005 +2.41 <0.005...”

CJJ81176_0251 acetylglutamate kinase from Campylobacter jejuni subsp. jejuni 81-176
28% identity, 61% coverage

High-throughput sequencing of Campylobacter jejuni insertion mutant libraries reveals mapA as a fitness factor for chicken colonization
Johnson, Journal of bacteriology 2014
- “...Annotation/predicted functiona Fitness ratiob CJJ81176_0251 CJJ81176_0296 CJJ81176_0674 CJJ81176_0005 CJJ81176_1238 CJJ81176_1606 CJJ81176_1143 CJJ81176_1679...”

ARGB_PSEAE / Q9HTN2 Acetylglutamate kinase; N-acetyl-L-glutamate 5-phosphotransferase; NAG kinase; NAGK; EC 2.7.2.8 from Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) (see 2 papers)
Q9HTN2 acetylglutamate kinase (EC 2.7.2.8) from Pseudomonas aeruginosa (see 3 papers)
NP_254010 acetylglutamate kinase from Pseudomonas aeruginosa PAO1
PA14_70280 acetylglutamate kinase from Pseudomonas aeruginosa UCBPP-PA14
PA5323 acetylglutamate kinase from Pseudomonas aeruginosa PAO1
30% identity, 64% coverage

function: Catalyzes the ATP-dependent phosphorylation of N-acetyl-L- glutamate.
catalytic activity: N-acetyl-L-glutamate + ATP = N-acetyl-L-glutamyl 5-phosphate + ADP (RHEA:14629)
subunit: Homohexamer.
Structural bases of feed-back control of arginine biosynthesis, revealed by the structures of two hexameric N-acetylglutamate kinases, from Thermotoga maritima and Pseudomonas aeruginosa.
Ramón-Maiques, Journal of molecular biology 2006 (PubMed)
- GeneRIF: Findings set the bases for understanding the higher regulatory functions reported for N-acetylglutamate kinases of photosynthetic organisms.
Transmembrane but not soluble helices fold inside the ribosome tunnel.
Bañó-Polo, Nature communications 2018
- “...Macrogen (Seoul, South Korea). DNA manipulation The helical sequence from NAGK (residues 526, Uniprot # Q9HTN2 ) and L9 (residues 4667, Uniprot # P02417 ) and the TM sequence from VSV-G (residues 463482, Uniprot # P04884 ), gp41 (residues 684705, Uniprot # P03375 ), GpA (residues...”
Pseudomonas aeruginosa core metabolism exerts a widespread growth-independent control on virulence
Panayidou, Scientific reports 2020
- “...pathway (pau00030) PA14_22910 ( edd ) 40 PA14_23090 ( edaA ) 41 Arginine biosynthesis (pau00220) PA14_70280 ( argB ) 42 PA14_69500 ( argH ) 43 Glycine, serine and threonine metabolism (pau00260) PA14_65560 ( serB ) 44 Glycolysis/Gluconeogenesis (pau00010) PA14_62830 ( tpiA ) *: Found attenuated in...”
Massively parallel mutant selection identifies genetic determinants of Pseudomonas aeruginosa colonization of Drosophila melanogaster
Miles, mSystems 2024
- “...PA4696 ilvI Amino acids [E] PA5013 ilvE Amino acids [E] PA5204 argA Amino acids [E] PA5323 argB Amino acids [E] + PA0662 argC Amino acids [E] + PA3525 argG Amino acids [E] + PA3537 argF Amino acids [E] PA5263 argH Amino acids [E] PA3118 leuB Amino...”
Inhibition of Pseudomonas aeruginosa swarming motility by 1-naphthol and other bicyclic compounds bearing hydroxyl groups
Oura, Applied and environmental microbiology 2015
- “...protein Other PA0594 PA3006 PA3014 PA3721 PA3866 PA4710 PA5323 Hypothetical proteins PA3229 PA3720 phuR argB rhlA in the presence of 1-naphthol was 1.3-fold (...”
Detection of host-derived sphingosine by Pseudomonas aeruginosa is important for survival in the murine lung
LaBauve, PLoS pathogens 2014
- “...gene operon convergently transcribed toward sphA , PA5328 - PA5326 . The argB gene ( PA5323 ) was induced more strongly in the sphR deletion than in wild type, which we think is likely due to a cis effect of the sphR ( PA5324 ) deletion,...”
- “...cerN Neutral ceramidase 3.1 NC 3.4 PA5326 sphD Predicted threonine aldolase family 2.6 NC 2.9 PA5323 argB Acetylglutamate kinase 2.2 2.1 NC 1 gene names, apart from argB , all derived from this study. Mapping of the sphA , sphBCD , and cerN promoters We used...”
Genome-wide patterns of recombination in the opportunistic human pathogen Pseudomonas aeruginosa
Dettman, Genome biology and evolution 2014
- “...synthetase PA4779 PALES_51641 ABC transporter permease PA5090 PALES_54801 Type-VI secretion protein, Rhs element, Vgr-family protein PA5323 PALES_57181 argB , acetylglutamate kinase, arginine/ornithine metabolism PA5324 PALES_57191 Transcriptional regulator, AraC family PA5349 PALES_57441 Rubredoxin-NAD(+) reductase Homologous and nonhomologous recombination were not colocalized within the genome. When we compared...”
A systems biology approach to drug targets in Pseudomonas aeruginosa biofilm
Sigurdsson, PloS one 2012
- “...silico minimal medium Alanine biosynthesis Alr (PA4930) Arginine, putrescine, and spermidine metabolism UreB (PA4867) ArgB (PA5323) Aromatic amino acids AroC (PA1681), AroK (PA5039) AroB (PA5038), AroA (PA3164), AroE (PA0025) TrpA (PA0035), TrpB (PA0036), PheA (PA3166) Biosynthesis of cofactors, prosthetic groups and carriers, cell wall/ Lipopolysaccharide/ capsule...”

ACSP50_6398 acetylglutamate kinase from Actinoplanes sp. SE50/110
32% identity, 58% coverage

A maltose-regulated large genomic region is activated by the transcriptional regulator MalT in Actinoplanes sp. SE50/110
Droste, Applied microbiology and biotechnology 2020
- “...deiminase Arginine biosynthesis ACSP50_8316 ACSP50_3922 Ornithine carbamoyltransferase Arginine biosynthesis ACSP50_4060 ACSP50_3923 Carbamate kinase Arginine biosynthesis ACSP50_6398 ACSP50_3924 Cyclic nucleotidebinding protein (phosphodiesterase) Put. serine/threonine biosynthesis ACSP50_3944 Beta-Ala-His dipeptidase Amino acid metabolism ACSP50_1214 ACSP50_3946 Amino acid permease Amino acid metabolism ACSP50_3948 Threonine/serine exporter family protein Serine/threonine biosynthesis ACSP50_3950...”

A0A3B6B442 Aspartate/glutamate/uridylate kinase domain-containing protein from Triticum aestivum
30% identity, 62% coverage

Comparative Physiological, Biochemical, and Leaf Proteome Responses of Contrasting Wheat Varieties to Drought Stress
Moloi, Plants (Basel, Switzerland) 2024
- “...Acid phosphatase, plant A0A3B6FKL0 Nucleoside phosphorylase domain-containing protein 1.66 0.27 3.78 10 3 Phosphorylase superfamily A0A3B6B442 Aspartate/glutamate/uridylate kinase domain-containing protein 1.92 0.34 4.08 10 2 Glutamate/acetylglutamate kinase A0A3B6TUD9 Thiamine thiazole synthase, chloroplastic 1.74 0.13 3.42 10 2 Thiamine thiazole synthase A0A3B6NHD8 O-methyltransferase ZRP4 1.56 0.41 3.89...”

CAC2389 Acetylglutamate kinase from Clostridium acetobutylicum ATCC 824
30% identity, 53% coverage

The Small RNA sr8384 Is a Crucial Regulator of Cell Growth in Solventogenic Clostridia
Yang, Applied and environmental microbiology 2020 (secret)
Capturing the response of Clostridium acetobutylicum to chemical stressors using a regulated genome-scale metabolic model
Dash, Biotechnology for biofuels 2014
- “...(ARGSL) CAC2390 N-acetyl-gamma-glutamyl-phosphate reductase Med CAC0974 Argininosuccinate lyase CAC2390 N-acetyl-gamma-glutamyl-phosphate reductase High CAC0974 Argininosuccinate lyase CAC2389 Acetylglutamate kinase (ACGK) Tertiary (K=3) Low CAC0973 Argininosuccinate synthase (ARGSS) CAC2389 Acetylglutamate kinase Med CAC0973 Argininosuccinate synthase CAC2389 Acetylglutamate kinase High CAC0973 Argininosuccinate synthase Quaternary (K=4) [minimal effect on biomass]...”
- “...synthase Secondary (K=2) Low No core set Med No core set High CAC0316 Ornithine carbamoyltransferase CAC2389 Acetylglutamate kinase Tertiary (K=3) Low No core set Med No core set High CAC0974 Argininosuccinate lyase Quaternary (K=4) Low No core set Med No core set High [minimal effect on...”
Meta-analysis and functional validation of nutritional requirements of solventogenic Clostridia growing under butanol stress conditions and coutilization of D-glucose and D-xylose
Heluane, Applied and environmental microbiology 2011
- “...CAC2024 0.009199846 E E E E E CAC2388 CAC2389 CAC2390 CAC2723 CAC2805 2.72258E05 0.000250975 0.003281643 0.002038606 0.000640894 E E E CAC3164 CAC3348 CAC3618...”
- “...E E E I I P P CAC2235 CAC2388 CAC2389 CAC2390 CAC2634 CAC2708 CAC2711 CAC2712 CAC3164 CAC3170 CAC3348 CAC3462 CAC3596 CAC3680 CAC3681 0.40506 1.51803 1.07553...”
The role of PerR in O2-affected gene expression of Clostridium acetobutylicum
Hillmann, Journal of bacteriology 2009
- “...Arginine biosynthesis CAC0316 CAC0376 CAC0973 CAC0974 CAC2388 CAC2389 CAC2390 CAC2391 Protein function COG class O2 sufB1 sufB2 Fe-regulated ABC-type...”
Genome-scale model for Clostridium acetobutylicum: Part I. Metabolic network resolution and analysis
Senger, Biotechnology and bioengineering 2008
- “...the N -acetyl- -phosphate-reductase (ArgC, EC 1.2.1.38, CAC2390) and the acetylglutamate kinase (ArgB, EC 2.7.2.8, CAC2389). This cycle results in the net production of 1 mole of l -glutamate per mole of l -ornithine processed by this pathway. The net biochemical reaction (not charge-balanced) of the...”
- “...for reactions catalyzed by glutamate dehydrogenase (EC 1.4.1.4, CAC0737) and acetylglutamate kinase (ArgB, EC 2.7.2.8, CAC2389), the proposed pathway requires significant concentration gradients to be thermodynamically feasible. The effect of the size of the l -glutamate solute pool is two-fold in this case. On one hand,...”

2bufC / Q9HTN2 Arginine feed-back inhibitable acetylglutamate kinase (see paper)
30% identity, 61% coverage

Ligand: adenosine-5'-diphosphate (2bufC)

A0A1D6E3W6 acetylglutamate kinase (EC 2.7.2.8) from Zea mays (see paper)
30% identity, 62% coverage

2ap9A / P9WQ01 Crystal structure of acetylglutamate kinase from mycobacterium tuberculosis cdc1551
34% identity, 64% coverage

Ligand: magnesium ion (2ap9A)

B6U787 Acetylglutamate kinase from Zea mays
30% identity, 62% coverage

Phosphoproteomic analysis of the response of maize leaves to drought, heat and their combination stress.
Hu, Frontiers in plant science 2015
- “...S xxxxxxxxxx BF4F7Z5; BF4F976; B4FI93; B4FRF2; B4FRV0; B4FUV7; B6SRZ6; B6SXN6; B6T1H0; B6T2A6; B6TDN3; B6TQS9; B6TWH2; B6U787; B8A0K2; C0HIM6; C0P3W9; C0P4D8; C0P9L7; C0PCR0; C0PDN0; C0PD30; K7TRK2; K7U573; K7V0H0; K7VBI0; K7VBA5; K7W2Z7; K7WC16; Q41729; Q9ATN2 11.33 31 132 55507 1013205 4.29 2 xxxxxxxxxx SP xxxxxxxxx B4FAA8; B4FAB7; B4G272;...”

BPSL0200 putative acetylglutamate kinase from Burkholderia pseudomallei K96243
30% identity, 54% coverage

RegAB Homolog of Burkholderia pseudomallei is the Master Regulator of Redox Control and involved in Virulence
Phenn, PLoS pathogens 2021
- “...The Tn 5 insertion in BPSL0201 occurred after nucleotide 242. Annotation of the neighboring genes: BPSL0200, acetylglutamate kinase [EC:2.7.2.8]; BPSL0203, ATP-dependent HslUV protease ATP-binding subunit HslU. S1C: Mice (n = 10) were intravenously infected with low doses (200 CFU) of all strains and mortality curves were...”

ARGB_MYCTU / P9WQ01 Acetylglutamate kinase; N-acetyl-L-glutamate 5-phosphotransferase; NAG kinase; NAGK; EC 2.7.2.8 from Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
BCG_1693 putative Acetylglutamate kinase argB from Mycobacterium bovis BCG str. Pasteur 1173P2
Rv1654 acetylglutamate kinase from Mycobacterium tuberculosis H37Rv
34% identity, 63% coverage

function: Catalyzes the ATP-dependent phosphorylation of N-acetyl-L- glutamate.
catalytic activity: N-acetyl-L-glutamate + ATP = N-acetyl-L-glutamyl 5-phosphate + ADP (RHEA:14629)
subunit: Homohexamer.
Comparison of the transcriptome, lipidome, and c-di-GMP production between BCGΔBCG1419c and BCG, with Mincle- and Myd88-dependent induction of proinflammatory cytokines in murine macrophages
Flores-Valdez, Scientific reports 2024
- “...Possible conserved secreted protein 0.8313 0.005587559 lipR BCG_3109 Rv3084 Probable acetyl-hydrolase/esterase lipR 0.828 0.010400861 argB BCG_1693 Rv1654 Probable Acetylglutamate kinase argB 0.8205 0.003955123 ArgR regulon BCG_0699 BCG_0699 Rv0650 Possible sugar kinase with ROK family protein domain 0.8087 0.027255813 BCG_1762 BCG_1762 Rv1723 Probable hydrolase with CubicO group...”
InbR, a TetR family regulator, binds with isoniazid and influences multidrug resistance in Mycobacterium bovis BCG
Yang, Scientific reports 2015
- “...sigI RNA polymerase sigma factor SigI 15 BCG_1692 2.18 Rv1653 argJ bifunctional ornithine acetyltransferase/N-acetylglutamate synthase BCG_1693 2.34 Rv1654 argB acetylglutamate kinase BCG_1694 2.34 Rv1655 argD acetylornithine aminotransferase NA BCG_1695 1.32 Rv1656 argF ornithine carbamoyltransferase BCG_1696 1.13 Rv1657 argR arginine repressor 16 BCG_2047c 1.94 2.94 Rv2028c hypothetical...”
Loss of glycerol catabolism confers carbon-source-dependent artemisinin resistance in Mycobacterium tuberculosis
Martini, Antimicrobial agents and chemotherapy 2024 (secret)
Comparison of the transcriptome, lipidome, and c-di-GMP production between BCGΔBCG1419c and BCG, with Mincle- and Myd88-dependent induction of proinflammatory cytokines in murine macrophages
Flores-Valdez, Scientific reports 2024
- “...conserved secreted protein 0.8313 0.005587559 lipR BCG_3109 Rv3084 Probable acetyl-hydrolase/esterase lipR 0.828 0.010400861 argB BCG_1693 Rv1654 Probable Acetylglutamate kinase argB 0.8205 0.003955123 ArgR regulon BCG_0699 BCG_0699 Rv0650 Possible sugar kinase with ROK family protein domain 0.8087 0.027255813 BCG_1762 BCG_1762 Rv1723 Probable hydrolase with CubicO group peptidase,...”
Role of C-terminal domain of Mycobacterium tuberculosis PE6 (Rv0335c) protein in host mitochondrial stress and macrophage apoptosis
Medha,, Apoptosis : an international journal on programmed cell death 2023
- “...C and intracellular ATP. Similar observations were reported with other Mtb proteins such as HBHA, Rv1654, Rv0674 and Rv3261c which targeted and disrupted host mitochondrial integrity [ 47 51 ]; though the role of C-terminal domain in causing mitochondrial stress have not been investigated. Interestingly, mitochondrial...”
- “...Cell Immunol 2020 354 104145 10.1016/j.cellimm.2020.104145 32569876 50. Lee K-I Choi S Choi H-G Recombinant Rv1654 protein of Mycobacterium tuberculosis induces mitochondria-mediated apoptosis in macrophage Microbiol Immunol 2021 65 178 188 10.1111/1348-0421.12880 33565648 51. Dubey RK Dhamija E Kumar Mishra A Mycobacterial origin protein Rv0674 localizes...”
Recombinant Rv1654 protein of Mycobacterium tuberculosis induces mitochondria-mediated apoptosis in macrophage
Lee, Microbiology and immunology 2021 (PubMed)
- “...diverse immunologically active components. This study investigated the biological function of a newly identified component, Rv1654, with the potential to induce apoptosis in macrophages. Recombinant Rv1654 induced macrophage apoptosis in a caspase-9/3-dependent manner through the production of reactive oxygen species (ROS) and interaction with Toll-like receptor...”
- “...was inhibited by the JNK inhibitor. Moreover, it was found that treatment of macrophages with Rv1654 led to the loss of mitochondrial membrane potential, release of cytochrome c into the cytosol, and translocation of Bax into the mitochondria. Finally, Rv1654-mediated apoptosis was inhibited in macrophages transfected...”
Quantitative proteomics reveals that dormancy-related proteins mediate the attenuation in mycobacterium strains
Wang, Virulence 2021
- “...synthesis proteins were significantly upregulated in the BCG strain, namely, ArgC (Rv1652), ArgJ (Rv1653), ArgB (Rv1654), ArgD (Rv1655), ArgF (Rv1656), ArgR (Rv1657), ArgG (Rv1658), and ArgH (Rv1659), which may indicate that the H37Rv and H37Ra strains experience a deficiency in arginine during the stationary phase. The...”
TB or not to be: what specificities and impact do antibodies have during tuberculosis?
Hermann, Oxford open immunology 2021
- “...regulator protein x MT3959 Putative uncharacterized protein x Rv2564 Uncharacterized ABC transporter ATP-binding protein x Rv1654 Acetylglutamate kinase x Rv0440 60 kDa chaperonin 2 x Rv2853 PE-PGRS family protein PE_PGRS48 x MT3033 Uncharacterized protein x Rv3810 Exported repetitive protein precursor x Rv0109 E-PGRS family protein PE_PGRS1...”
Potency Increase of Spiroketal Analogs of Membrane Inserting Indolyl Mannich Base Antimycobacterials Is Due to Acquisition of MmpL3 Inhibition
Li, ACS infectious diseases 2020
- “...: G2524A/A842T M3 6.6 T862A/S288T - M4 4.5 T959C/L320P Rv1744c : G194A/G65D M5 4.6 G1772T/S591I Rv1654 (argB) : C197G/D99E M6 4.5 T959C/L320P - M7 6.3 G1772T/S591I Rv1654 (argB) : C197G/D99E a M1 to M5 mutant strains were isolated from one selection experiment, whereas M6 and M7...”
Comprehensive analysis of protein acetyltransferases of human pathogen Mycobacterium tuberculosis
Xie, Bioscience reports 2019
- “...other mycobacteria, even Rhodococcus and Streptomyces. For example, the adjacent genes of Rv1653c including Rv1652, Rv1654, Rv1655, and Rv1656 are highly conserved in M. leprae TN, M. smegmatis str. mc 2 155, M. avium 104, Rhodococcus sp.RHA1, and Streptomyces avermitilis MA-4680 (Supplementary Figure S2). However, the...”
More

BOW65_RS28295 acetylglutamate kinase from Pseudomonas koreensis
29% identity, 62% coverage

Bacterial Analogs of Plant Tetrahydropyridine Alkaloids Mediate Microbial Interactions in a Rhizosphere Model System
Lozano, Applied and environmental microbiology 2019
- “...Cell surface 9 BOW65_RS22455 Peptidoglycan-associated lipoprotein Cell surface 10 BOW65_RS29255 Phospholipid/glycerol acyltransferase Cell surface 11 BOW65_RS28295 Acetylglutamate kinase Metabolism 12 BOW65_RS08620 Methylcitrate synthase Metabolism 13 BOW65_RS24475 Ketol-acid reductoisomerase Metabolism 14 BOW65_RS07790 Succinyl-CoA synthetase subunit alpha Metabolism 15 BOW65_RS08625 2-Methylisocitrate dehydratase Metabolism 16 a BOW65_RS24600 3-Methyl-2-oxobutanoate hydroxymethyltransferase...”

Q85FW5 Acetylglutamate kinase from Cyanidioschyzon merolae (strain NIES-3377 / 10D)
31% identity, 59% coverage

The crystal structure of the complex of PII and acetylglutamate kinase reveals how PII controls the storage of nitrogen as arginine
Llácer, Proceedings of the National Academy of Sciences of the United States of America 2007
- “...and Cyanidioschyzon merolae (Swiss-Prot files Q6B8Z0 and Q85FW5, respectively) have no PII gene in their chloroplast genomes (National Center for Biotechnology...”

Pput_5198 acetylglutamate kinase from Pseudomonas putida F1
PP_5289 acetylglutamate kinase from Pseudomonas putida KT2440
30% identity, 61% coverage

iTRAQ-based quantitative proteomic analysis of the global response to 17β-estradiol in estrogen-degradation strain Pseudomonas putida SJTE-1
Xu, Scientific reports 2017
- “...0.005 gi|148546266 Aminomethyltransferase Pput_1023 1.65 0.032 gi|148545429 Acetyl-CoA hydrolase Pput_0172 1.94 0.029 gi|148550398 Acetylglutamate kinase Pput_5198 0.63 0.004 gi|148546291 6-phosphogluconate dehydratase Pput_1048 0.44 0.000 gi|148549733 Methylmalonate-semialdehyde dehydrogenase Pput_4531 1.57 0.002 gi|148550491 Glutaminefructose-6-phosphate aminotransferase Pput_5291 1.66 0.028 gi|148549700 Acetyl-CoA acetyltransferase Pput_4498 2.24 0.029 gi|148546692 Branched-chain alpha-keto acid...”
Experimental and Analytical Approaches for Improving the Resolution of Randomly Barcoded Transposon Insertion Sequencing (RB-TnSeq) Studies
Borchert, ACS synthetic biology 2022
- “...trimmed and nontrimmed data sets ( Table 1 , File S1 ). Interestingly, two loci (PP_5289 and PP_5185) showed conflicting fitness changes, depending on the trimming method used ( Figure S2 ). Additionally, trimming 5% from both ends showed fitness differences > |1| only for two...”
Arginine Biosynthesis Modulates Pyoverdine Production and Release in Pseudomonas putida as Part of the Mechanism of Adaptation to Oxidative Stress
Barrientos-Moreno, Journal of bacteriology 2019 (secret)
A genome-scale metabolic reconstruction of Pseudomonas putida KT2440: iJN746 as a cell factory
Nogales, BMC systems biology 2008
- “...conditions. Amino acid PP gene gene Reaction iJN746/PA01 (growth) Arginine PP_5185(PP_1346) argA,(argJ) ACGS,(ORNTAC, ACGS) (+/-)* PP_5289 argB ACGK (-/-) PP_3633 argC AGPR (-/-) PP_5186,(PP_1346) argE,(argJ) ACODA(ORNTAC, ACGS) (+/-)* PP_1088 argG ARGSS (-/-) PP_0184 argH ARGSL (-/-) PP_1346 argJ ORNTAC, ACGS (+/-)* Histidine PP_0292 hisA PRMICIi (-/-)...”

MSMEG_3774 acetylglutamate kinase from Mycolicibacterium smegmatis MC2 155
MSMEG_3774 acetylglutamate kinase from Mycobacterium smegmatis str. MC2 155
33% identity, 63% coverage

Elucidating the role of c-di-AMP in Mycobacterium smegmatis: Phenotypic characterization and functional analysis
Chaudhary, Heliyon 2023
- “...protein 3.12 0.024 14 Arginine biosynthetic process argF (MSMEG_3772) Ornithine carbamoyltransferase 1.12 0.033 15 argB (MSMEG_3774) Acetylglutamate kinase 1.17 0.025 16 argD (MSMEG_3773) Acetylornithine aminotransferase 1.25 0.049 Table 2 Genes under several main categories are listed which are significantly downregulated in M. smegmatis pde strain compared...”
Protein Composition of Mycobacterium smegmatis Differs Significantly Between Active Cells and Dormant Cells With Ovoid Morphology
Trutneva, Frontiers in microbiology 2018
- “...MSMEG_0956, and MSMEG_2780), leucine synthesis (MSMEG_6271 and MSMEG_2379) and arginine synthesis (MSMEG_3769, MSMEG_3770, MSMEG_3773, and MSMEG_3774). Dormant cells evidently accumulate storage materials: we found several enzymes responsible for the synthesis and accumulation of glycogen (MSMEG_4918), trehalose (MSMEG_6514 and MSMEG_6515 unique; Supplementary Table S2 ) and polyphosphates...”

RLV_2815 acetylglutamate kinase from Rhizobium leguminosarum bv. viciae
31% identity, 60% coverage

A microaerobically induced small heat shock protein contributes to Rhizobium leguminosarum/Pisum sativum symbiosis and interacts with a wide range of bacteroid proteins
Domingo-Serrano, Applied and environmental microbiology 2025
- “...complex 76 42 177 11 RLV_6686 Succinate-CoA ligase (ADP-forming) subunit beta 73 47 105 44 RLV_2815 Acetylglutamate kinase 71 50 33 287 DNA replication-, transcription-, and translation-related proteins RLV_4236 Elongation factor Tu 288 12 135 22 RLV_6794 50S ribosomal protein L19 159 23 86 59 RLV_4269...”

MT1692 acetylglutamate kinase from Mycobacterium tuberculosis CDC1551
34% identity, 63% coverage

Enhanced specialized transduction using recombineering in Mycobacterium tuberculosis
Tufariello, mBio 2014
- “...Rv3602c [ MT3707 ]), leuD ( Rv2987c [ MT3065 ]), and argB ( Rv1654 [ MT1692 ]), to induce auxotrophy for serine, methionine, pantothenate, leucine and arginine, respectively (see TableS2 in the supplemental material for sequences of primers used in cloning flanks for construction of AESs...”
Novel mass spectrometry-based tool for genotypic identification of mycobacteria
Lefmann, Journal of clinical microbiology 2004
- “...MT1881 MT2544 MT1619 MT3065 MT1423 MT3344 MT1551 MT1598 MT1692 MT1905 MT2068 MT2125 MT2271 MT2924 MT309 MT2236 a Species determined by partial 16S rDNA...”

SPO0526 acetylglutamate kinase from Ruegeria pomeroyi DSS-3
30% identity, 62% coverage

Experimental Identification of Small Non-Coding RNAs in the Model Marine Bacterium Ruegeria pomeroyi DSS-3
Rivers, Frontiers in microbiology 2016
- “...trans49 124 SPO1050 Phage integrase family site specific recombinase Phage 0.001 SPO0323 Hypothetical protein 0.001 SPO0526 Acetylglutamate kinase Amino acid metabolism 0.002 SPO3390 Hypothetical protein 0.003 SPO2630 C4-dicarboxylate transport sensor protein Transport 0.006 SPO1884 Methionine synthase I Amino acid metabolism 0.009 SPO3077 TldD/PmbA family protein 0.009...”

Q39BX5 Acetylglutamate kinase from Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
30% identity, 54% coverage

Proteomic profiling of Burkholderia cenocepacia clonal isolates with different virulence potential retrieved from a cystic fibrosis patient during chronic lung infection
Madeira, PloS one 2013
- “...1.4 0.017 Amino acid metabolism 16 Q1BHV4 BCAL2213 Oligopeptidase A 2.5 1.4 0.6 0.009 36 Q39BX5 BCAL0496 argB Acetylglutamate kinase 1.6 1.1 0.7 0.002 37 Q39BX5 BCAL0496 argB Acetylglutamate kinase 2.4 1.3 0.6 <0.001 52 A2VXX6 BCAL1874 hisZ ATP phosphoribosyltransferase regulatory subunit 2.2 1.7 0.8 <0.001...”

BCAL0496 putative acetylglutamate kinase from Burkholderia cenocepacia J2315
30% identity, 54% coverage

Proteomic profiling of Burkholderia cenocepacia clonal isolates with different virulence potential retrieved from a cystic fibrosis patient during chronic lung infection
Madeira, PloS one 2013
- “...0.017 Amino acid metabolism 16 Q1BHV4 BCAL2213 Oligopeptidase A 2.5 1.4 0.6 0.009 36 Q39BX5 BCAL0496 argB Acetylglutamate kinase 1.6 1.1 0.7 0.002 37 Q39BX5 BCAL0496 argB Acetylglutamate kinase 2.4 1.3 0.6 <0.001 52 A2VXX6 BCAL1874 hisZ ATP phosphoribosyltransferase regulatory subunit 2.2 1.7 0.8 <0.001 90...”
Genome-scale NCRNA homology search using a Hamming distance-based filtration strategy
Sun, BMC bioinformatics 2012
- “...3278580 3278849 0.52 0.022 BCAL2989 BCAL2990 50 53 2 0.38 2538 548365 548654 0.42 0 BCAL0496 BCAL0497 55 267 All of them are conserved in R. solanacearum. "PLAST" refers to PLAST-ncRNA. "FA" stands for FOLDALIGN. 5' D and 3' D contain the distances to the 5'...”

AZL_005260 acetylglutamate kinase from Azospirillum sp. B510
30% identity, 63% coverage

The N-Acetylglutamate Synthase Family: Structures, Function and Mechanisms
Shi, International journal of molecular sciences 2015
- “...(R66D, N158G, K217T, E. coli NAGK numbering). Instead, a protein encoded by a different gene (AZL_005260) performs the NAGK function. In the Haliangium ochraceum genome, where there is a separate gene (Hoch_4935) for a bacterial-type NAGK, the gene for NAGS appears fused to the argC gene...”

SGO_1567 acetylglutamate kinase from Streptococcus gordonii str. Challis substr. CH1
31% identity, 50% coverage

Regulation of gene expression in a mixed-genus community: stabilized arginine biosynthesis in Streptococcus gordonii by coaggregation with Actinomyces naeslundii
Jakubovics, Journal of bacteriology 2008
- “...SGO_0178 SGO_0177 SGO_0176 SGO_0175 SGO_1716 SGO_1590 SGO_1569 SGO_1568 SGO_1567 SGO_1566 SGO_1109 SGO_1108 SGO_1104 SGO_1103 a b c spxB bfbF bfbG bfbB bfbR...”

MAP_RS06925 acetylglutamate kinase from Mycobacterium avium subsp. paratuberculosis K-10
32% identity, 63% coverage

Delineating transcriptional crosstalk between Mycobacterium avium subsp. paratuberculosis and human THP-1 cells at the early stage of infection via dual RNA-seq analysis
Park, Veterinary research 2022
- “...was slightly upregulated (Figure 5 A). Genes downregulated in the arginine biosynthesis pathway included argB (MAP_RS06925), argC (MAP_RS06915), argD (MAP_RS06930), argF (MAP_RS06935), argG (MAP_RS06945), argH (MAP_RS06950), and argJ (MAP_RS06920). Meanwhile, host arginine and proline metabolism-related gene sets were downregulated (Figure 5 B). This pathway included genes...”

P69365 Acetylglutamate kinase from Porphyra purpurea
32% identity, 52% coverage

Interaction of N-acetyl-l-glutamate kinase with the PII signal transducer in the non-photosynthetic alga Polytomella parva: Co-evolution towards a hetero-oligomeric enzyme
Selim, The FEBS journal 2020
- “...Physcomitrella patens (A0 JC 02) and Arabidopsis thaliana (Q9 SCL 7), red algae Porphyra purpurea (P69365), cyanobacteria Synechococcus elongatus PCC 7942 (Q6V1L5) and Synechocystis sp. PCC 6803 (P73326), and bacteria Thermotoga maritima (Q9X2A4) and Escherichiacoli (P0A6C8). Highlighted residues in black are invariant in at least 55%...”

BAB2_0988 Aspartate/glutamate/uridylate kinase:Acetylglutamate kinase from Brucella melitensis biovar Abortus 2308
30% identity, 61% coverage

Proteomics-based confirmation of protein expression and correction of annotation errors in the Brucella abortus genome
Lamontagne, BMC genomics 2010
- “...AspS BAB1_1256 RpsJ; S10 BAB1_2080 HslU BAB2_0976 AldB BAB1_0780 HemB BAB1_1266 RplJ; L10 BAB1_2081 HslV BAB2_0988 ArgB BAB1_0787 GlyA BAB1_1280 Unknown BAB1_2087 HisE BAB2_0990 Unknown BAB1_0789 RibD BAB1_1286 GloA BAB1_2096 PTS system IIA BAB2_0991 DapD BAB1_0790 RibE BAB1_1294 Aminotransferase subunit BAB2_0993 DapE BAB1_0813 CysD BAB1_1297 Unknown...”

2bufK / Q9HTN2 Arginine feed-back inhibitable acetylglutamate kinase (see paper)
31% identity, 63% coverage

Ligand: n-acetyl-l-glutamate (2bufK)

BMEII0273 ACETYLGLUTAMATE KINASE from Brucella melitensis 16M
30% identity, 61% coverage

Comparative proteome analysis of Brucella melitensis vaccine strain Rev 1 and a virulent strain, 16M
Eschenbrenner, Journal of bacteriology 2002
- “...BMEI1980 BMEI0010 BMEII0487 BMEI1950 BMEI0124 BMEI0868 BMEI0536 BMEII1092 BMEII0273 5.23 5.10 5.32 5.55 5.52 5.19 5.61 5.37 5.44 5.07 5.40 5.68 5.24 5.68 5.30...”

argB / AAA22198.1 acetylglutamate kinase from Geobacillus stearothermophilus (see paper)
32% identity, 59% coverage

GL331_10535 acetylglutamate kinase from Bacillus velezensis
35% identity, 50% coverage

Surfactin Stimulated by Pectin Molecular Patterns and Root Exudates Acts as a Key Driver of the Bacillus-Plant Mutualistic Interaction
Hoff, mBio 2021
- “...100 85.04 Unknown Unknown GL331_10530 argJ 3.852 99 94.82 99 77.23 Metabolism Biosynthesis of arginine GL331_10535 argB 5.39 100 91.51 100 71.5 GL331_10540 argD 4.64 100 93.96 96 74.62 GL331_10545 carA 5.726 100 93.48 100 73.46 GL331_10715 cwlQ 3.67 100 92.43 75 77.02 Cell wall Bifunctional...”

L0107 acetylglutamate kinase (EC 2.7.2.8) from Lactococcus lactis subsp. lactis Il1403
31% identity, 63% coverage

Evolution of mosaic operons by horizontal gene transfer and gene displacement in situ
Omelchenko, Genome biology 2003
- “...maritima TM1243-1251 Nucleotide metabolism TM1243 Archaea Phosphoribosylaminoimidazole-succinocarboxamide synthase Cluster 42 Lactococcus lactis L0104-0108 Arginine biosynthesis L0107 Gram-negative bacteria Acetylglutamate kinase Thermotoga maritima TM1780-1785 Arginine biosynthesis TM1784 Archaea Acetylglutamate kinase Cluster 48 Borrelia burgdorferi BB0054-0061 Carbohydrate metabolism (glycolysis, gluconeogenesis) BB0057 Gram-positive bacteria Glyceraldehyde-3-phosphate dehydrogenase Cluster 54 Thermotoga...”

SO0276 acetylglutamate kinase from Shewanella oneidensis MR-1
32% identity, 49% coverage

Transcriptome analysis reveals a stress response of Shewanella oneidensis deprived of background levels of ionizing radiation
Castillo, PloS one 2018
- “...10 kDa chaperonin-1.371.16 SO0704 groEL 60 kDa chaperonin-1.49 SO1126 dnaK Chaperone-1.29 Biosynthesis of amino acids SO0276 argB Acetylglutamate kinase 1.00 SO0279 argH Argininosuccinate lyase 1.10 SO0818 metE Homocysteine methyltransferase 1.13 1.32 SO1361 aroF Phospho-2-dehydro-3-deoxyheptonate aldolase 1.01 SO1770 garK Glycerate kinase 1.01 SO2074 hisG ATP phosphoribosyltransferase 1.11...”

ATE50_RS13995 acetylglutamate kinase from Bacillus velezensis
35% identity, 50% coverage

Effects of Bacillus velezensis FKM10 for Promoting the Growth of Malus hupehensis Rehd. and Inhibiting Fusarium verticillioides
Wang, Frontiers in microbiology 2019
- “...carbamoyltransferase OTC, argF, argI 5.02 ATE50_RS14005 N-acetyl-gamma-glutamyl-phosphate reductase argC 3.25 ATE50_RS18085 Glutaminase glsA, GLS 3 ATE50_RS13995 Acetylglutamate kinase argB 3.37 ATE50_RS13990 Aspartate aminotransferase family protein argD 4.03 ATE50_RS06350 Argininosuccinate lyase argH, ASL 3.65 ATE50_RS06345 Argininosuccinate synthase argG, ASS1 3.02 ATE50_RS02030 Glutamate dehydrogenase gudB, rocG 2.69 ATE50_RS14000...”

CCNA_00285 acetylglutamate kinase from Caulobacter crescentus NA1000
29% identity, 64% coverage

Transposon Mutagenesis Paired with Deep Sequencing of Caulobacter crescentus under Uranium Stress Reveals Genes Essential for Detoxification and Stress Tolerance
Yung, Journal of bacteriology 2015
- “...Cadmium library CCNA_00080 CCNA_03858 CCNA_03624 CCNA_00285 CCNA_01379 CCNA_03625 CCNA_03498 CCNA_01521 CCNA_00290 CCNA_02552 CCNA_02553 CCNA_02140 CCNA_01067...”
The complex logic of stringent response regulation in Caulobacter crescentus: starvation signalling in an oligotrophic environment
Boutte, Molecular microbiology 2011
- “...NA1000 proC hMu CCNA_00528 ( Huitema et al , 2006 ) 1163 NA1000 argB hMu CCNA_00285 ( Huitema et al , 2006 ) 1144 NA1000 ilvB tn5 CCNA_02185 ( Huitema et al , 2006 ) 314 NA1000 leuC hMu CCNA_00196 ( Huitema et al , 2006...”

Q6R6P5 acetylglutamate kinase (EC 2.7.2.8) from Corynebacterium crenatum (see paper)
cg1582 acetylglutamate kinase from Corynebacterium glutamicum ATCC 13032
NCgl1342 acetylglutamate kinase from Corynebacterium glutamicum ATCC 13032
32% identity, 59% coverage

Discovery of novel amino acid production traits by evolution of synthetic co-cultures
Zuchowski, Microbial cell factories 2023
- “...[ 9 ] C1*LEUARG ++ C1* LEU ARG + with point mutations ArgB A26V M31V (Cg1582) [ 9 ] C1*LEUARG ++ ::P tac - eyfp (LEUARG ++ ) C1*LEUARG ++ with eyfp under control of P tac integrated into the IGR between cg1121 and cg1122 This...”
- “...of leuA (cg0303), leuC (cg1487), leuD (cg1488), leuB (cg1453), with point mutations ArgB A26V M31V (Cg1582) and eyfp under control of P tac integrated into the IGR between cg1121 and cg1122 This work CoNoS evolution Adaptive laboratory evolution (ALE)was performed using the Mini Pilot Plant described...”
Functional Genomics Uncovers Pleiotropic Role of Rhomboids in Corynebacterium glutamicum
Luenenschloss, Frontiers in microbiology 2022
- “...40C, aspartate-semialdehyde dehydrogenase (Cg0307) at 30C, homoserine dehydrogenase (Cg1337) at 30 and 40C, acetylglutamate kinase (Cg1582) in the CF and MF at 30C and argininosuccinate synthase (Cg1586) in the MF at 30 and 40C. Larger amounts of homocysteine methyltransferase (Cg1290), participating in methionine biosynthesis, were found...”
Acetohydroxyacid synthase, a novel target for improvement of L-lysine production by Corynebacterium glutamicum
Blombach, Applied and environmental microbiology 2009
- “...Amino acid biosynthesis cg1290 cg1436 cg1437 cg1487 cg1580 cg1582 cg1583 cg1584 cg1739 426 BLOMBACH ET AL. ACKNOWLEDGMENTS We thank Lothar Eggeling for...”
Citrate utilization by Corynebacterium glutamicum is controlled by the CitAB two-component system through positive regulation of the citrate transport genes citH and tctCBA
Brocker, Journal of bacteriology 2009
- “...cg1379 cg1380 cg3226 cg3227 cg3308 cg0810 cg1628 cg1581 cg1582 cg1583 cg3026 cg3027 cg3028 cg3029 cg1156 cg1451 cg0576 cg2894 cg1364 cg2157 cg1151 cg1386 cg0653...”
Functional genomics of pH homeostasis in Corynebacterium glutamicum revealed novel links between pH response, oxidative stress, iron homeostasis and methionine synthesis
Follmann, BMC genomics 2009
- “...N-acetyltransferase 0 2.03 -0.02 5.8 5.0 5.2 2.8 2.1 2.1 - - - ArgR 32 cg1582 v argB Acetylglutamate kinase 0 1.84 n.d. 1.1 - -0.8 3.1 - 0.0 - - - ArgR 33 cg1583 v argD Acetylornithine aminotransferase 0 1.66 n.d. 1.9 0.9 0.2 -...”
Adaptation of Corynebacterium glutamicum to ammonium limitation: a global analysis using transcriptome and proteome techniques
Silberbach, Applied and environmental microbiology 2005
- “...cg0303 cg0873 cg1129 cg1333 cg1334 cg1338 cg1580 cg1581 cg1582 cg1583 cg1584 cg1585 cg1586 cg1588 cg1697 cg2391 cg2900 codAb ureA ureB ureC ureE ureF ureG...”
High-yield production of L-serine through a novel identified exporter combined with synthetic pathway in Corynebacterium glutamicum
Zhang, Microbial cell factories 2020
- “...5.12 Ornithine carbamoyltransferase NCgl1343 280.65 57.24 4.9 Acetylornithine aminotransferase NCgl0746 43.30 9.04 4.7 Hypothetical protein NCgl1342 134.70 29.07 4.63 Acetylglutamate kinase NCgl2946 672.93 155.87 4.31 Hypothetical protein NCgl1022 89.53 21.28 4.20 Cysteine sulfinate desulfinase NCgl1023 368.88 88.67 4.15 Nicotinate-nucleotide pyrophosphorylase NCgl1341 108.49 27.09 4.00 Bifunctional ornithine...”
PII Signal Transduction Protein GlnK Alleviates Feedback Inhibition of N-Acetyl-l-Glutamate Kinase by l-Arginine in Corynebacterium glutamicum
Xu, Applied and environmental microbiology 2020 (secret)
Recent Advances of L-ornithine Biosynthesis in Metabolically Engineered Corynebacterium glutamicum
Wu, Frontiers in bioengineering and biotechnology 2019
- “...of N-acetylglutamate synthase (encoded by cg3035 / NCgl2644 ), N-acetylglutamate kinase (encoded by argB / NCgl1342 ), N-acetyl-gamma-glutamyl-phosphate reductase (encoded by argC / NCgl1340 ), acetylornithine aminotransferase (encoded by argD / NCgl1343 ), and ornithine acetyltransferase (encoded by argJ / NCgl1341 ). Additionally, L-ornithine can be...”
Citrate utilization by Corynebacterium glutamicum is controlled by the CitAB two-component system through positive regulation of the citrate transport genes citH and tctCBA
Brocker, Journal of bacteriology 2009
- “...NCgl2816 NCgl2817 NCgl2881 NCgl0676 NCgl1383 NCgl1341 NCgl1342 NCgl1343 NCgl2635 NCgl2636 NCgl2637 NCgl2638 NCgl0975 NCgl1235 NCgl0471 NCgl2523 NCgl1161...”
Adaptation of Corynebacterium glutamicum to ammonium limitation: a global analysis using transcriptome and proteome techniques
Silberbach, Applied and environmental microbiology 2005
- “...NCgl0950 NCgl1132 NCgl1133 NCgl1137 NCgl1340 NCgl1341 NCgl1342 NCgl1343 NCgl1344 NCgl1345 NCgl1346 NCgl1347 NCgl1446 NCgl2098 NCgl2528 cg0104 cg0113 cg0114...”
Global expression profiling and physiological characterization of Corynebacterium glutamicum grown in the presence of L-valine
Lange, Applied and environmental microbiology 2003
- “...aminotransferase argD (C. glutamicum) e 2627 NCgl1342 Acetylglutamate kinase argB (C. glutamicum) 2628e NCgl1341 Glutamate N-acetyltransferase argJ (C....”

Q59281 acetylglutamate kinase (EC 2.7.2.8) from Corynebacterium glutamicum (see paper)
32% identity, 59% coverage

SLUN_RS38470 acetylglutamate kinase from Streptomyces lunaelactis
32% identity, 58% coverage

Lunaemycins, New Cyclic Hexapeptide Antibiotics from the Cave Moonmilk-Dweller Streptomyces lunaelactis MM109^T
Martinet, International journal of molecular sciences 2023
- “...RS38475 homologous to StenL, Figure 1 , Table 1 ), lun13 for the N-acetylglutamate kinase (SLUN_RS38470 homologous to StenK and HmtB, Figure 1 , Table 1 ), lun11 for the N-acetyl-gamma-glutamyl-phosphate reductase (SLUN_RS38460 homologous to StenM, Figure 1 , Table 1 ), and lun12 for the...”
- “...StenJ, N(2)-acetyl-L-ornithine:2-oxoglutarate aminotransferase (ArgD), stenothricin BGC from Streptomyces roseosporus NRRL 15998 (EFE73302.1) 72/94 L-ornithine synthesis SLUN_RS38470 WP_108155198.1 Lun13 300 StenK, N-acetylglutamate kinase (ArgB), stenothricin BGC from Streptomyces roseosporus (EFE73303.1) 81/97 L-ornithine synthesis SLUN_RS38475 WP_108155199.1 Lun14 384 StenL, bifunctional N(2)-acetyl-L-ornithine:L-glutamate N-acetyltransferase (ArgJ), stenothricin BGC from Streptomyces roseosporus...”

BP9_03645 acetylglutamate kinase from Bacillus paralicheniformis
34% identity, 51% coverage

Comprehensive genomic analysis of Bacillus paralicheniformis strain BP9, pan-genomic and genetic basis of biocontrol mechanism
Asif, Computational and structural biotechnology journal 2023
- “...BP9_03858, BP9_03859, BP9_03860, BP9_03861) ( C ) and bacitracin cluster specific proteins (BP9_03648, BP9_03647, BP9_03646, BP9_03645, BP9_03644). Fig. 7 2.6 Pan Genome Analysis of paralicheniformis strains B. paralicheniformis genomes used in the pan-genome analysis are listed in Table S3 . Pan-genome analysis was carried out by...”

SSA_0759 Acetylglutamate kinase, putative from Streptococcus sanguinis SK36
30% identity, 50% coverage

Transcriptome, Phenotypic, and Virulence Analysis of Streptococcus sanguinis SK36 Wild Type and Its CcpA-Null Derivative (ΔCcpA)
Bai, Frontiers in cellular and infection microbiology 2019
- “...SSA_2364 2,107.33 1,058.92 1.35 0.00000 c185_g185 SSA_2371 215.79 93.91 1.52 0.00001 c184_g230 b , c SSA_0759 35.82 2.48 3.58 0.00001 c184_g222 SSA_2242 522.98 169.18 1.70 0.00001 c185_g110 b , c SSA_0860 2,286.06 878.21 1.48 0.00001 c185_g14 SSA_0848 a 3,980.18 1,824.31 1.29 0.00002 c185_g95 SSA_0195 93.96 32.03...”
Systematic study of genes influencing cellular chain length in Streptococcus sanguinis
Evans, Microbiology (Reading, England) 2014
- “...displaying shorter chains in their mutants with upregulated gene expressions in Ssx_1972. These genes were SSA_0759, SSA_0760, SSA_1715, SSA_1897, SSA_2117, SSA_2141, SSA_2159 and SSA_2337. All positively and negatively related genes should contribute to the cellular chain length of Ssx_1972. However, there were also downregulated genes showing...”
- “...Y SSA_0142 Hypothetical protein SSA_0142 0.4440 0.1035 Y SSA_2077 Hypothetical protein SSA_2077 0.4932 0.0512 Y SSA_0759 argB Acetylglutamate kinase 3.1950 0.6376 Y SSA_0760 Acetylornithine aminotransferase 9.4869 4.9372 Y SSA_1715 serC Phosphoserine aminotransferase 2.0630 1.0319 Y SSA_1897 Hypothetical protein SSA_1897 2.2604 0.6261 Y SSA_2117 rmuC DNA recombination...”

CNAG_02826 amino-acid acetyltransferase, mitochondrial from Cryptococcus neoformans var. grubii H99
26% identity, 64% coverage

Antifungal Mechanism of Action of Lauryl Betaine Against Skin-Associated Fungus Malassezia restricta
Do, Mycobiology 2019
- “...variant CNAG_02568 UBA/TS-N domain-containing protein CNAG_02702 CLC1 Putative voltage-gated chloride channel CNAG_02795 Phosphoribosyl glycinamide formyltransferase CNAG_02826 Mitochondrial amino-acid acetyltransferase CNAG_02905 Hypothetical protein CNAG_03235 THO complex subunit 1 CNAG_03269 Aldehyde dehydrogenase CNAG_03325 ChAPs family protein CNAG_03333 Cytoplasmic protein CNAG_03348 Hypothetical protein CNAG_03370 Calcium-binding protein NCS-1 CNAG_03380 Hypothetical...”

Q6B8Z0 Acetylglutamate kinase from Gracilaria tenuistipitata var. liui
28% identity, 61% coverage

The crystal structure of the complex of PII and acetylglutamate kinase reveals how PII controls the storage of nitrogen as arginine
Llácer, Proceedings of the National Academy of Sciences of the United States of America 2007
- “...Gracilaria tenuistipitata and Cyanidioschyzon merolae (Swiss-Prot files Q6B8Z0 and Q85FW5, respectively) have no PII gene in their chloroplast genomes (National...”

3l86A / Q8DV44 The crystal structure of smu.665 from streptococcus mutans ua159
30% identity, 50% coverage

Ligands: adenosine-5'-diphosphate; n-acetyl-l-glutamate (3l86A)

T303_03435 acetylglutamate kinase from Streptococcus thermophilus ASCC 1275
29% identity, 50% coverage

Functional Genomic Analyses of Exopolysaccharide-Producing Streptococcus thermophilus ASCC 1275 in Response to Milk Fermentation Conditions
Wu, Frontiers in microbiology 2019
- “...Cysteine catabolism T303_03425 4.00 N -acetyl-gamma-glutamyl-phosphate reductase Arginine biosynthesis T303_03440 3.54 Acetylornithine aminotransferase Arginine biosynthesis T303_03435 2.42 Acetylglutamate kinase Arginine biosynthesis T303_09105 4.34 Amino acid ABC transporter substrate-binding protein T303_08290 2.47 Amino acid ABC transporter substrate-binding protein T303_08720 1.81 Amino acid ABC transporter substrate-binding protein T303_04105...”

2rd5B / Q9SCL7 Structural basis for the regulation of n-acetylglutamate kinase by pii in arabidopsis thaliana (see paper)
32% identity, 58% coverage

Ligands: arginine; adenosine-5'-diphosphate; n-acetyl-l-glutamate (2rd5B)

Vpar_1306 acetylglutamate kinase from Veillonella parvula DSM 2008
29% identity, 61% coverage

Transcriptomic analysis of three Veillonella spp. present in carious dentine and in the saliva of caries-free individuals
Do, Frontiers in cellular and infection microbiology 2015
- “...protein ThiS 6.55 5.73 1.18 2E-05 Vpar_1307 N-acetyl-gamma-glutamyl-phosphate reductase (EC 1.2.1.38) 36.32 5.51 1.02 1E-06 Vpar_1306 Acetylglutamate kinase (EC 2.7.2.8) 28.84 5.28 1.11 3E-05 Vpar_0164 FIG01197475: hypothetical protein 20.37 5.28 1.04 7E-06 Vpar_1004 Alpha-aspartyl dipeptidase Peptidase E (EC 3.4.13.21) 18.93 5.26 1.12 3E-05 Vpar_0330 FIG01197189: hypothetical...”
Contribution of Veillonella parvula to Pseudomonas aeruginosa-mediated pathogenicity in a murine tumor model system
Pustelny, Infection and immunity 2015
- “...Vpar_0143 Vpar_1309 Vpar_1007 Vpar_1005 Vpar_1437 Vpar_1306 Vpar_1382 Vpar_1782 Vpar_1440 Vpar_1438 Vpar_1439 Vpar_1566 Vpar_1441 Vpar_1305 Vpar_1308 Vpar_1307...”

NAGK_ARATH / Q9SCL7 Acetylglutamate kinase, chloroplastic; N-acetyl-L-glutamate 5-phosphotransferase; NAG kinase; AtNAGK; EC 2.7.2.8 from Arabidopsis thaliana (Mouse-ear cress) (see 4 papers)
Q9SCL7 acetylglutamate kinase (EC 2.7.2.8) from Arabidopsis thaliana (see 5 papers)
AT3G57560, NP_191315 N-acetyl-l-glutamate kinase from Arabidopsis thaliana
32% identity, 58% coverage

function: Involved in the arginine biosynthetic pathway via the intermediate compound ornithine.
catalytic activity: N-acetyl-L-glutamate + ATP = N-acetyl-L-glutamyl 5-phosphate + ADP (RHEA:14629)
subunit: Interacts with GLB1. Interaction is dependent of MgATP and inhibited by 2-oxoglutarate, arginine, glutamate, citrate, and oxaloacetate.
The Plastidial Protein Acetyltransferase GNAT1 Forms a Complex With GNAT2, yet Their Interaction Is Dispensable for State Transitions
Brünje, Molecular & cellular proteomics : MCP 2024
- “...4. ZHD10 (A72, AT2G21530) 5. ZEP (A61, AT5G67030) 6. PORC (T69, AT1G03630) 7. NAGK (T51, AT3G57560) 8. AT2G14880 (T46) 9. MORF9 (T61, AT1G11430). Table2 Physiological and photosynthesis-related parameters investigated for the wild type and the mutant lines gnat1-1 , gnat1-2 , and gnat2 Plant line Dry...”
Molecular mechanisms of resistance to Myzus persicae conferred by the peach Rm2 gene: A multi-omics view
Le, Frontiers in plant science 2022
- “...6.4 Prupe_1G052400 AT4G13510 80 Yes 1.8 2.10E-07 AMT1; Ammonium transporter 1 Urea cycle/Proline metabolism Prupe_1G463900 AT3G57560 70 Yes -1.6 2.00E-03 NAGK; Acetylglutamate kinase Prupe_8G115600 AT2G19940 81 Yes -2.3 5.20E-10 NAGPR; N-acetyl-gamma-glutamyl-phosphate reductase Prupe_6G093800 AT1G29900 82 Yes -1.7 3.60E-07 CARB; Carbamoyl-phosphate synthase large chain, chloroplastic Prupe_1G376500 AT1G75330...”
Identification and Characterization of Plant-Interacting Targets of Tomato Spotted Wilt Virus Silencing Suppressor
Zhai, Pathogens (Basel, Switzerland) 2021
- “...protein LOC107787150 Solyc03g111050 AT3G48500 Mitogen-activated protein kinase (MAPK) LOC107794128 Solyc01g094960 AT4G01370 Acetylglutamate kinase LOC107803486 Solyc11g005620 AT3G57560 Epi-aristolochene dihydroxylase; CYP71B35 LOC107759261 Solyc04g083140 AT3G26310 Nitrate reductase LOC107785409 Solyc11g013810 AT1G37130 Myosin LOC107806983 Solyc02g020910 AT3G19960 Nuclear pore complex protein SEC13 LOC107777830 Solyc02g087300 AT2G30050 Metacaspase type II LOC107824366 Solyc09g098150 AT1G79330 Serine/threonine...”
Gel-based proteomic map of Arabidopsis thaliana root plastids and mitochondria
Grabsztunowicz, BMC plant biology 2020
- “...86 O80574, At2g44040 Acetolactate synthase small subunit 1 58 Q9FFF4, At5g16290 Acetylglutamate kinase 92 Q9SCL7, At3g57560 Acetylornithine aminotransferase 62, 63 Q9M8M7, At1g80600 Argininosuccinate synthase 51, 52 Q9SZX3, At4g24830 ATP phosphoribosyltransferase 1 62 Q9S762, At1g58080 Bifunctional 3-dehydroquinate dehydratase/shikimate dehydrogenase 30 Q9SQT8, At3g06350 Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate...”
- “...identified from our root plastid sample (Table 1 , Fig. 3 ). Acetylglutamate kinase (NAGK, At3g57560), catalyzing phosphorylation of N-acetylglutamate was identified in spot 92. N-acetylglutamate phosphate is then converted to N-acetylglutamate semialdehyde by N-acetylglutamyl-phosphate reductase (AGPR, At2g19940, spots 70 and 71). In the next step,...”
Acetylglutamate kinase is required for both gametophyte function and embryo development in Arabidopsis thaliana.
Huang, Journal of integrative plant biology 2017 (PubMed)
- GeneRIF: functions with arginine to regulate gametophyte function and embryo development
Physiological implications of arginine metabolism in plants
Winter, Frontiers in plant science 2015
- “...activity were mediated by altering domain interactions within NAGS. NAGK The localization of Arabidopsis NAGK (At3g57560) in chloroplasts was predicted by sequence analysis and was experimentally demonstrated by Chen et al. (2006) . Feedback regulation of NAGK mediated by the plastidic PII protein was first described...”
DYn-2 Based Identification of Arabidopsis Sulfenomes
Akter, Molecular & cellular proteomics : MCP 2015
- “...family EMBRYO DEFECTIVE 1027 Description AT4G32520 AT4G29840 AT3G57560 AT3G49680 AGI code Plastid Plastid Plastid Plastid Plastid Plastid Plastid Plastid,...”
Chloroplast acetyl-CoA carboxylase activity is 2-oxoglutarate-regulated by interaction of PII with the biotin carboxyl carrier subunit
Feria, Proceedings of the National Academy of Sciences of the United States of America 2010
- “...gene no. At3g56130 At1g52670 At3g15690 At5g15530 At5g16390 At3g57560 Feria Bourrellier et al. Description No. of peptides Percent coverage of protein Position...”
More
Gel-based proteomic map of Arabidopsis thaliana root plastids and mitochondria
Grabsztunowicz, BMC plant biology 2020
- “...1 86 O80574, At2g44040 Acetolactate synthase small subunit 1 58 Q9FFF4, At5g16290 Acetylglutamate kinase 92 Q9SCL7, At3g57560 Acetylornithine aminotransferase 62, 63 Q9M8M7, At1g80600 Argininosuccinate synthase 51, 52 Q9SZX3, At4g24830 ATP phosphoribosyltransferase 1 62 Q9S762, At1g58080 Bifunctional 3-dehydroquinate dehydratase/shikimate dehydrogenase 30 Q9SQT8, At3g06350 Bifunctional aspartate aminotransferase and...”

DV527_RS01270 acetylglutamate kinase from Staphylococcus saprophyticus
29% identity, 59% coverage

Transcriptome Analysis of Halotolerant Staphylococcus saprophyticus Isolated from Korean Fermented Shrimp
Jo, Foods (Basel, Switzerland) 2022
- “...glutamate N -acetyltransferase acetyltransferase ArgJ 1.38 1.12 DV527_RS01910 pgsC Poly--glutamate biosynthesis protein PgsC 1.75 1.77 DV527_RS01270 argB acetylglutamate kinase 2.14 1.78 DV527_RS01905 pgsB Poly--glutamate synthase PgsB 1.94 1.52 * Gene expression is represented using the absolute log 2 fold change (FC) values having adjusted p -values...”

SERP1090 acetylglutamate kinase from Staphylococcus epidermidis RP62A
29% identity, 50% coverage

Concentration-Dependent Global Quantitative Proteome Response of Staphylococcus epidermidis RP62A Biofilms to Subinhibitory Tigecycline
Sung, Cells 2022
- “...2-oxoisovalerate dehydrogenase subunit alpha 2.59 1.87 1.89 SERP1082 ispA fig|176279.9.peg.1053 H Geranyltranstransferase 0.00 0.00 1000.00 SERP1090 argB fig|176279.9.peg.1061 F Acetylglutamate kinase 1000.00 1000.00 1000.00 SERP1127 sigA fig|176279.9.peg.1097 K RNA polymerase sigma factor 3.91 4.99 27.12 SERP0120 tmk fig|176279.9.peg.112 F Thymidylate kinase 1000.00 1000.00 1000.00 SERP1151 SERP1151...”

SCO1578 acetylglutamate kinase from Streptomyces coelicolor A3(2)
32% identity, 59% coverage

Transcriptomic analysis of a classical model of carbon catabolite regulation in Streptomyces coelicolor
Romero-Rodríguez, BMC microbiology 2016
- “...SCL24.06c Argininosuccinate lyase [EC:4.3.2.1] SCO1576 argR, SCL24.12c Arginine repressor SCO1577 argD, SCL24.13c Acetonitrile aminotransferase [EC:2.6.1.11] SCO1578 argB, SCL24.14c Acetylglutamate kinase [EC:2.7.2.8] SCO1579 argJ, SCL24.15c Putative glutamate N-acetyltransferase [EC:2.3.1.1 2.3.1.35] SCO1580 argC N-Acetyl-gamma-glutamyl-phosphate reductase [EC:1.2.1.38] SCO1815 fabG, SCI28.09c Probable 3-oxacyl-(acyl-carrier-protein) reductase [EC:1.1.1.100] SCO2126 glk, SC6E10.20c Glucokinase [EC:2.7.1.2]...”
Genome-wide analysis of the role of GlnR in Streptomyces venezuelae provides new insights into global nitrogen regulation in actinomycetes
Pullan, BMC genomics 2011
- “...homology to acetyltransferase Sven_1874 SCO2210 glutamine synthetase II glnII Sven_5427 SCO5772 putative cysteine dioxygenase Sven_1172 SCO1578 acetylglutamate kinase Sven_3383 - putative PIN domain containing protein Sven_0779 - putative permease Sven_6135 - putative major facilitator super family transporter Sven_2419 SCO2636 unknown Sven_1169 SCO1572 putative secreted protein Sven_4152...”
Characterization of the polyoxin biosynthetic gene cluster from Streptomyces cacaoi and engineered production of polyoxin H
Chen, The Journal of biological chemistry 2009
- “...S. tendae NikN, S. tendae NikN, S. tendae SCO1578, S. coelicolor A3(2) NodU, Sinorhizobium sp. ArgA, Rhodoferax ferrireducens PA4907, P. aeruginosa PAO1 ORF3,...”

LOC107803486 acetylglutamate kinase, chloroplastic-like from Nicotiana tabacum
30% identity, 62% coverage

Identification and Characterization of Plant-Interacting Targets of Tomato Spotted Wilt Virus Silencing Suppressor
Zhai, Pathogens (Basel, Switzerland) 2021
- “...Plastid RNA-binding protein LOC107787150 Solyc03g111050 AT3G48500 Mitogen-activated protein kinase (MAPK) LOC107794128 Solyc01g094960 AT4G01370 Acetylglutamate kinase LOC107803486 Solyc11g005620 AT3G57560 Epi-aristolochene dihydroxylase; CYP71B35 LOC107759261 Solyc04g083140 AT3G26310 Nitrate reductase LOC107785409 Solyc11g013810 AT1G37130 Myosin LOC107806983 Solyc02g020910 AT3G19960 Nuclear pore complex protein SEC13 LOC107777830 Solyc02g087300 AT2G30050 Metacaspase type II LOC107824366 Solyc09g098150...”

DVU1466 acetylglutamate kinase from Desulfovibrio vulgaris Hildenborough
30% identity, 61% coverage

Design and analysis of mismatch probes for long oligonucleotide microarrays
Deng, BMC genomics 2008
- “...Genbank ID Organism* Annotation DVU0625 46451220 DvH Putative cytochrome c nitrite reductase, catalytic subunit NfrA DVU1466 46451220 DvH Acetylglutamate kinase (argB) DVU1782 46451220 DvH Iron-sulfur cluster-binding protein DVU2526 46451220 DvH Periplasmic [NiFe] hydrogenase, large subunit, isozyme2(hynA-2) MMP0707 44921025 Mm Na+/H+ exchanger MMP0926 44921025 Mm Chemotaxis protein...”
Response of Desulfovibrio vulgaris to alkaline stress
Stolyar, Journal of bacteriology 2007
- “...DVU0467 DVU0468 DVU0469 DVU0470 DVU0471 DVU0663 DVU0890 DVU1466 DVU1585 DVU1609 DVU1610 DVU2981 DVU2982 DVU2983 DVU2984 DVU3048 DVU3371 Expression change (log2...”

OKIT_0634 acetylglutamate kinase from Oenococcus kitaharae DSM 17330
31% identity, 61% coverage

Functional divergence in the genus Oenococcus as predicted by genome sequencing of the newly-described species, Oenococcus kitaharae
Borneman, PloS one 2012
- “...biosynthesis in O. kitaharae . RAST Pathway Description ORF(s) Arginine biosynthesis Acetylglutamate kinase (EC 2.7.2.8) OKIT_0634 Acetylornithine aminotransferase (EC 2.6.1.11) OKIT_0630 Glutamate N-acetyltransferase (EC 2.3.1.35) OKIT_0629 N-acetyl-gamma-glutamyl-phosphate reductase (EC 1.2.1.38) OKIT_0628 N-acetylglutamate synthase (EC 2.3.1.1) OKIT_0629 Ornithine carbamoyltransferase (EC 2.1.3.3) OKIT_0631 Carbamoyl-phosphate synthase small chain (EC...”

BB341_RS23955, SCLAV_0799 acetylglutamate kinase from Streptomyces clavuligerus
32% identity, 58% coverage

Comparative Transcriptome Analysis of Streptomyces Clavuligerus in Response to Favorable and Restrictive Nutritional Conditions
Pinilla, Antibiotics (Basel, Switzerland) 2019
- “...argC (2.52 FC), acetylornithine aminotransferase, argD (3.0 FC), arginine biosynthesis bifunctional protein and argininosuccinate synthase (SCLAV_0799) showed higher expression in the SB-M condition. Glutamate is an important amino acid precursor in CA biosynthesis [ 28 , 29 ]; glutamate conversion to arginine, reaction mediated by NAGS,...”
- “...10 3 SCLAV_0798 Acetylornithine aminotransferase ( oat2 ) 2.582 5.623 10 4 1.418 10 2 SCLAV_0799 Acetylglutamate kinase 2.553 1.598 10 3 3.160 10 2 Down-regulated genes in GSPG SCLAV_5442 Putative transcriptional regulator 6.728 2.427 10 3 4.380 10 2 SCLAV_1087 Putative penicillin-binding protein 4.02 1.310...”
The CagRS Two-Component System Regulates Clavulanic Acid Metabolism via Multiple Pathways in Streptomyces clavuligerus F613-1
Fu, Frontiers in microbiology 2019
- “...reductase Arginine synthesis 1.11E-15 SCLAV_0800(argJ) BB341_RS23950 (argJ) 7.33 6.45 Bifunctional ornithine Arginine synthesis 1.11E-15 SCLAV_0799(argB) BB341_RS23955 (argB) 6.74 5.48 Acetylglutamate kinase Arginine synthesis 1.11E-15 SCLAV_0798(argD) BB341_RS23960 (argD) 5.33 5.67 Acetylornithine aminotransferase Arginine synthesis 1.11E-15 SCLAV_0797 BB341_RS23965 (argR) 5.04 5.49 Arginine repressor Arginine synthesis 1.11E-15 SCLAV_0796 BB341_RS23970...”
Transcriptomic analysis of Streptomyces clavuligerus ΔccaR::tsr: effects of the cephamycin C-clavulanic acid cluster regulator CcaR on global regulation
Alvarez-Álvarez, Microbial biotechnology 2014
- “...<1E 06 SCLAV_5278 hlmM Putative transcriptional regulator 2.01 2.59E 04 1.36 8.01E 03 Arginine biosynthesis SCLAV_0799 argB Acetylglutamate kinase 2.15 <1E 06 2.98 <1E 06 SCLAV_0801 argC N-acetyl-gamma-glutamyl-phosphate reductase 1.70 3.58E 02 2.49 3.43E 04 SCLAV_0798 argD Acetonitrile aminotransferase 1.67 3.19E 03 2.60 <1E 06 SCLAV_0796...”

argB / CAB95021.1 n-acetylglutamate 5-phosphotransferase from Moritella abyssi (see paper)
33% identity, 48% coverage

ABZJ_00054 amino-acid N-acetyltransferase from Acinetobacter baumannii MDR-ZJ06
26% identity, 55% coverage

Colistin Resistance in Acinetobacter baumannii MDR-ZJ06 Revealed by a Multiomics Approach
Hua, Frontiers in cellular and infection microbiology 2017
- “...isomerase and thioredoxin 1.894318 12.3252 7.68E-20 2.75E-18 ABZJ_00894 lactoylglutathione lyase-like protein 1.797874 6.779815 5.27E-15 1.62E-13 ABZJ_00054 N-alpha-acetylglutamate synthase (amino-acid acetyltransferase) 1.77044 10.25589 3.24E-20 1.27E-18 ABZJ_01151 hypothetical protein 1.634908 3.574211 4.88E-06 3.84E-05 ABZJ_03714 hypothetical protein 1.61859 8.500912 1.39E-08 1.85E-07 ABZJ_01900 acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit alpha 1.527437 6.102611 2.98E-06...”

DJ41_3725, FQU82_00067 amino-acid N-acetyltransferase from Acinetobacter baumannii
26% identity, 55% coverage

Transcriptomic analysis reveals the regulatory role of quorum sensing in the Acinetobacter baumannii ATCC 19606 via RNA-seq
Xiong, BMC microbiology 2022
- “...while FQU82_02901 was found to be downregulated. Among the DEGs involved in the arginine biosynthesis, FQU82_00067 and FQU82_01752 were upregulated, whereas FQU82_01177, FQU82_02901, FQU82_01050 ( ureC ), FQU82_01049 ( ureB ), and FQU82_01048 ( ureA ) were downregulated. Arginine was one of the common amino acids...”
Metabolic Responses to Polymyxin Treatment in Acinetobacter baumannii ATCC 19606: Integrating Transcriptomics and Metabolomics with Genome-Scale Metabolic Modeling
Zhu, mSystems 2019
- “...Data Set S1I ). Within amino acid biosynthesis, the upregulation of amino acid N -acetyltransferase (DJ41_3725, argA , 7.6-fold) and acetylglutamate kinase (DJ41_2686, argB , 2.0-fold) resulted in upregulated arginine biosynthesis flux and a decreased intermediate metabolite pool of N -acetyl- l -glutamate (3.5-fold) and l...”

NAGS_SCHPO / O94330 Amino-acid acetyltransferase, mitochondrial; Arginine-requiring protein 6; Glutamate N-acetyltransferase; N-acetylglutamate synthase; AGS; NAGS; EC 2.3.1.1 from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see paper)
SPBC725.14 acetylglutamate synthase Arg6 (predicted) from Schizosaccharomyces pombe
26% identity, 77% coverage

function: N-acetylglutamate synthase involved in arginine biosynthesis.
catalytic activity: L-glutamate + acetyl-CoA = N-acetyl-L-glutamate + CoA + H(+) (RHEA:24292)
Thiol-independent action of mitochondrial thioredoxin to support the urea cycle of arginine biosynthesis in Schizosaccharomyces pombe
Song, Eukaryotic cell 2008
- “...(www.genedb.org/pombe) are indicated in parentheses (arg6, SPBC725.14; arg11, SPAC4G9.09c; arg1, SPCC777.09c; arg3, and SPAC4G9.10; arg12, SPBC428.05c; arg7,...”

BCAL2231 putative amino-acid acetyltransferase from Burkholderia cenocepacia J2315
26% identity, 58% coverage

Genetic Determinants Associated With in Vivo Survival of Burkholderia cenocepacia in the Caenorhabditis elegans Model
Wong, Frontiers in microbiology 2018
- “...Genes involved in the biosynthesis of amino acids (i.e., argB, talB, gpmA , BCAL0401 and BCAL2231) were also identified suggesting that B. cenocepacia responds to nutritional cues within the host environment by adjusting its metabolic pathways to sustain growth. Several studies have shown that the presence...”
Candidate Essential Genes in Burkholderia cenocepacia J2315 Identified by Genome-Wide TraDIS
Wong, Frontiers in microbiology 2016
- “...aspartate, and glutamate metabolism glt2 Arginine and proline metabolism BCAL3292 Arginine biosynthesis argB, argH, argG, BCAL2231 Glycine, serine, and threonine metabolism gpmA, BCAL1852, serC Histidine metabolism hisG, hisD, hisB, hisF, hisI, hisE, BCAL1874 Lysine biosynthesis dapF, BCAS0211 Phenylalanine, tyrosine, and tryptophan biosynthesis phhA, aroK, trpC, trpD,...”

SARLGA251_01530 acetylglutamate kinase from Staphylococcus aureus subsp. aureus LGA251
26% identity, 59% coverage

Whole genome sequencing identifies zoonotic transmission of MRSA isolates with the novel mecA homologue mecC
Harrison, EMBO molecular medicine 2013
- “...Farm B Cow A Patient A1 Patient A2 Sheep B1 SheepB2 Sheep B3 Patient B SARLGA251_01530 Putative amino acid kinase 763 770 A T Yes Yes Yes Yes Yes Yes Yes SARLGA251_03380 Putative membrane protein 238 383 C T Yes Yes Yes Yes Yes Yes Yes...”

CKS_1064 acetylglutamate kinase from Pantoea stewartii subsp. stewartii DC283
30% identity, 55% coverage

Analyzing the Transcriptomes of Two Quorum-Sensing Controlled Transcription Factors, RcsA and LrhA, Important for Pantoea stewartii Virulence
Kernell, PloS one 2015
- “...permease family protein 8.85 9.44 1.3E-11 ACV-0289953 CKS_1065 argC N-acetyl-gamma-glutamylphosphate reductase 5.25 5.50 8.6E-08 ACV-0289954 CKS_1064 argB acetylglutamate kinase 5.14 5.46 2.3E-07 ACV-0291072 CKS_1283 cysD sulfate adenylyltransferase subunit 2 5.07 5.57 3.0E-07 ACV-0291071 CKS_1282 cysN sulfate adenylyltransferase subunit 1 4.29 4.64 4.7E-06 ACV-0289145 CKS_4942 argI ornithine...”

SAB0122c probable acetylglutamate kinase from Staphylococcus aureus RF122
26% identity, 59% coverage

Horizontal gene transfers link a human MRSA pathogen to contagious bovine mastitis bacteria
Brody, PloS one 2008
- “...bovine mastitis. Uniquely shared sequences Sequence description Flanking MGE or phage DNA MRSA252 RF122 SAR0183 SAB0122c Partial sequence of Acetylglutamate Kinase. None detected SAR0385 SAB0361 Similar to bovine pathogenicity island protein ORF3 Phage SAR0585 SAB0449 Hypothetical Phosphomethylpyrimidine kinase None detected SAR0824 SAB0723 Malolactic enzyme ORF plus...”

VV1_1372 acetylglutamate kinase from Vibrio vulnificus CMCP6
29% identity, 58% coverage

A consensus sequence for binding of SmcR, a Vibrio vulnificus LuxR homologue, and genome-wide identification of the SmcR regulon
Lee, The Journal of biological chemistry 2008
- “...Translation Not in COGsc b VV1_1370, VV1_1371 VV1_1372 VV1_1373 VV1_1374 VV2_1326 VV1_1950b VV1_1951 VV1_1952 VV1_1103, VV2_0929 VV2_0928 VV1_2257 VV2_1089b...”
- “...and metabolism VV1_1370 VV1_1371 VV1_1372 VV1_1373 VV1_1374 Acetylornithine deacetylase N-acetyl-gamma-glutamyl-phosphate reductase Acetylglutamate kinase...”

SO4245 amino-acid acetyltransferase from Shewanella oneidensis MR-1
23% identity, 60% coverage

Transcriptome analysis reveals a stress response of Shewanella oneidensis deprived of background levels of ionizing radiation
Castillo, PloS one 2018
- “...hisG ATP phosphoribosyltransferase 1.11 1.20 SO2767 asnB Asparagine synthetase [glutamine-hydrolyzing] 1.02 SO3986 lysC Aspartokinase 1.11 SO4245 argA N-acetylglutamate synthase 1.01 1.11 SO2305 lrp Leucine-responsive regulatory protein -1.10 SO1898 liuR Transcriptional regulator LiuR of Leu degradation -1.35 ABC transporters SO0056 Transport system substrate binding component 1.05 SO0070...”
Probing regulon of ArcA in Shewanella oneidensis MR-1 by integrated genomic analyses
Gao, BMC genomics 2008
- “...2.83 3.53 -205 GTAAAATCGATGTTA e B & E so3855 (sfcA) 0.36 0.49 -177 GTTAATTGATTGTAA B so4245 (argA) 0.19 0.41 -178 GTTAAAAAAATGTGA B a Log 2 value. For multiple-gene Operons, only expression of the first gene was listed b Referring to the translation start site c Putative...”
- “...so3863-5 (modABC) 0.53 2.49 R 206 + 2.75 CTTGAGTAAATGTTA Molybdenum ABC transporter, periplasmic molybdenum-binding protein so4245 (argA) 0.19 0.41 A 178 - 2.65 GTTAAAAAAATGTGA Amino-acid acetyltransferase so4273 -0.85 0.39 L 9 + 3.08 GGTAATTAATTGTTA Hypothetical protein so4457 1.69 2.66 T 63 - 2.76 GTTGCCTAAATGTTA GGDEF domain...”

SO_4245 amino-acid N-acetyltransferase from Shewanella oneidensis MR-1
23% identity, 60% coverage

Acetylation of xenogeneic silencer H-NS regulates biofilm development through the nitrogen homeostasis regulator in Shewanella
Liu, Nucleic acids research 2024
- “...cells grown under the stationary stage as control. The transcription levels of genes including argA (SO_4245), argC (SO_0275), artQ (SO_1043)and glnA were quantified. The genes of argA , encoding an N-acetylglutamate synthase, and argC , encoding an N-acetylglutamylphosphate reductase, carry out the first step and the...”

argB / CAB82481.1 acetylglutamate kinase from Streptomyces clavuligerus (see 3 papers)
30% identity, 63% coverage

AFUA_2G11490, Afu2g11490 acetylglutamate synthase from Aspergillus fumigatus Af293
38% identity, 19% coverage

Arginine Auxotrophy Affects Siderophore Biosynthesis and Attenuates Virulence of Aspergillus fumigatus
Dietl, Genes 2020
- “...for extra- and intracellular siderophore production. ArgJ (AFUA_5G08120, in blue), bifunctional acetylglutamate synthase/ornithine acetyltransferase; Arg2 (AFUA_2G11490), acetylglutamate synthase; ArgEF (AFUA_6G02910), bifunctional acetylglutamate kinase and N-acetyl-gamma-glutamyl-phosphate reductase; Arg8 (AFUA_2G12470), acetylornithine aminotransferase; ArgB (AFUA_4G07190; in red), ornithine carbamoyltransferase; AmcA (AFUA_8G02760), mitochondrial ornithine exporter; AgaA (AFUA_3G11430), arginase; Cap1 (AFUA_5G06780),...”
Characterization of the Link between Ornithine, Arginine, Polyamine and Siderophore Metabolism in Aspergillus fumigatus
Beckmann, PloS one 2013
- “...). Northern analysis demonstrated transcriptional upregulation of the three ornithine/arginine biosynthetic genes encoding acetylglutamate synthase (AFUA_2g11490), ArgEF (AFUA_6g02910) and acetylornithine aminotransferase (AFUA_2g12470) in A. fumigatus D141 ( Figure 6 ), as previously shown for strain ATCC 46645 [22] . CpcA-deficiency slightly upregulated the transcript levels of...”
HapX-mediated adaption to iron starvation is crucial for virulence of Aspergillus fumigatus
Schrettl, PLoS pathogens 2010
- “...the pathways are numbered and corresponding to the Northern analysis in (B): 1, acetylglutamate synthetase (Afu2g11490) 2, acetylglutamate kinase and glutamate-5-semialdehyde dehydrogenase (Afu6g02910); 3, acetylornithine aminotransferase (Afu2g12470); 4, arginine biosynthesis bifunctional enzyme (Afu5g08120); 5, carbamoylphosphate synthase(Afu5g06780); 6, ornithine carbamoyltransferase (Afu4g07190); 7, arginase (Afu3g11430); 8, ornithine aminotransferase...”

SAR0183 putative amino acid kinase from Staphylococcus aureus subsp. aureus MRSA252
26% identity, 59% coverage

Horizontal gene transfers link a human MRSA pathogen to contagious bovine mastitis bacteria
Brody, PloS one 2008
- “...of bovine mastitis. Uniquely shared sequences Sequence description Flanking MGE or phage DNA MRSA252 RF122 SAR0183 SAB0122c Partial sequence of Acetylglutamate Kinase. None detected SAR0385 SAB0361 Similar to bovine pathogenicity island protein ORF3 Phage SAR0585 SAB0449 Hypothetical Phosphomethylpyrimidine kinase None detected SAR0824 SAB0723 Malolactic enzyme ORF...”

SAV0182 hypothetical protein from Staphylococcus aureus subsp. aureus Mu50
SA0176 hypothetical protein from Staphylococcus aureus subsp. aureus N315
SAOUHSC_00147 acetylglutamate kinase, putative from Staphylococcus aureus subsp. aureus NCTC 8325
SAUSA300_0184 acetylglutamate kinase from Staphylococcus aureus subsp. aureus USA300_FPR3757
CH51_RS00845 acetylglutamate kinase from Staphylococcus aureus
31% identity, 42% coverage

Mutated response regulator graR is responsible for phenotypic conversion of Staphylococcus aureus from heterogeneous vancomycin-intermediate resistance to vancomycin-intermediate resistance
Neoh, Antimicrobial agents and chemotherapy 2008
- “...S-9 2264148 G A G SAV2136 pdp S-10 206670 G A G SAV0182 argB S-11 514468 A G G SAV0471 gltC S-12 1693563 Delb T T SAV1583 hemN S-13 1798058 C T C SAV1689 S-14...”
An RpoB mutation confers dual heteroresistance to daptomycin and vancomycin in Staphylococcus aureus
Cui, Antimicrobial agents and chemotherapy 2010
- “...SA1439 SA2375 Arginine metabolism and urea cycle SA0175 SA0176 SA0177 SA0178 SA0179 SA0821 SA0822 SA2082 SA2083 SA2084 SA2085 SA2086 SA2087 SA2088 SA2428 SA2429...”
Antibacterial Components and Modes of the Methanol-Phase Extract from Commelina communis Linn
Liu, Plants (Basel, Switzerland) 2023
- “...significantly downregulated (0.246-fold to 0.397-fold) ( p < 0.05), including an acetylglutamate kinase putative ( SAOUHSC_00147 ), a glutamate N-acetyltransferase/amino-acid acetyltransferase ( SAOUHSC_00148 ), an ornithine carbamoyltransferase ( SAOUHSC_01128 ), a carbamate kinase ( SAOUHSC_01129 ), and a nitric oxide synthase oxygenase domain putative ( SAOUHSC_02134...”
- “...Arginine biosynthesis SAOUHSC_01128 0.246 Ornithine carbamoyltransferase SAOUHSC_01129 0.301 Carbamate kinase SAOUHSC_00148 0.335 Glutamate N-acetyltransferase/amino-acid acetyltransferase SAOUHSC_00147 0.388 Acetylglutamate kinase putative SAOUHSC_02134 0.397 Nitric oxide synthase oxygenase domain putative SAOUHSC_01287 2.119 Glutamine synthetase type I SAOUHSC_02409 2.658 Arginase SAOUHSC_02965 3.951 Carbamate kinase SAOUHSC_02968 4.068 Ornithine carbamoyltransferase SAOUHSC_02969...”
Human Urine Alters Methicillin-Resistant Staphylococcus aureus Virulence and Transcriptome
Paudel, Applied and environmental microbiology 2021 (secret)
CcpA regulates arginine biosynthesis in Staphylococcus aureus through repression of proline catabolism
Nuxoll, PLoS pathogens 2012
- “...pathway are as follows: argJ (bifunctional ornithine acetyltransferase/glutamate N-acetyltransferase), SAUSA300_0185, EC 2.3.1.35/2.3.1.1; argB (acetylglutamate kinase), SAUSA300_0184, EC 2.7.2.8; argC (N-acetyl-gamma-glutamyl-phosphate-reductase), SAUSA300_0186, EC 1.2.1.38; argD (acetylornithine transaminase), SAUSA300_0187, EC 2.6.1.11; argF (ornithine carbamoyl transferase), SAUSA300_1062, EC 2.1.3.3; argG (argininosuccinate synthase), SAUSA300_0864, EC 6.3.4.5; and argH (argininosuccinate lyase),...”
Staphylococcus aureus PhoU Homologs Regulate Persister Formation and Virulence
Shang, Frontiers in microbiology 2020
- “...protein 16.1 ND CH51_RS07980 Biotin 2.03 ND CH51_RS12955 Biotin transporter BioY 6.42 ND Proline metabolism CH51_RS00845 Acetylglutamate kinase 2.01 ND CH51_RS04860 Ornithine aminotransferase 2 2.15 ND CH51_RS16020 Hypothetical protein 7.01 ND CH51_RS08555 Pyrroline-5-carboxylate reductase 2.49 ND Lysine biosynthesis CH51_RS07635 4-Hydroxy-tetrahydrodipicolinate reductase 2.12 ND CH51_RS07655 Diaminopimelate decarboxylase...”

BAU10_13665 acetylglutamate kinase from Vibrio alginolyticus
28% identity, 57% coverage

Identification of the global regulatory roles of RraA via the integrative transcriptome and proteome in Vibrio alginolyticus
Chen, mSphere 2024
- “...core enzymes in the arginine synthesis pathway, including argininosuccinate lyase ArgH (BAU10_13655), acetylglutamate kinase ArgB (BAU10_13665), N-acetyl-gamma-glutamyl-phosphate reductase ArgC (BAU10_13670), bifunctional N-succinyl diaminopimelate-aminotransferase or acetylornithine transaminase protein ArgD (BAU10_13850), ornithine carbamoyltransferase ArgF (BAU10_13125), and argininosuccinate synthase ArgG (BAU10_13660), were positively regulated by RraA ( Fig. 6A...”

PP5185 N-acetylglutamate synthase from Pseudomonas putida KT2440
PP_5185 amino-acid N-acetyltransferase from Pseudomonas putida KT2440
27% identity, 58% coverage

Genome-scale reconstruction and analysis of the Pseudomonas putida KT2440 metabolic network facilitates applications in biotechnology
Puchałka, PLoS computational biology 2008
- “...in silico due to weakly annotated gene putatively encoding redundant isozymes. In the case of PP5185 (coding for N -acetylglutamate synthase), its essentiality is removed by PP1346 (coding for bifunctional ornithine acetyltransferase/ N -acetylglutamate synthase protein), which is not only an isozyme of PP5185 (the N...”
- “...-acetyl- l -glutamate (the product of N -acetylglutamate synthase) and thus renders the activity of PP5185 redundant. It appears either that this is a mis-annotation or that the enzyme is utilized only under different conditions. In addition, PP0897 ( fum C) seems to have two paralogues...”
Experimental and Analytical Approaches for Improving the Resolution of Randomly Barcoded Transposon Insertion Sequencing (RB-TnSeq) Studies
Borchert, ACS synthetic biology 2022
- “...nontrimmed data sets ( Table 1 , File S1 ). Interestingly, two loci (PP_5289 and PP_5185) showed conflicting fitness changes, depending on the trimming method used ( Figure S2 ). Additionally, trimming 5% from both ends showed fitness differences > |1| only for two genes, as...”
Arginine Biosynthesis Modulates Pyoverdine Production and Release in Pseudomonas putida as Part of the Mechanism of Adaptation to Oxidative Stress
Barrientos-Moreno, Journal of bacteriology 2019 (secret)

BPSL2325 putative amino-acid acetyltransferase from Burkholderia pseudomallei K96243
25% identity, 58% coverage

Genomic and RT-qPCR analysis of trimethoprim-sulfamethoxazole and meropenem resistance in Burkholderia pseudomallei clinical isolates
Schnetterle, PLoS neglected tropical diseases 2021
- “...BPSL2409) and possesses one SNP in common with strain C, which is located in the BPSL2325 gene, encoding an N-acetylglutamate synthase. Strain B2 possesses two specific SNPs, one at the same locus (BPSL2325) but at another position and the second in an intergenic region at position...”
- “...G>A 139 G>A Arg47Cys 2313254 2313254 - G G G G G G G>C 2811582 BPSL2325 N-acetylclutamate synthase G G G G 1094 G>A G G Cys365Tyr 2912606 BPSL2409 ABC Transporter ATP-Binding protein T T 854 T>C 854 T>C T T T Leu285Pro 3337083 BPSL2789 WcbR...”

VC2643 acetylglutamate kinase from Vibrio cholerae O1 biovar eltor str. N16961
28% identity, 57% coverage

Pyomelanin produced by Vibrio cholerae confers resistance to predation by Acanthamoeba castellanii
Noorian, FEMS microbiology ecology 2017
- “...(tryptophan biosynthesis), gltD and VC2373 (glutamate biosynthesis), glnA (glutamine biosynthesis) argC , VC2617, VC2641, VC2642, VC2643, and VC2508 (arginine metabolism and biosynthesis), VC1704 (cysteine and methionine metabolism), VC0162, VC0031 and VC0028 (isoleucine biosynthesis) and VC0392, VCA0604 and VCA0605 (aminotransferases). The increase in metabolism and energy production...”
The virulence transcriptional activator AphA enhances biofilm formation by Vibrio cholerae by activating expression of the biofilm regulator VpsT
Yang, Infection and immunity 2010
- “...this fragment covered the V. cholerae genome region of VC2643 to VC2649 (Fig. 1B). Although most of the genes in this region encode products involved in...”

ACIAD0039 N-alpha-acetylglutamate synthase (amino-acid acetyltransferase) from Acinetobacter sp. ADP1
27% identity, 54% coverage

iTRAQ-Based Comparative Proteomic Analysis of Acinetobacter baylyi ADP1 Under DNA Damage in Relation to Different Carbon Sources
Jiang, Frontiers in microbiology 2019
- “...functional category. Protein Gene name ACIAD No. MMA:LB MMC:LB MMP:LB MMS:LB Up-regulated Transferase Acetyltransferase argA ACIAD0039 1.61 1.53 1.74 1.49 2-isopropylmalate synthase leuA ACIAD0530 6.49 11.07 6.55 6.08 Phosphate acetyltransferase pta ACIAD0540 1.82 3.87 3.16 1.75 Acetate kinase (propionate kinase) ack ACIAD0541 1.84 4.02 3.53 2.07...”

P22567 amino-acid N-acetyltransferase (EC 2.3.1.1) from Pseudomonas aeruginosa (see 2 papers)
PA5204 N-acetylglutamate synthase from Pseudomonas aeruginosa PAO1
NP_253891 N-acetylglutamate synthase from Pseudomonas aeruginosa PAO1
28% identity, 58% coverage

Massively parallel mutant selection identifies genetic determinants of Pseudomonas aeruginosa colonization of Drosophila melanogaster
Miles, mSystems 2024
- “...PA4694 ilvC Amino acids [E] PA4696 ilvI Amino acids [E] PA5013 ilvE Amino acids [E] PA5204 argA Amino acids [E] PA5323 argB Amino acids [E] + PA0662 argC Amino acids [E] + PA3525 argG Amino acids [E] + PA3537 argF Amino acids [E] PA5263 argH Amino...”
Proteome profiling of Pseudomonas aeruginosa PAO1 identifies novel responders to copper stress
Wright, BMC microbiology 2019
- “...3] Class 3 PA3011 1.58 0.009 7 DNA topoisomerase I Cytoplasmic [Class 3] Class 2 PA5204 1.67 0.002 12 N-acetylglutamate synthase Cytoplasmic [Class 3] Class 1 PA3552 1.79 0.007 5 ArnB Cytoplasmic [Class 3] Class 2 PA4272 1.86 0.001 3 50S ribosomal protein L10 Cytoplasmic [Class...”
Functional dissection of N-acetylglutamate synthase (ArgA) of Pseudomonas aeruginosa and restoration of its ancestral N-acetylglutamate kinase activity
Sancho-Vaello, Journal of bacteriology 2012
- “...in pET22b (from Novagene) of argA (PA5204 gene) (http://cmr.jcvi.org/tigr-scripts /CMR/CmrHomePage.cgi) from P. aeruginosa encoding wild-type (WT) NAGS with...”
Functional dissection of N-acetylglutamate synthase (ArgA) of Pseudomonas aeruginosa and restoration of its ancestral N-acetylglutamate kinase activity.
Sancho-Vaello, Journal of bacteriology 2012
- GeneRIF: The N-terminal amino acid kinase domain of argA was hexameric and inactive, whereas the C-terminal histone acetyltransferase domain was monomeric/dimeric and catalytically active.
Functional characterization of a novel ArgA from Mycobacterium tuberculosis
Errey, Journal of bacteriology 2005
- “...EC, E. coli (NP_417295); PA, P. aeruginosa (NP_253891). Residues in boldface indicate similarity, residues in black indicate conserved residues. National Center...”
Proteomic approach to identify host cell attachment proteins provides protective Pseudomonas aeruginosa vaccine antigen FtsZ
Jurado-Martín, NPJ vaccines 2024
- “...5.52 Q51487 Outer membrane protein M (OprM) LES 431, 57P31PA, A5803 4 31.315.7 52.6 5.52 P22567 Amino-acid N-acetyltransferase (ArgA) LES 431, 57P31PA, A5803 4 23.417.9 47.7 5.95 P47204 Cell division protein (FtsZ) LES 431, 57P31PA, A5803 4 39.119.0 41.2 4.91 Q9I3D2 Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate...”

BA4353 acetylglutamate kinase from Bacillus anthracis str. Ames
GBAA4353 acetylglutamate kinase from Bacillus anthracis str. 'Ames Ancestor'
31% identity, 50% coverage

An in silico analysis of T-box regulated genes and T-box evolution in prokaryotes, with emphasis on prediction of substrate specificity of transporters
Wels, BMC genomics 2008
- “...of the transporter is higher than between the Tyr T-box and the Tyr T-box preceding BA4353 (NhaC family transporter). This is consistent with the fact that: the Tyr T-box acquisition of the NhaC ortholog should have occurred earlier in history, as the Tyr T-box control of...”
Global gene expression by Bacillus anthracis during growth in mammalian blood
Carlson, Pathogens and disease 2015
- “...GBAA3596 GBAA4351 GBAA4661 GBAA3595 GBAA4269 GBAA5261 GBAA4660 GBAA4353 GBAA5464 GBAA5150 GBAA1685 J5 F.C. Abbrev. Description 9.31 8.44 8.10 7.87 7.85 7.70...”
An attenuated strain of Bacillus anthracis (CDC 684) has a large chromosomal inversion and altered growth kinetics
Okinaka, BMC genomics 2011
- “...S GBAA4328 3953215 Conserved hypothetical protein A T GBAA4328 3953216 Conserved hypothetical protein A V GBAA4353 3973954 Acetylglutamate kinase G R GBAA4388 4002699 Phosphate butyryl transferase A V GBAA4408 4021751 Acetyl-CoA carboxylase Q * GBAA4430 4037923 Hypothetical protein A T GBAA4515 4109405 RNA polymerase sigma-43 K...”

DR2442 N-acetylglutamate kinase from Deinococcus radiodurans R1
31% identity, 51% coverage

Characterization of the Radiation Desiccation Response Regulon of the Radioresistant Bacterium Deinococcus radiodurans by Integrative Genomic Analyses
Eugénie, Cells 2021
- “...N-acetyltransferase 209/193 AATACGCTAGGGGCGTAAA/ ATTCCGGTAAAGACAGAAT no/no 3 DR2441 DRO_2415 d drN , putatively in operon with dr2442 acetyltransferase 109 AATTTGTTATTTGCGAACT yes/yes 3,5 Metabolism and metabolic transport DR0217 DRO_0217 thiosulfate sulfurtransferase +4 ATTACGCCAAAGACGTGTT no/no 4 DR0561 DRO_0559 sugar ABC transporter substrate-binding protein 245 GTTCAGGAAAAAACATAAC no protein observed DR1297...”

STM2992 N-alpha-acetylglutamate synthase (amino-acid acetyltransferase) from Salmonella typhimurium LT2
24% identity, 60% coverage

Global transcriptional analysis of dehydrated Salmonella enterica serovar Typhimurium
Gruzdev, Applied and environmental microbiology 2012
- “...hisF (STM2077) glpB (STM2285) nifS (STM2543) argA (STM2992) ygjU (STM3225) argG (STM3290.S) gltB (STM3330) gltD (STM3331) prlC (STM3594) argE (STM4120) argC...”
Intraspecies variation in the emergence of hyperinfectious bacterial strains in nature
Heithoff, PLoS pathogens 2012
- “...0.89 1.59 1.60 Induced during macrophage infection [150] ; also known as psiE . ArgR STM2992 argA 0.51 2.71 3.50 N-acetylglutamate synthase [91] . STM4122 argB 0.56 1.64 2.74 Acetylglutamate kinase [91] . STM3468 argD 1.26 2.84 4.31 Bifunctional N-succinyldiaminopimelate-aminotransferase/acetylornithine transaminase protein [91] . STM3290 argG...”
Salmonella enterica serovar typhimurium colonizing the lumen of the chicken intestine grows slowly and upregulates a unique set of virulence and metabolism genes
Harvey, Infection and immunity 2011
- “...fidL Amino acid transport and metabolism STM0878 STM2992 STM4296 STM1094 STM4105 STM3965 STM3086 STM0887 STM2055 STM2056 STM2469 STM2468 STM0877 STM0878...”

VP2758 acetylglutamate kinase from Vibrio parahaemolyticus RIMD 2210633
28% identity, 55% coverage

Transcriptome analysis of Vibrio parahaemolyticus in type III secretion system 1 inducing conditions
Nydam, Frontiers in cellular and infection microbiology 2014
- “...COG4960OU vp2423 Fimbrial protein COG3847U vp2596 LysE/ArgO (YggA) family protein COG1279R vp2597 DNA-binding protein COG2606S vp2758 Acetylglutamate kinase COG0548E vpa0159 Hypothetical protein COG5266P vpa0289 Hypothetical protein COG1280E vpa0597 Hypothetical protein vpa0635 Oxidoreductase, oxygen dependent, FAD-dependent protein COG0277C vpa0882 Heme transport protein HutA COG1629P vpa1275 Short chain...”
- “...COG0165E 7.5 13.1 14.4 23.4 24.6 vp2757 Argininosuccinate synthase COG0137E 12.4 29.2 33.1 52.5 65.4 vp2758 Acetylglutamate kinase COG0548E 9.5 21.3 22.6 43.7 45.7 vp2910 Hypothetical protein COG4974L 2.0 4.8 6.7 11.6 15.1 vpa0035 Sodium/glutamate symporter COG0786E 7.0 1.3 1.7 3.0 3.5 vpa0639 Arginine transporter permease...”

Hoch_4935 acetylglutamate kinase from Haliangium ochraceum DSM 14365
29% identity, 53% coverage

The N-Acetylglutamate Synthase Family: Structures, Function and Mechanisms
Shi, International journal of molecular sciences 2015
- “...performs the NAGK function. In the Haliangium ochraceum genome, where there is a separate gene (Hoch_4935) for a bacterial-type NAGK, the gene for NAGS appears fused to the argC gene for N -acetyl--glutamyl-phosphate reductase. Thus, this gene (Hoch_4300, incorrectly annotated as argC only) resembles the yeast...”

NAGS_NEUCR / Q1K8F6 Amino-acid acetyltransferase, mitochondrial; Arginine-requiring protein 14; Glutamate N-acetyltransferase; N-acetylglutamate synthase; AGS; NAGS; EC 2.3.1.1 from Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) (see 2 papers)
38% identity, 18% coverage

function: N-acetylglutamate synthase involved in arginine biosynthesis.
catalytic activity: L-glutamate + acetyl-CoA = N-acetyl-L-glutamate + CoA + H(+) (RHEA:24292)

t2900 N-acetylglutamate synthase from Salmonella enterica subsp. enterica serovar Typhi Ty2
24% identity, 60% coverage

Salmonellamultimutants enable efficient identification of SPI-2 effector protein function in gut inflammation and systemic colonization
Newson, 2024

PMI3238 acetylglutamate kinase from Proteus mirabilis HI4320
28% identity, 55% coverage

Transcriptional analysis of the MrpJ network: modulation of diverse virulence-associated genes and direct regulation of mrp fimbrial and flhDC flagellar operons in Proteus mirabilis
Bode, Infection and immunity 2015
- “...vector control Gene Annotationa PMI0271 PMI0748 PMI0747 PMI0347 PMI3238 PMI0749 PMI0263 mrpJ Fimbrial operon regulator Type VI secretion system protein Type VI...”

KSF55_02455 acetylglutamate kinase from Lactiplantibacillus pentosus
27% identity, 50% coverage

Genome-wide transcriptomics revealed carbon source-mediated gamma-aminobutyric acid (GABA) production in a probiotic, Lactiplantibacillus pentosus 9D3
Raethong, Heliyon 2025
- “...the DEGs encoding enzymes for the arginine metabolism such as acetyl-gamma-glutamyl-phosphate reductase (KSF55_02445), acetylglutamate kinase (KSF55_02455), acetylornithine aminotransferase (KSF55_02460), glutamate acetyltransferase (KSF55_02450), ornithine carbamoyltransferase (KSF55_02465), arginosuccinate lyase (KSF55_03925), and arginosuccinate synthase (KSF55_03920) exhibited significantly higher expression levels in glucose cultures than in those grown on sucrose...”

SXYL_00241 acetylglutamate kinase from Staphylococcus xylosus
27% identity, 50% coverage

Transcriptomic analysis of Staphylococcus xylosus in the presence of nitrate and nitrite in meat reveals its response to nitrosative stress
Vermassen, Frontiers in microbiology 2014
- “...ureE 2.6 SXYL_00292 ureF Urease accessory protein UreF 2.7 SXYL_00238 rocD1 Ornithine aminotransferase 1 0.6 SXYL_00241 argB Acetylglutamate kinase 0.6 SXYL_00239 argC N-acetyl-gamma-glutamyl-phosphate reductase 0.6 SXYL_02450 Arginine/lysine/ornithine decarboxylase 0.7 SXYL_01961 argG Argininosuccinate synthase 1.6 SXYL_01373 asnA L-asparaginase 1.9 Peptidase SXYL_01980 ampA Cytosol aminopeptidase 1.9 SXYL_01931 Oligoendopeptidase...”

NAGS_YEAST / P40360 Amino-acid acetyltransferase, mitochondrial; Arginine-requiring protein 2; Glutamate N-acetyltransferase; N-acetylglutamate synthase; AGS; NAGS; EC 2.3.1.1 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 5 papers)
YJL071W Acetylglutamate synthase (glutamate N-acetyltransferase), mitochondrial enzyme that catalyzes the first step in the biosynthesis of the arginine precursor ornithine; forms a complex with Arg5,6p from Saccharomyces cerevisiae
34% identity, 21% coverage

function: N-acetylglutamate synthase involved in arginine biosynthesis.
catalytic activity: L-glutamate + acetyl-CoA = N-acetyl-L-glutamate + CoA + H(+) (RHEA:24292)
subunit: Interacts with the acetylglutamate kinase chain of AGR5,6.
Generation of a Yeast Cell Model Potentially Useful to Identify the Mammalian Mitochondrial N-Acetylglutamate Transporter
Gorgoglione, Biomolecules 2023
- “...database ( https://www.yeastgenome.org/ (accessed on 21 April 2023)) reports that the single deletion of ARG2 (YJL071w), ARG5,6 (YER069w) and ARG7 (YMR062c) genes leads to an arginine auxotrophy [ 56 , 57 , 58 ]. The deletion of ARG2 or ARG7 is not helpful for our project...”
Pex35 is a regulator of peroxisome abundance
Yofe, Journal of cell science 2017
- “...0.32 0.40 6 YJL101C Gsh1 0.22 0.11 0.47 7 YBR081C Spt7 0.20 0.10 0.48 8 YJL071W Arg2 0.21 0.11 0.51 9 YNL270C Alp1 1.30 0.69 0.53 10 YER116C Slx8 0.25 0.14 0.54 11 YGL143C Mrf1 0.49 0.28 0.57 12 YBR251W Mrps5 0.13 0.07 0.57 13 YNL005C...”
RSC Chromatin-Remodeling Complex Is Important for Mitochondrial Function in Saccharomyces cerevisiae
Imamura, PloS one 2015
- “...PPA2 PyroPhosphatAse YJR104C SOD1 SuperOxide Dismutase General metabolism Amino acid biosynthesis YLR027C AAT2 Aspartate AminoTransferase YJL071W ARG2 ARGinine requiring YJL088W ARG3 ARGinine requiring YER069W ARG5 , 6 ARGinine requiring YDR127W ARO1 AROmatic amino acid requiring YOR303W CPA1 Carbamyl Phosphate synthetase A YAL012W CYS3 CYStathionine gamma-lyase YEL046C...”
dSLAM analysis of genome-wide genetic interactions in Saccharomyces cerevisiae
Pan, Methods (San Diego, Calif.) 2007
- “...growth YIL036W CST6 Requires uracil for optimal growth YJL071W ARG2 Lethal on magic medium YJL130C URA2 Uracil biosynthesis YJL148W RPA34 Extreme slow growth...”
A new yeast metabolon involving at least the two first enzymes of arginine biosynthesis: acetylglutamate synthase activity requires complex formation with acetylglutamate kinase
Abadjieva, The Journal of biological chemistry 2001 (PubMed)
- “...California, Berkeley on February 17, 2017 Open reading frame YJL071W of Saccharomyces cerevisiae was shown to be ARG2 and identified as the structural gene for...”
- “...University of California, Berkeley on February 17, 2017 YJL071W Is Allelic to ARG2 and Is the Structural Gene for Acetylglutamate Synthase--FastA and BLAST...”
Disruption of six ORFs on Saccharomyces cerevisiae chromosome X: the YJL069c gene of unknown function is essential to cell viability
Vandenbol, Yeast (Chichester, England) 1999 (PubMed)
- “...c, human esterase D and rat AMP deaminase 1. YJL071w has recently been identified as the ARG2 gene coding for acetylglutamate synthase. Inactivation of the...”
- “...YJL070C A1 A2 A3 A4 S1 S2 YJL071W A1 A2 A3 A4 S1 S2 K2 K3 GGGATATCACGACGACGAAGACGTTACT GTGGTAGGAGTGGATTATCG CGATAATCCACTCCTACCAC GGGATATCCAATCTGCCACCACAGACAC...”

APJL_0696 amino-acid acetyltransferase from Actinobacillus pleuropneumoniae serovar 3 str. JL03
23% identity, 63% coverage

A Transcriptome Map of Actinobacillus pleuropneumoniae at Single-Nucleotide Resolution Using Deep RNA-Seq
Su, PloS one 2016
- “...755351 755515 164 - Y APJL_0687(-) APJL_0688(+) MOCO_RNA_motif B APP-S21 765539 765588 50 Y Y APJL_0696(-) APJL_0697(-) - B APP-S22 773794 773833 40 - Y APJL_0700(-) APJL_0703(-) - A APP-S23 783905 783980 76 Y - APJL_0707(-) APJL_0708(+) - A APP-S24 801903 801952 50 Y Y APJL_0730(+)...”

3t7bB / Q8ZA87 Crystal structure of n-acetyl-l-glutamate kinase from yersinia pestis
29% identity, 55% coverage

Ligand: glutamic acid (3t7bB)

YPTB0111 acetylglutamate kinase from Yersinia pseudotuberculosis IP 32953
YPO3925 acetylglutamate kinase from Yersinia pestis CO92
YP_3124 acetylglutamate kinase from Yersinia pestis biovar Medievalis str. 91001
28% identity, 55% coverage

Differential Gene Expression Patterns of Yersinia pestis and Yersinia pseudotuberculosis during Infection and Biofilm Formation in the Flea Digestive Tract
Chouikha, mSystems 2019
- “...YPTB3736 YPO0165 LacI family transcriptional regulator 2.1 2.0 YPTB0110 YPO3927 argC N-Acetyl-gamma-glutamyl-phosphate reductase 5.0 3.6 YPTB0111 YPO3925 argB Acetylglutamate kinase 3.0 3.0 YPTB0336 YPO0279 hmuV Hemin importer ATP-binding subunit 3.4 3.1 YPTB0337 YPO0280 hmuU ABC hemin transporter, permease subunit 4.1 3.6 YPTB0338 YPO0281 hmuT ABC transporter,...”
Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Rosso, BMC microbiology 2008
- “...(cysE) YPO0070 serine acetyltransferase 1.669 (0.016) YPTB0106 (metL) YPO0116 bifunctional aspartokinase/homoserine dehydrogenase II 1.565 (0.045) YPTB0111 (argB) YPO3925 acetylglutamate kinase 1.495 (0.016) YPTB0112 (argH) YPO3924 putative argininosuccinate lyase 1.779 (0.007) YPTB0134 (ilvG) YPO3901 acetolactate synthase isozyme II large subunit 0.627 (0.039) YPTB0203 (rhtC) YPO3832 threonine efflux...”
Differential Gene Expression Patterns of Yersinia pestis and Yersinia pseudotuberculosis during Infection and Biofilm Formation in the Flea Digestive Tract
Chouikha, mSystems 2019
- “...YPO0165 LacI family transcriptional regulator 2.1 2.0 YPTB0110 YPO3927 argC N-Acetyl-gamma-glutamyl-phosphate reductase 5.0 3.6 YPTB0111 YPO3925 argB Acetylglutamate kinase 3.0 3.0 YPTB0336 YPO0279 hmuV Hemin importer ATP-binding subunit 3.4 3.1 YPTB0337 YPO0280 hmuU ABC hemin transporter, permease subunit 4.1 3.6 YPTB0338 YPO0281 hmuT ABC transporter, periplasmic...”
Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Rosso, BMC microbiology 2008
- “...serine acetyltransferase 1.669 (0.016) YPTB0106 (metL) YPO0116 bifunctional aspartokinase/homoserine dehydrogenase II 1.565 (0.045) YPTB0111 (argB) YPO3925 acetylglutamate kinase 1.495 (0.016) YPTB0112 (argH) YPO3924 putative argininosuccinate lyase 1.779 (0.007) YPTB0134 (ilvG) YPO3901 acetolactate synthase isozyme II large subunit 0.627 (0.039) YPTB0203 (rhtC) YPO3832 threonine efflux protein 0.597...”
Comparative Lysine Acetylome Analysis of Y. pestis YfiQ/CobB Mutants Reveals that Acetylation of SlyA Lys73 Significantly Promotes Biofilm Formation of Y. pestis
Tan, Microbiology spectrum 2023
- “...ligase YP_0638 argI Ornithine carbamoyl transferase YP_3602 gcvP Glycine dehydrogenase (decarboxylating) YP_2548 glyA Serine hydroxymethyltransferase YP_3124 argB Acetylglutamate kinase YP_0566 argR Arginine repressor YP_3842 pyrB Aspartate carbamoyl transferase GTPase activity (GO:0003924) YP_3117 tufB Elongation factor Tu-B YP_2471 ureG Urease accessory protein UreG YP_0520 rsgA Small ribosomal...”

BT3395 N-succinylglutamate kinase (EC 2.7.2.-) from Bacteroides thetaiotaomicron VPI-5482
BT3395 putative acetylglutamate kinase from Bacteroides thetaiotaomicron VPI-5482
26% identity, 50% coverage

mutant phenotype: Important for fitness in most defined media, except when arginine is provided. Bacteroidetes use succinylated intermediates, and a close homolog from B. fragilis prefers N-succinylglutamate as a substrate (see PMC7311316 and references therein), so this is N-succinylglutamate kinase, not N-acetylglutamate kinase.
Functional genetics of human gut commensal Bacteroides thetaiotaomicron reveals metabolic requirements for growth across environments
Liu, Cell reports 2021
- “...(BT3759, homologous to argC in E. coli ; BT3733, argH ; BT3760, argG ; and BT3395, argB ). Furthermore, BT3761 was critical for growth on minimal media without amino acids, and its fitness defect was rescued through addition of arginine ( Figure 1E ). Additionally, quantitative...”

APH_0422 acetylglutamate kinase from Anaplasma phagocytophilum HZ
26% identity, 45% coverage

Anaplasma phagocytophilum Asp14 is an invasin that interacts with mammalian host cells via its C terminus to facilitate infection
Kahlon, Infection and immunity 2013
- “...APH_0283 APH_0893 APH_0111 APH_0608 APH_1359 APH_1084 APH_0422 APH_0971 APH_0038 APH_1355 APH_0669 APH_0450 APH_0231 APH_0874 APH_1017 APH_1339 APH_0168...”

SGGMMB4_05193 acetylglutamate kinase from Sodalis glossinidius str. 'morsitans'
28% identity, 55% coverage

A Tale of Three Species: Adaptation of Sodalis glossinidius to Tsetse Biology, Wigglesworthia Metabolism, and Host Diet
Hall, mBio 2019
- “...codon 443 aa 418 aa SGGMMB4_04655 (argA_2) 804 bp total argB 777 bp Sant_3956 ACGK SGGMMB4_05193 New annotation indicates full-length gene 258 aa 257 aa 765 bp argC 1,005 bp Sant_3957 AGPR SGGMMB4_05194 New annotation indicates full-length gene and ArgC detected by proteomics 334 aa 334...”

LHK_02338 ArgA from Laribacter hongkongensis HLHK9
26% identity, 66% coverage

General metabolism of Laribacter hongkongensis: a genome-wide analysis
Curreem, Cell & bioscience 2011
- “...from the genomic sequence, several genes involved in the biosynthesis (amino-acid acetyltransferase gene argA : LHK_02338, LHK_02366 ; acetylglutamate kinase gene argB: LHK_02337, LHK_02829) and catabolism (whole operon of arginine deiminase arcB / A / C / D : LHK_02727-LHK_02734) of arginine are duplicated in L....”

ArgB / b3959 acetylglutamate kinase (EC 2.7.2.8) from Escherichia coli K-12 substr. MG1655 (see 4 papers)
argB / P0A6C8 acetylglutamate kinase (EC 2.7.2.8) from Escherichia coli (strain K12) (see 4 papers)
ARGB_ECOLI / P0A6C8 Acetylglutamate kinase; N-acetyl-L-glutamate 5-phosphotransferase; NAG kinase; NAGK; EC 2.7.2.8 from Escherichia coli (strain K12) (see 4 papers)
A0A140NEG9 acetylglutamate kinase (EC 2.7.2.8) from Escherichia coli (see paper)
1gs5A / P0A6C8 N-acetyl-l-glutamate kinase from escherichia coli complexed with its substrate n-acetylglutamate and its substrate analog amppnp (see paper)
argB / SP|P0A6C8 acetylglutamate kinase; EC 2.7.2.8 from Escherichia coli (see 2 papers)
b3959 acetylglutamate kinase from Escherichia coli str. K-12 substr. MG1655
CXG97_RS23620, OI124_15960 acetylglutamate kinase from Escherichia coli
27% identity, 55% coverage

function: Catalyzes the ATP-dependent phosphorylation of N-acetyl-L- glutamate.
catalytic activity: N-acetyl-L-glutamate + ATP = N-acetyl-L-glutamyl 5-phosphate + ADP (RHEA:14629)
subunit: Homodimer.
Ligands: n-acetyl-l-glutamate; phosphoaminophosphonic acid-adenylate ester (1gs5A)
A system-level model for the microbial regulatory genome
Brooks, Molecular systems biology 2014
- “...effects Gene 1 Gene 2 Fitness correlation Regulon gene 1 Regulon gene 2 Corems b3774 b3959 0.959012 IlvY ArgR 512157 b2913 b3829 0.938764 PurR MetR 512157 b3829 b3959 0.934393 MetR ArgR 512157;554056 b2913 b3941 0.932025 PurR MetR 512157 b3957 b3941 0.931565 ArgR MetR 512157;554056 b3172 b3829...”
- “...IlvY 512157;512477 b3941 b3774 0.927251 MetR IlvY 512157 b3960 b3941 0.921375 ArgR MetR 512157;554056 b3941 b3959 0.921282 MetR ArgR 512157;554056 EGRIN 2.0 predicts detailed organization and context-specific importance of GREs in gene promoters We next investigated accuracy of EGRIN 2.0-predicted spatial organization of GREs and their...”
Global transcriptomic analysis of an engineered Escherichia coli strain lacking the phosphoenolpyruvate: carbohydrate phosphotransferase system during shikimic acid production in rich culture medium
Cortés-Tolalpa, Microbial cell factories 2014
- “...Cellular function GO b Average expression argA b2818 Acetylglutamate synthase Amino acid metabolism 87.9837 argB b3959 N-acetylglutamate kinase Amino acid metabolism 45.8143 argC b3958 N-acetylglutamylphosphate reductase Amino acid metabolism 53.4932 argD b3359 N-succinyldiaminopimelate-aminotransferase/acetylornithine transaminase Amino acid metabolism 21.9053 argE b3957 Acetylornithine deacetylase Amino acid metabolism 18.7485...”
Quantitative assessment of thermodynamic constraints on the solution space of genome-scale metabolic models
Hamilton, Biophysical journal 2013
- “...b3958 argC Lethal Lethal Nonlethal Lethal Nonlethal Lethal b3959 argB Lethal Lethal Nonlethal Lethal Nonlethal Lethal b4226 ppa Lethal Lethal Nonlethal Lethal...”
Gap-filling analysis of the iJO1366 Escherichia coli metabolic network reconstruction for discovery of metabolic functions
Orth, BMC systems biology 2012
- “...identified ilvE (b3770) pabC (b1096) 8.00E-8 dapF (b3809) none identified argC (b3958) none identified argB (b3959) none identified hemE (b3997) none identified ubiC (b4039) none identified purA (b4177) none identified Computational prediction of gap-filling reactions One cause of model gaps and false negative phenotypic predictions is...”
Genome-scale analysis to the impact of gene deletion on the metabolism of E. coli: constraint-based simulation approach
Xu, BMC bioinformatics 2009
- “...b4041 b2316 b2312, b2476 b4013 b3957 b4160 b2323 b2499, b2507 s0001 b3958 b3255 b2557, b2780 b3959 b3256 b3642, b4005 b3960 b4006, b4177 s0001 b4244, b4245 SS NSP CAC GSM TTPM TIM genes b0639 b0720 b0907 b0908, b1260 b0914 b1098 b1136 b1261, b1262 s0001 b2827 b1263, b1264...”
Experimental and computational assessment of conditionally essential genes in Escherichia coli
Joyce, Journal of bacteriology 2006
- “...(b0121) amtB (b0451) glpF (b3927) cysW (b2423) argB (b3959); argC (b3958); argD (b3359); argG (b3172) aspC (b0928) ilvY (b3773); ilvE (b3770); lrp (b0889) aldA...”
Interfering with different steps of protein synthesis explored by transcriptional profiling of Escherichia coli K-12
Sabina, Journal of bacteriology 2003
- “...rplV rpmD rpsL sfsA soxS trmD trpC trxA wrbA b2818 b3959 b2601 b2414 b0014 b3870 b3774 b3774 b0344 b0642 b3460 b3829 b4143 b0957 b3315 b3302 b3342 b0146 b4062...”
- “...b4254 b4242 b0014 b0273 b1738 b2592 b3958 b0235 b0473 b3959 b3172 b1737 b1814 b4143 b1829 b0603. b0015 b4142 b1216 b3728 b2614 b1320 b2309 b0161 b0607 b1190...”
Combined, functional genomic-biochemical approach to intermediary metabolism: interaction of acivicin, a glutamine amidotransferase inhibitor, with Escherichia coli K-12
Smulski, Journal of bacteriology 2001
- “...b2296 b0463 b0464 b0605 b1300 b1927 b0980 b0062 b2818 b3959 b3958 b3359 b3957 b3172 b3960 b3237 b0754 b0928 b0311 b0312 b0313 b0314 b3336 b4149 b0175 b1216...”
Protein engineering using variational free energy approximation
Lobzaev, Nature communications 2024
- “...we began by performing in silico mutagenesis of the Ec NAGK wildtype sequence (Uniprot id: P0A6C8; PDB id: 1GS5) to build the input dataset required to approximate the sequence-to-energy relationship for this enzyme (see Methods). With our procedure, we generated 117,387 unique variants, with each variant...”
Interaction of N-acetyl-l-glutamate kinase with the PII signal transducer in the non-photosynthetic alga Polytomella parva: Co-evolution towards a hetero-oligomeric enzyme
Selim, The FEBS journal 2020
- “...7942 (Q6V1L5) and Synechocystis sp. PCC 6803 (P73326), and bacteria Thermotoga maritima (Q9X2A4) and Escherichiacoli (P0A6C8). Highlighted residues in black are invariant in at least 55% of aligned NAGK proteins. Amino acids in blue represent similar residues. Box I refers to plastidtargeting signal peptides sequence (ChloP...”
Pathogenicity and identification of host adaptation genes of the avian pathogenic Escherichia coli O145 in duck
Tan, Frontiers in cellular and infection microbiology 2024
- “...Proline dehydrogenase -18.45 0.0276 L-Glutamate OI124_11515 cyoE K02257 Heme o synthase -20.82 0.0198 Heme O OI124_15960 argB K00930 Acetylglutamate kinase 6.15 0.0316 N-Acetyl-glutamyl-P OI124_15965 argC K00145 N-acetylglutamylphosphate reductase 9.73 9.74E-07 N-Acetylglutamate semialdehyde OI124_17115 ilvC K00053 Ketol-acid reductoisomerase -20.03 0.0210 (S)-2-Acetolactate, etal. OI124_17460 tnaA K01667 Tryptophanase 5.37...”
Transcriptome profiling of avian pathogenic Escherichia coli and the mouse microvascular endothelial cell line bEnd.3 during interaction
Wang, PeerJ 2020
- “...protein-export protein SecB CXG97_RS19155 SecG 1.1816 0.027567 protein-export membrane protein SecG Arginine and proline metabolism CXG97_RS23620 argB 3.3547 1.35E05 acetylglutamate kinase CXG97_RS17080 arcC 1.6337 0.008478 carbamate kinase CXG97_RS08705 patD 1.3149 0.037641 gamma-aminobutyraldehyde dehydrogenase CXG97_RS25795 argF 8.588 1.37E24 ornithine carbamoyltransferase CXG97_RS03780 speF 1.5823 0.034956 ornithine decarboxylase SpeF...”

ECs4888 acetylglutamate kinase from Escherichia coli O157:H7 str. Sakai
27% identity, 55% coverage

Global transcriptional response of Escherichia coli O157:H7 to growth transitions in glucose minimal medium
Bergholz, BMC microbiology 2007
- “...ppc -3.62 1 ECs3802 O157 -2.43 6 ECs4887 argC -3.99 1 ECs3811 yggG 2.28 2 ECs4888 argB -3.62 1 ECs3818 metK -3.03 1 ECs4893 O157 2.09 2 ECs3840 nupG 2.44 2 ECs4907 rplA -3.02 1 ECs3931 glgS 2.94 2 ECs4908 rplJ -2.64 1 ECs4052 argG -2.68...”

SF5M90T_2823 amino-acid N-acetyltransferase from Shigella flexneri 5a str. M90T
22% identity, 60% coverage

RNA-seq analysis of the influence of anaerobiosis and FNR on Shigella flexneri
Vergara-Irigaray, BMC genomics 2014
- “...protein -1.93 1.58 SF5M90T_2185 fruA PTS system, fructose-specific transport protein -1.99 Aminoacid transport and metabolism SF5M90T_2823 argA N-acetylglutamate synthase 1.94 SF5M90T_1910 fliY putative periplasmic binding transport protein 1.80 SF5M90T_625 ybgH peptide transporter 1.64 -1.60 -1.21 SF5M90T_292 pepD aminoacyl-histidine dipeptidase (peptidase D) 1.54 1.78 1.75 SF5M90T_2879 gcvT...”

Sant_3956 acetylglutamate kinase from Sodalis praecaptivus
29% identity, 55% coverage

A Tale of Three Species: Adaptation of Sodalis glossinidius to Tsetse Biology, Wigglesworthia Metabolism, and Host Diet
Hall, mBio 2019
- “...GTG start codon 443 aa 418 aa SGGMMB4_04655 (argA_2) 804 bp total argB 777 bp Sant_3956 ACGK SGGMMB4_05193 New annotation indicates full-length gene 258 aa 257 aa 765 bp argC 1,005 bp Sant_3957 AGPR SGGMMB4_05194 New annotation indicates full-length gene and ArgC detected by proteomics 334...”

ArgA / b2818 N-acetylglutamate synthase (EC 2.3.1.1) from Escherichia coli K-12 substr. MG1655 (see 2 papers)
argA / P0A6C5 N-acetylglutamate synthase (EC 2.3.1.1) from Escherichia coli (strain K12) (see 5 papers)
ARGA_ECOLI / P0A6C5 Amino-acid acetyltransferase; N-acetylglutamate synthase; AGS; NAGS; EC 2.3.1.1 from Escherichia coli (strain K12) (see paper)
argA / RF|NP_417295 amino-acid acetyltransferase from Escherichia coli K12 (see paper)
b2818 N-acetylglutamate synthase from Escherichia coli str. K-12 substr. MG1655
NP_417295 N-acetylglutamate synthase from Escherichia coli str. K-12 substr. MG1655
UTI89_C3219 N-acetylglutamate synthase from Escherichia coli UTI89
ECs3675 N-acetylglutamate synthase from Escherichia coli O157:H7 str. Sakai
22% identity, 60% coverage

catalytic activity: L-glutamate + acetyl-CoA = N-acetyl-L-glutamate + CoA + H(+) (RHEA:24292)
subunit: Homohexamer.
Essential Genome of the Metabolically Versatile Alphaproteobacterium Rhodopseudomonas palustris
Pechter, Journal of bacteriology 2015
- “...RPA2035 RPA3834 RPA4270 RPA4309 hisG ilvC idh thrB serC b3735 b2818 b3957 b2019 b3774 b1136 b0003 b0907 atpH argA argE hisG ilvC icd thrB serC ATP synthase F0F1...”
- “...protein, E. coli encodes two single-function proteins, ArgA (b2818) and ArgE (b3597); both are essential for E. coli strain MG1655 to grow in minimal...”
Global transcriptomic analysis of an engineered Escherichia coli strain lacking the phosphoenolpyruvate: carbohydrate phosphotransferase system during shikimic acid production in rich culture medium
Cortés-Tolalpa, Microbial cell factories 2014
- “...SA production cultures Gene Locus Protein name a Cellular function GO b Average expression argA b2818 Acetylglutamate synthase Amino acid metabolism 87.9837 argB b3959 N-acetylglutamate kinase Amino acid metabolism 45.8143 argC b3958 N-acetylglutamylphosphate reductase Amino acid metabolism 53.4932 argD b3359 N-succinyldiaminopimelate-aminotransferase/acetylornithine transaminase Amino acid metabolism 21.9053...”
Quantitative assessment of thermodynamic constraints on the solution space of genome-scale metabolic models
Hamilton, Biophysical journal 2013
- “...b2615 nadK Lethal Lethal Nonlethal Lethal Nonlethal Lethal b2818 argA Lethal Lethal Nonlethal Lethal Nonlethal Lethal b3607 cysE Lethal Lethal Nonlethal Lethal...”
Genome-scale analysis to the impact of gene deletion on the metabolism of E. coli: constraint-based simulation approach
Xu, BMC bioinformatics 2009
- “...PPB genes b0159 b0159 b0175 b0185 b0522, b0523 b2687 b0386 b2585 b1092 b0945, b1062 b2942 b2818 b3018 b1094 b1131, b1281 b3939 b3172 b4041 b2316 b2312, b2476 b4013 b3957 b4160 b2323 b2499, b2507 s0001 b3958 b3255 b2557, b2780 b3959 b3256 b3642, b4005 b3960 b4006, b4177 s0001 b4244,...”
Experimental and computational assessment of conditionally essential genes in Escherichia coli
Joyce, Journal of bacteriology 2006
- “...Berkeley Amino acid metabolism ....................................... argA (b2818) argE (b3957) argH (b3960) aroA (b0908) aroB (b3389) aroC (b2329) aroD...”
Sulfur and nitrogen limitation in Escherichia coli K-12: specific homeostatic responses
Gyaneshwar, Journal of bacteriology 2005
- “...genes (b1260, b1261, and b1263), and six arg biosynthetic genes (b2818, b3958 to b3960, b3172, and b3359) (Fig. 2). Regulation of the trp and arg genes is of...”
Interfering with different steps of protein synthesis explored by transcriptional profiling of Escherichia coli K-12
Sabina, Journal of bacteriology 2003
- “...ompA rplV rpmD rpsL sfsA soxS trmD trpC trxA wrbA b2818 b3959 b2601 b2414 b0014 b3870 b3774 b3774 b0344 b0642 b3460 b3829 b4143 b0957 b3315 b3302 b3342 b0146...”
- “...chaA pstS grpE ycjW hisJ htrA ybdQ dadX dadA b3687 b2818 b1455 b4254 b4242 b0014 b0273 b1738 b2592 b3958 b0235 b0473 b3959 b3172 b1737 b1814 b4143 b1829 b0603....”
Combined, functional genomic-biochemical approach to intermediary metabolism: interaction of acivicin, a glutamine amidotransferase inhibitor, with Escherichia coli K-12
Smulski, Journal of bacteriology 2001
- “...metA b2296 b0463 b0464 b0605 b1300 b1927 b0980 b0062 b2818 b3959 b3958 b3359 b3957 b3172 b3960 b3237 b0754 b0928 b0311 b0312 b0313 b0314 b3336 b4149 b0175 b1216...”
Functional characterization of a novel ArgA from Mycobacterium tuberculosis
Errey, Journal of bacteriology 2005
- “...SC, S. coelicolor (NP_627584); EC, E. coli (NP_417295); PA, P. aeruginosa (NP_253891). Residues in boldface indicate similarity, residues in black indicate...”
Complete nucleotide sequence of the Escherichia coli argA gene.
Brown, Nucleic acids research 1987
- GeneRIF: N-terminus verified by Edman degradation on mature peptide
Inferring protein function from homology using the Princeton Protein Orthology Database (P-POD).
Livstone, Current protocols in bioinformatics 2011
- “...D. discoideum rnrB Actr10 ribonucleoside-diphosphate reductase DDB_G0274021 D. melanogaster dpp Activin-A-receptor-25D decapentaplegic FBgn0000490 E. coli P0A6C5 G. gallus PRAF3_CHICK IPI00597483 PRA1 family protein 3 Q5F433 H. sapiens LAMB4_HUMAN IPI00295437 Laminin subunit A4D0S4 M. musculus Abcd1 ALDP ATP-binding cassette, sub-family D MGI:1349215 R. norvegicus Snap25 synaptosomal-associated protein...”
Genetic requirements for uropathogenic E. coli proliferation in the bladder cell infection cycle
Mediati, mSystems 2024
- “...6.01E-03 UTI89_C4510 glpK Aerobic glycerol 3-phosphate dehydrogenase (required for growth on glycerol) 4.98 6.55E-09 1.02E-06 UTI89_C3219 argA N-acetylglutamate synthase (arginine/ornithine biosynthesis) 4.81 1.24E-05 7.18E-04 UTI89_C3814 purH Formyltransferase/IMP cyclohydrolase (purine biosynthesis) 4.80 3.29E-03 6.53E-02 UTI89_C1621 Hypothetical protein (DUF333-containing protein) 4.49 4.81E-03 8.12E-02 UTI89_C1620 Hypothetical protein 4.21 9.48E-03...”
Global transcriptional response of Escherichia coli O157:H7 to growth transitions in glucose minimal medium
Bergholz, BMC microbiology 2007
- “...pyrG -2.98 1 ECs4679 atpE -2.33 1 ECs3659 fucO 2.17 3 ECs4716 rho -2.56 5 ECs3675 argA -4.09 1 ECs4720 wecC -2.34 1 ECs3677 recB -2.17 1 ECs4741 xerC -2.08 1 ECs3701 yqeF 2.50 3 ECs4756 yigL -2.18 1 ECs3743 ygeW 2.08 2 ECs4759 metE -2.76...”

EAMY_0144 Acetylglutamate kinase from Erwinia amylovora CFBP1430
29% identity, 55% coverage

The stringent response regulator (p) ppGpp mediates virulence gene expression and survival in Erwinia amylovora
Yang, BMC genomics 2020
- “...regulator of met regulon 2.41 8.53 Arginine EAMY_1553 argC , acetylglutamate semialdehyde dehydrogenase 2.41 11.13 EAMY_0144 argB , acetylglutamate kinase 2.17 10.74 EAMY_0297 argR , arginine repressor 1.93 8.35 EAMY_0146 argH , argininosuccinate lyase 1.88 10.84 EAMY_0145 argG , argininosuccinate synthase 1.83 11.69 EAMY_3415 argD ,...”

BDBG_00643 amino-acid acetyltransferase, mitochondrial from Blastomyces gilchristii SLH14081
35% identity, 16% coverage

Fungal Morphology, Iron Homeostasis, and Lipid Metabolism Regulated by a GATA Transcription Factor in Blastomyces dermatitidis
Marty, PLoS pathogens 2015
- “...37C, deletion of SREB had limited effect on biosynthetic genes; however, an amino acid acetyltransferase (BDBG_00643) involved with first step in ornithine biosynthesis had a 1.1 log 2 increase ( S3 Fig ); ornithine serves as a substrate for siderophore biosynthesis. Transcript abundance for DE genes...”
- “...( S6 Table ). In addition, SREB-3xHA was enriched upstream of an amino acid acetyltransferase, BDBG_00643, which is derepressed in SREB and is predicted to be involved in the biosynthesis of ornithine. ChIP-qPCR confirmed enrichment of a subset of these genes including the glycolipid surface protein...”

NAGS_CANAL / Q59MB6 Amino-acid acetyltransferase, mitochondrial; Arginine-requiring protein 2; Glutamate N-acetyltransferase; N-acetylglutamate synthase; AGS; NAGS; EC 2.3.1.1 from Candida albicans (strain SC5314 / ATCC MYA-2876) (Yeast) (see paper)
34% identity, 20% coverage

function: N-acetylglutamate synthase involved in arginine biosynthesis.
catalytic activity: L-glutamate + acetyl-CoA = N-acetyl-L-glutamate + CoA + H(+) (RHEA:24292)

lmo1589 highly similar to N-acetylglutamate 5-phosphotransferase from Listeria monocytogenes EGD-e
29% identity, 49% coverage

Genes significantly associated with lineage II food isolates of Listeria monocytogenes
Pirone-Davies, BMC genomics 2018
- “...in lineage II. No truncations are associated with a single isolation source, but truncations in lmo1589, argB , and lmo1433 are frequently present in lineage I isolates, but not lineage II. Analysis of gene clusters for significant association with isolation source We analyzed OrthoMCL gene clusters...”
Listeria monocytogenes grown at 7° C shows reduced acid survival and an altered transcriptional response to acid shock compared to L. monocytogenes grown at 37° C
Ivy, Applied and environmental microbiology 2012
- “...lmo1541 lmo1542 (rplU) lmo1556 (hemC) lmo1557 (hemA) lmo1589 (argB) lmo1590 (argJ) lmo1591 (argC) lmo1833 (pyrD) lmo1835 (pyrAB) lmo1929 (ndk) lmo1932 lmo2040...”
- “...after 5 and 15 min of acid shock are lmo1589 (argB), lmo1590 (argJ), and lmo1591 (argC); the three enzymes encoded by these genes are involved in conversion...”

A7ML88 Acetylglutamate kinase from Cronobacter sakazakii (strain ATCC BAA-894)
27% identity, 55% coverage

Chemotaxis and Shorter O-Antigen Chain Length Contribute to the Strong Desiccation Tolerance of a Food-Isolated Cronobacter sakazakii Strain
Qian, Frontiers in microbiology 2021
- “...change Arginine biosynthesis relevant LILKMKPI_03206 argA A7MR21 Amino-acid acetyltransferase 3.58 () 2.13 () LILKMKPI_00159 argB A7ML88 Acetylglutamate kinase 3.39 () 1.71 () LILKMKPI_00158 argC A7ML82 N-acetyl-gamma-glutamyl-phosphate reductase 1.71 () 3.62 () LILKMKPI_03766 argD A7ME32 Acetylornithine/succinyldiaminopimelate aminotransferase 1.54 () 2.29 () LILKMKPI_00157 argE A7ML83 Acetylornithine deacetylase 2.02...”

ACBG90_06560 amino-acid N-acetyltransferase from Stutzerimonas kunmingensis
26% identity, 58% coverage

Genomic Insights into Stutzerimonas kunmingensis TFRC-KFRI-1 Isolated from Manila Clam (Ruditapes philippinarum): Functional and Phylogenetic Analysis
Lee, Microorganisms 2024
- “...involved in arginine biosynthesis were identified, including argS (ACBG90_07960), argC (ACBG90_08560), argE (ACBG90_06555), and argA (ACBG90_06560). These genes play a critical role in protein biosynthesis and cellular metabolism. Genes associated with prokaryotic defense systems were also discovered, including components of the Type I restrictionmodification system, such...”

STM14_4957 acetylglutamate kinase from Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
27% identity, 55% coverage

Utilizing nutrient type compounds as anti-bacterial compounds: arginine and cysteine inhibit Salmonella survival in egg white
Ben-Porat, Frontiers in bioengineering and biotechnology 2024
- “...0.69005 STM14_3729 speA arginine decarboxylase 1.01 0.37472 0.90177 STM14_4175 argD_2 bifunctional N-succinyldiaminopimelate-aminotransferase 1.13 0.46895 0.93932 STM14_4957 argB acetylglutamate kinase 1.32 0.56035 0.96410 STM14_3973 argG argininosuccinate synthase 0.72 0.59484 0.97854 STM14_4958 argH argininosuccinate lyase 0.44 0.74602 0.99384 STM14_5361 STM14_5361 arginine deiminase 0.16 0.88496 0.99682 STM14_0818 speF ornithine...”

STM4122 acetylglutamate kinase from Salmonella typhimurium LT2
27% identity, 55% coverage

Global transcriptional analysis of dehydrated Salmonella enterica serovar Typhimurium
Gruzdev, Applied and environmental microbiology 2012
- “...prlC (STM3594) argE (STM4120) argC (STM4121) argB (STM4122) argD (STM1303) argI (STM4469) (Continued on following page) 7868 aem.asm.org Applied and...”
Intraspecies variation in the emergence of hyperinfectious bacterial strains in nature
Heithoff, PLoS pathogens 2012
- “...also known as psiE . ArgR STM2992 argA 0.51 2.71 3.50 N-acetylglutamate synthase [91] . STM4122 argB 0.56 1.64 2.74 Acetylglutamate kinase [91] . STM3468 argD 1.26 2.84 4.31 Bifunctional N-succinyldiaminopimelate-aminotransferase/acetylornithine transaminase protein [91] . STM3290 argG 0.17 1.54 1.24 Arginosuccinate synthase [91] . STM4123 argH...”

PMI2307 amino-acid acetyltransferase from Proteus mirabilis HI4320
22% identity, 60% coverage

Transcriptional analysis of the MrpJ network: modulation of diverse virulence-associated genes and direct regulation of mrp fimbrial and flhDC flagellar operons in Proteus mirabilis
Bode, Infection and immunity 2015
- “...PMI1702 PMI2292 ptsG PMI0287 PMI2528 hyfA PMI2755 lysC PMI2307 argA PMI0744 PMI0742 PMI2660 caiF PMI2825 def PMI0746 PMI2523 hyfF PMI3577 fdhF PMI0741 PMI2821...”

FGSG_01939 hypothetical protein from Fusarium graminearum PH-1
33% identity, 27% coverage

Comparison of Fusarium graminearum Transcriptomes on Living or Dead Wheat Differentiates Substrate-Responsive and Defense-Responsive Genes
Boedi, Frontiers in microbiology 2016
- “...arginine-specific large chain 0 3.1 2 FGSG_09638 Probable URA2multifunctional pyrimidine biosynthesis protein 0 3.6 2 FGSG_01939 Probable amino-acid N-acetyltransferase 0 3.2 3 FGSG_06094 Probable glutamate N-acetyltransferase precursor 3.20E-282 2.0 3, 6 FGSG_05003 Probable acetylglutamate kinase/N-acetyl- gamma-glutamyl-phosphate reductase precursor (ARG-6) 1.90E-211 2.2 4 FGSG_06281 Probable ornithine carbamoyltransferase...”

AT00_10695 acetylglutamate kinase from Pseudoalteromonas lipolytica SCSIO 04301
30% identity, 49% coverage

Molecular basis of the phenotypic variants arising from a Pseudoalteromonas lipolytica mutator
Zeng, Microbial genomics 2023
- “...G307S 1 M21 AT00_10245 Pantoate-beta-alanine ligase 736997 T574C Y192H 1 M22 Intergenic 744855 1 M23 AT00_10695 Acetylglutamate kinase 845179 C659T A220V 1 M24 AT00_10890 Purine metabolism 882529 A3203G D1068G 1 M25 AT00_12615 Alpha/beta hydrolase 86527 A101G N34S 1 M26 AT00_13635 Chemotaxis protein 311678 A176G D59G 1...”

Igni_0621 N2-acetyl-L-aminoadipate kinase from Ignicoccus hospitalis KIN4/I
27% identity, 49% coverage

Multi-omics analysis provides insight to the Ignicoccus hospitalis-Nanoarchaeum equitans association
Rawle, Biochimica et biophysica acta. General subjects 2017
- “...Co-culture Gene Identifier Annotation Type Igni_1228 L-glutamine synthetase p Igni_1400 Carbamoyl-phosphate synthase small subunit p Igni_0621 N-acetylglutamate kinase/N2-acetyl-L-aminoadipate kinase t Igni_0570 Asparagine synthase p L-asparagine m Igni_1349 Aspartate dehydrogenase p Igni_0641 Quinolinate synthetase A p Igni_0569 Hypothetical protein p Igni_0199 Aspartate kinase L-Aspartyl-4-Phosphate m Igni_1227 Phenylalanyl-tRNA...”

Sant_0864 amino-acid N-acetyltransferase from Sodalis praecaptivus
22% identity, 59% coverage

A Tale of Three Species: Adaptation of Sodalis glossinidius to Tsetse Biology, Wigglesworthia Metabolism, and Host Diet
Hall, mBio 2019
- “...in E. coli Size in S. praecaptivus Reaction S. glossinidius c Conclusion argA 1,332 bp Sant_0864 ACGS SGGMMB4_04654 (argA_1) argA_2 may produce a subunit that can function individually, using its GTG start codon 443 aa 418 aa SGGMMB4_04655 (argA_2) 804 bp total argB 777 bp Sant_3956...”

AT4G37670 GCN5-related N-acetyltransferase (GNAT) family protein / amino acid kinase family protein from Arabidopsis thaliana
25% identity, 33% coverage

Target of Rapamycin Regulates Genome Methylation Reprogramming to Control Plant Growth in Arabidopsis
Zhu, Frontiers in genetics 2020
- “...AT3G22425 0.4460 Hypo Promoter HISN5A| Imidazoleglycerol-phosphate dehydratase AT4G13890 0.5464 Hypo Exon SHM5| Pyridoxal phosphate-dependent transferase AT4G37670 0.5988 Hypo Exon/intron NAGS2| Acyl-CoA N -acyltransferase AT4G26970 0.6402 Hypo Exon/intron ACO3| Aconitase dehydratase large subunit AT1G22020 0.6478 Hypo Exon/intron SHM6| Pyridoxal phosphate-dependent transferase AT1G79530 0.6699 Hypo Promoter GAPCP1| Glyceraldehyde...”
Low CO2 induces urea cycle intermediate accumulation in Arabidopsis thaliana
Blume, PloS one 2019
- “...CCGTCCAGAGTTGTTGAACCG CCACGAGCCTCGACTTCAAGTC DIN4 AT3G13450 GACACTCCTTTCCCTCTAGTGTTCG ATTCACAGTGGATCTGATTGCATCC dOAT AT5G46180 TGTCCCCGGTTTCAGCTTAC AGCCTCAGATCCATCTCGGA IMD AT5G14200/AT1G31180 CGATGCTTCTCAAGTATGGACTTGG CCATTTCCTTGCATCCCACCAG NAGS2 AT4G37670 GAAGGAACCCGTGATGCCAGAG GCTCGCAGTAACTCCTCATCAGTTC OTC AT1G75330 CAAAGGCAAAGCAAGCTGGA CGGCTTCATCCTTTTGACCC P5CDH AT5G62530 GATAGGGACACCAGAGGCTATA GTAGATGGAGGAAGTTCCCAAC P5CS1 AT2G39800 GGTTGAGACTTGAGGAGAGACAC CCACTACATAAGCGAGGGTTTCAA PII AT4G01900 CCATCTTGCCTCGATTTGGTCAC CAGTAAAGCCGATGAAACTTGCTGG PP2A AT1G13320 CTGCAAACAATCTGAAGCGTCTTG CTGGAGCGAGAAGCGATACTG PRODH AT3G30775 GTGTCGTTCTCGCAACACATAACG CTTGCTAACATTGAACCCTGCTCTC Metabolite analysis Metabolite extraction...”
Phosphate starvation induces DNA methylation in the vicinity of cis-acting elements known to regulate the expression of phosphate-responsive genes
Yong-Villalobos, Plant signaling & behavior 2016
- “...AT4G35090 AT5G01180 AT1G47960 AT1G74590 AT2G16430 AT4G37670 AT5G22300 AT2G26760 AT3G02850 AT3G21870 AT3G60840 AT4G01820 AT1G66570 AT3G05690 AT3G47420 AT3G59884...”
Physiological implications of arginine metabolism in plants
Winter, Frontiers in plant science 2015
- “...a high level of similarity to two predicted Arabidopsis NAGS proteins, NAGS1 (At2g22910) and NAGS2 (At4g37670). A plastid transit peptide is predicted for Sl NAGS1 and the plastid localization is supported by the expression of SlNAGS1 in all aerial organs, whereas no expression was detected in...”
Plant SILAC: stable-isotope labelling with amino acids of arabidopsis seedlings for quantitative proteomics
Lewandowska, PloS one 2013
- “...for At4g33680, CATMA4a35440 for At4g33680) and six (SALK_047105 for At1g29900, SALK_038130 for At4g24830, SALK_070991 for At4g37670, SALK_070983 for At4g37670, SALK_138081 for At2g19940, SALK_085035 for At2g22910) knock-out mutants (T-DNA insertions) in genes in the lysine and arginine biosynthetic pathways, respectively. Some mutant lines showed poor growth phenotypes...”
Microarray analysis of transcriptional responses to abscisic acid and salt stress in Arabidopsis thaliana
Liu, International journal of molecular sciences 2013
- “...change Annotation AT4G20780 0.4886 0.2518 calcium-binding protein CML42 AT3G03780 0.4726 0.2624 threonine-protein kinase WNK-related protein AT4G37670 0.4649 0.2412 N -acetyl-l-glutamate synthase 2 AT2G23600 0.4647 0.4048 acetone-cyanohydrin lyase AT5G59080 0.4621 0.497 hypothetical protein AT4G14680 0.4594 0.3298 sulfate adenylyltransferase APS3 AT4G21870 0.458 0.1104 heat shock protein class V...”
Genome-wide analysis of histone modifiers in tomato: gaining an insight into their developmental roles
Aiese, BMC genomics 2013
- “...number close to tomato. Based on the domain composition, in Arabidopsis we identified At2g22910 and At4g37670 which in addition to AT1 have the AAK domain (PF00696). Similarly to tomato, it is likely that these two proteins are not histone acetylases. Phylogenetic analysis of tomato and Arabidopsis...”
Transcriptional profiling of an Fd-GOGAT1/GLU1 mutant in Arabidopsis thaliana reveals a multiple stress response and extensive reprogramming of the transcriptome
Kissen, BMC genomics 2010
- “...6.3.2.3 glutathione synthetase GSH2 AT5G27380 0.855 1.4.1.3 glutamate dehydrogenase GDH2 AT5G07440 1.126 2.3.1.1 N-acetyltransferase NAGS AT4G37670 0.755 6.3.5.5 carbamoyl-phosphate synthase CPS AT3G27740 0.696 6.3.5.5 carbamoyl-phosphate synthase CPS AT1G29900 0.701 2.1.3.3 ornithine carbamoyltransferase OTC AT1G75330 0.436 6.3.4.5 arginosuccinate synthase AS AT4G24830 0.596 nitrate transporter NRT1.1 AT1G12110 0.432...”
More

VP2371 N-acetylglutamate synthase from Vibrio parahaemolyticus RIMD 2210633
21% identity, 56% coverage

Transcriptome analysis of Vibrio parahaemolyticus in type III secretion system 1 inducing conditions
Nydam, Frontiers in cellular and infection microbiology 2014
- “...Hypothetical protein 3.9 4.0 7.8 19.2 39.2 vp2070 Hypothetical protein 8.6 62.9 70.2 87.1 246.1 vp2371 N-acetylglutamate synthase COG0548E 5.6 8.2 8.7 16.5 16.4 vp2553 RNA polymerase sigma factor RpoS COG0568K 1.6 2.1 3.1 5.2 10.5 vp2756 Bifunctional argininosuccinate lyase/N-acetylglutamate synthase COG0165E 7.5 13.1 14.4 23.4...”
- “...symporter ( vpa0035 ), glutamate synthase subunits ( vp0481 , vp0483 ), N-acetylglutamate synthase ( vp2371 ), arginosuccinate lyase/N-acetylglutamate synthase ( vp2756 ), arginosuccinate synthase ( vp2757 ), and acetylglutamate kinase ( vp2758 ) (Xu et al., 2006 ). A gene encoding arginine transporter permease subunit...”

PH1718 hypothetical protein from Pyrococcus horikoshii OT3
29% identity, 53% coverage

The primordial metabolism: an ancestral interconnection between leucine, arginine, and lysine biosynthesis
Fondi, BMC evolutionary biology 2007
- “...biosynthesis as well as in the AAA variant of lysine biosynthesis, and that ORF PH1720, PH1718, PH1716, and PH1715 (Figure 3b ) might be involved in the biosynthesis of both lysine (through the AAA one) and arginine. Even though it cannot be ruled a priori out...”

VC2316 N-acetylglutamate synthase from Vibrio cholerae O1 biovar eltor str. N16961
22% identity, 57% coverage

Conservation of the binding site for the arginine repressor in all bacterial lineages
Makarova, Genome biology 2001
- “...4.52 tATGAATAAAtATgCAca HI1727 -64 3.87 AtaGAATttttATTCAca -43 3.75 AtcGAtTAtttATTCAaT HI1180-77 -50 4.01 tATGcATAAAAATgtAaT V. cholerae VC2316 -15 3.82 AaaGAATAAAAAgTCATT VC2390-89 -52 3.57 ttTGcAaAAtAATTtATT VC2508 -72 3.72 ttaaAATAtttATTCAcT -51 3.35 AtaGcATtttcATgCtTT VC2618 -120 3.83 AaTaAATgtAAATaCAaT VC2644-42 -76 3.00 AacacATAttAAaTCAcT -55 4.00 AGTGAATAAAAAaaCAaT VC2645 -79 3.50 AtTGttTttttATTCAcT -58...”

XP_010317758 N-acetyl-glutamate synthase isoform X1 from Solanum lycopersicum
27% identity, 29% coverage

Over-expression of a tomato N-acetyl-L-glutamate synthase gene (SlNAGS1) in Arabidopsis thaliana results in high ornithine levels and increased tolerance in salt and drought stresses.
Kalamaki, Journal of experimental botany 2009
- GeneRIF: Transgenic Arabidopsis plants expressing the SlNAGS1 gene showed significant accumulation of ornithine in the leaves and displayed a higher tolerance to salt and drought stress compared to WT plants. [SlNAGS1]

VIBHAR_03295 N-acetylglutamate synthase from Vibrio harveyi ATCC BAA-1116
21% identity, 55% coverage

Transcriptional regulation of opaR, qrr2-4 and aphA by the master quorum-sensing regulator OpaR in Vibrio parahaemolyticus
Zhang, PloS one 2012
- “...[30] $ luxC VIBHAR_06244 TACAAATAACATTAATAATT D-275-256 8.49 [58] # TATAAATAAATCAAACTATA D-151-132 8.88 [58] # argA VIBHAR_03295 AATTGAATAAGAAGACAATA D-64-45 6.6 [59] # V. parahaemolyticus RIMD 2210633 opaR VP2516 TAATGACATTACTGTCTATA D-149-130 9.99 This study $ AATTATTAAAATAATCAATT D-68-49 11.29 This study $ qrr2 VPA16231624 intergenic GACTAACTCAATTGTTAATA D-167-148 7.8 This...”

C4NFG1 amino-acid N-acetyltransferase (EC 2.3.1.1) from Solanum lycopersicum (see paper)
27% identity, 29% coverage

PSHAa2290 acetylglutamate kinase (NAG kinase) (AGK) (N-acetyl-L-glutamate 5-phosphotransferase) from Pseudoalteromonas haloplanktis TAC125
29% identity, 50% coverage

Modelling microbial metabolic rewiring during growth in a complex medium
Fondi, BMC genomics 2016
- “...of its genes Cluster name Motif name Genes Weblogo Cluster 2 ArgR PSHAa0194, PSHAa0698,PSHAa2175, PSHAa2287, PSHAa2290, PSHAa2291, PSHAa2292, PSHAb0333, PSHAb0428, PSHAb0543 Cluster 3 CcpA PSHAa0189, PSHAa0609, PSHAa0740, PSHAa1167, PSHAa1648, PSHAa1649, PSHAa1650, PSHAa1651, PSHAa2167, PSHAb0082, PSHAb0345 Cluster 6 GalR PSHAa0603, PSHAa0871, PSHAa1364, PSHAa1767, PSHAa2301, PSHAb0295 Cluster 2....”

3b8gA / Q5FAK7 Crysta structure of n-acetylglutamate synthase from neisseria gonorrhoeae complexed with coenzyme a and n-acetyl-glutamate (see paper)
24% identity, 61% coverage

Ligands: coenzyme a; n-acetyl-l-glutamate (3b8gA)

NP_179875 N-acetyl-l-glutamate synthase 1 from Arabidopsis thaliana
AT2G22910 GCN5-related N-acetyltransferase (GNAT) family protein / amino acid kinase family protein from Arabidopsis thaliana
25% identity, 33% coverage

Can ornithine accumulation modulate abiotic stress tolerance in Arabidopsis?
Kalamaki, Plant signaling & behavior 2009
- GeneRIF: Tomata SlNAGS1 accumulation patterns suggest a possible role of this gene in hypoxia-induced responses. The 35S::SlNAGS1 Arabidopsis plants accumulated ornithine at high levels and exhibited increased tolerance to salt and drought stresses. [NAGS1]
Comprehensive Transcriptome and Proteome Analyses Reveal the Drought Responsive Gene Network in Potato Roots
Qin, Plants (Basel, Switzerland) 2024
- “...protein Q9 yellow Soltu.DM.04G020610 AT3G48310 cytochrome P450, family 71, subfamily A, polypeptide Q9 yellow Soltu.DM.02G027580 AT2G22910 N-acetyl-l-glutamate synthase Q9 yellow Soltu.DM.08G020150 AT4G19230 cytochrome P450, family 707, subfamily A, polypeptide Q9 yellow Soltu.DM.06G034620 AT3G22600 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein Q9 yellow Soltu.DM.09G025790 AT1G06760 winged-helix...”
What Antarctic Plants Can Tell Us about Climate Changes: Temperature as a Driver for Metabolic Reprogramming
Bertini, Biomolecules 2021
- “...10 3 1.86 AT3G49830 P-loop containing nucleoside triphosphate hydrolases superfamily protein 6.41 10 4 1.75 AT2G22910 NAGS1, N-acetyl-l-glutamate synthase 1 2.32 10 3 1.69 AT4G17170 AT-RAB2, ATRAB-B1B, ATRAB2A, ATRABB1C, RAB-B1B, RAB2A, RABB1C, RAB GTPase homolog B1C 9.62 10 3 1.51 AT2G22780 PMDH1, peroxisomal NAD-malate dehydrogenase 1...”
Extensive Natural Variation in Arabidopsis Seed Mucilage Structure
Voiniciuc, Frontiers in plant science 2016
- “...). While At2g22870 ( EMBRYO DEFECTIVE 2001, EMB2001 ) is primarily expressed in the embryo, At2g22910 ( NAGS1 ), which is predicted to facilitate amino acid synthesis (Kalamaki et al., 2009 ) is expressed at low levels throughout seed coat development (Supplemental Figure 4 ). Since...”
- “...finger family protein Chr2 8973773 6.04 At2g20840 Secretory carrier membrane protein (SCAMP3) Chr2 9750472 7.36 At2g22910 N-acetyl-l-glutamate synthase 1 (NAGS1) Chr2 9751265 7.36 Chr2 9751714 7.36 Chr2 9752535 6.77 Chr2 10799538 6.94 At2g25350 Phox (PX) domain-containing protein Chr3 5368453 6.10 At3g15880 WUS-interacting protein 2 (WSIP2) Chr3...”
ROOT HAIR DEFECTIVE SIX-LIKE4 (RSL4) promotes root hair elongation by transcriptionally regulating the expression of genes required for cell growth
Vijayakumar, The New phytologist 2016
- “...superfamily protein AT3G57570 ARM repeat superfamily protein AT4G26400 RING/Ubox protein/zinc ion binding, response to chitin AT2G22910 NAGS1 Nacetyllglutamate synthase 1/arginine biosynthesis AT5G61570 Protein kinase family protein/phosphorylation AT3G24350 SYP32 SYNTAXIN OF PLANTS 32/vesiclemediated transport AT4G00830 LIF2 LHP1Interacting Factor 2, RNAbinding partner of LHP1 (Polycomb complex component)/controls flowering,...”
Physiological implications of arginine metabolism in plants
Winter, Frontiers in plant science 2015
- “...NAGS protein shows a high level of similarity to two predicted Arabidopsis NAGS proteins, NAGS1 (At2g22910) and NAGS2 (At4g37670). A plastid transit peptide is predicted for Sl NAGS1 and the plastid localization is supported by the expression of SlNAGS1 in all aerial organs, whereas no expression...”
Plant SILAC: stable-isotope labelling with amino acids of arabidopsis seedlings for quantitative proteomics
Lewandowska, PloS one 2013
- “...At1g29900, SALK_038130 for At4g24830, SALK_070991 for At4g37670, SALK_070983 for At4g37670, SALK_138081 for At2g19940, SALK_085035 for At2g22910) knock-out mutants (T-DNA insertions) in genes in the lysine and arginine biosynthetic pathways, respectively. Some mutant lines showed poor growth phenotypes under normal conditions and some of the arginine pathway...”
Genome-wide analysis of histone modifiers in tomato: gaining an insight into their developmental roles
Aiese, BMC genomics 2013
- “...giving a number close to tomato. Based on the domain composition, in Arabidopsis we identified At2g22910 and At4g37670 which in addition to AT1 have the AAK domain (PF00696). Similarly to tomato, it is likely that these two proteins are not histone acetylases. Phylogenetic analysis of tomato...”
Over-expression of a tomato N-acetyl-L-glutamate synthase gene (SlNAGS1) in Arabidopsis thaliana results in high ornithine levels and increased tolerance in salt and drought stresses
Kalamaki, Journal of experimental botany 2009
- “...as reviewed in Slocum, 2005 ; Caldovic and Tuchman, 2003 ). Two highly similar genes (At2g22910 and At4g37670) have been predicted as NAGS in the Arabidopsis genome. They share structural similarity to the E. coli argA gene, in terms of exhibiting an N-terminal N -acetylglutamate kinase...”
- “...involved in arginine synthesis and degradation, Slocum found that At4g37670 is more transcriptionaly active than At2g22910 ( Slocum, 2005 ). To date, the sequences of a number of putative NAGS expressed sequence tags (ESTs) from various plant species, such as corn, rice, soybean and tomato have...”

ARGB_THET2 / Q72HA9 Acetylglutamate kinase; N-acetyl-L-glutamate 5-phosphotransferase; NAG kinase; NAGK; EC 2.7.2.8 from Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27) (see paper)
TTC1586 No description from Thermus thermophilus HB27
33% identity, 22% coverage

function: Catalyzes the ATP-dependent phosphorylation of N-acetyl-L- glutamate.
catalytic activity: N-acetyl-L-glutamate + ATP = N-acetyl-L-glutamyl 5-phosphate + ADP (RHEA:14629)
Structural insight into amino group-carrier protein-mediated lysine biosynthesis: crystal structure of the LysZ·LysW complex from Thermus thermophilus
Yoshida, The Journal of biological chemistry 2015
- “...yield pET26b-lysZ. In the functional analysis of TTC1586, which is another N-acetylglutamate kinase (NAGK) homolog of T. thermophilus HB27, the...”
- “...of the reaction product after the enzyme reaction between TTC1586 and TtLysZ, respectively. To examine activity as NAGK, the reaction was performed with 200 mM...”

New Search

For advice on how to use these tools together, see Interactive tools for functional annotation of bacterial genomes.

Statistics

The PaperBLAST database links 793,807 different protein sequences to 1,259,118 scientific articles. Searches against EuropePMC were last performed on March 13 2025.

How It Works

PaperBLAST builds a database of protein sequences that are linked to scientific articles. These links come from automated text searches against the articles in EuropePMC and from manually-curated information from GeneRIF, UniProtKB/Swiss-Prot, BRENDA, CAZy (as made available by dbCAN), BioLiP, CharProtDB, MetaCyc, EcoCyc, TCDB, REBASE, the Fitness Browser, and a subset of the European Nucleotide Archive with the /experiment tag. Given this database and a protein sequence query, PaperBLAST uses protein-protein BLAST to find similar sequences with E < 0.001.

To build the database, we query EuropePMC with locus tags, with RefSeq protein identifiers, and with UniProt accessions. We obtain the locus tags from RefSeq or from MicrobesOnline. We use queries of the form "locus_tag AND genus_name" to try to ensure that the paper is actually discussing that gene. Because EuropePMC indexes most recent biomedical papers, even if they are not open access, some of the links may be to papers that you cannot read or that our computers cannot read. We query each of these identifiers that appears in the open access part of EuropePMC, as well as every locus tag that appears in the 500 most-referenced genomes, so that a gene may appear in the PaperBLAST results even though none of the papers that mention it are open access. We also incorporate text-mined links from EuropePMC that link open access articles to UniProt or RefSeq identifiers. (This yields some additional links because EuropePMC uses different heuristics for their text mining than we do.)

For every article that mentions a locus tag, a RefSeq protein identifier, or a UniProt accession, we try to select one or two snippets of text that refer to the protein. If we cannot get access to the full text, we try to select a snippet from the abstract, but unfortunately, unique identifiers such as locus tags are rarely provided in abstracts.

PaperBLAST also incorporates manually-curated protein functions:

Proteins from NCBI's RefSeq are included if a GeneRIF entry links the gene to an article in PubMed^®. GeneRIF also provides a short summary of the article's claim about the protein, which is shown instead of a snippet.
Proteins from Swiss-Prot (the curated part of UniProt) are included if the curators identified experimental evidence for the protein's function (evidence code ECO:0000269). For these proteins, the fields of the Swiss-Prot entry that describe the protein's function are shown (with bold headings).
Proteins from BRENDA, a curated database of enzymes, are included if they are linked to a paper in PubMed and their full sequence is known.
Every protein from the non-redundant subset of BioLiP, a database of ligand-binding sites and catalytic residues in protein structures, is included. Since BioLiP itself does not include descriptions of the proteins, those are taken from the Protein Data Bank. Descriptions from PDB rely on the original submitter of the structure and cannot be updated by others, so they may be less reliable. (For SitesBLAST and Sites on a Tree, we use a larger subset of BioLiP so that every ligand is represented among a group of structures with similar sequences, but for PaperBLAST, we use the non-redundant set provided by BioLiP.)
Every protein from EcoCyc, a curated database of the proteins in Escherichia coli K-12, is included, regardless of whether they are characterized or not.
Proteins from the MetaCyc metabolic pathway database are included if they are linked to a paper in PubMed and their full sequence is known.
Proteins from the Transport Classification Database (TCDB) are included if they have known substrate(s), have reference(s), and are not described as uncharacterized or putative. (Some of the references are not visible on the PaperBLAST web site.)
Every protein from CharProtDB, a database of experimentally characterized protein annotations, is included.
Proteins from the CAZy database of carbohydrate-active enzymes are included if they are associated with an Enzyme Classification number. Even though CAZy does not provide links from individual protein sequences to papers, these should all be experimentally-characterized proteins.
Proteins from the REBASE database of restriction enzymes are included if they have known specificity.
Every protein with an evidence-based reannotation (based on mutant phenotypes) in the Fitness Browser is included.
Sequence-specific transcription factors (including sigma factors and DNA-binding response regulators) with experimentally-determined DNA binding sites from the PRODORIC database of gene regulation in prokaryotes.
Putative transcription factors from RegPrecise that have manually-curated predictions for their binding sites. These predictions are based on conserved putative regulatory sites across genomes that contain similar transcription factors, so PaperBLAST clusters the TFs at 70% identity and retains just one member of each cluster.
Coding sequence (CDS) features from the European Nucleotide Archive (ENA) are included if the /experiment tag is set (implying that there is experimental evidence for the annotation), the nucleotide entry links to paper(s) in PubMed, and the nucleotide entry is from the STD data class (implying that these are targeted annotated sequences, not from shotgun sequencing). Also, to filter out genes whose transcription or translation was detected, but whose function was not studied, nucleotide entries or papers with more than 25 such proteins are excluded. Descriptions from ENA rely on the original submitter of the sequence and cannot be updated by others, so they may be less reliable.

Except for GeneRIF and ENA, the curated entries include a short curated description of the protein's function. For entries from BioLiP, the protein's function may not be known beyond binding to the ligand. Many of these entries also link to articles in PubMed.

For more information see the PaperBLAST paper (mSystems 2017) or the code. You can download PaperBLAST's database here.

Changes to PaperBLAST since the paper was written:

November 2023: incorporated PRODORIC and RegPrecise. Many PRODORIC entries were not linked to a protein sequence (no UniProt identifier), so we added this information.
February 2023: BioLiP changed their download format. PaperBLAST now includes their non-redundant subset. SitesBLAST and Sites on a Tree use a larger non-redundant subset that ensures that every ligand is represented within each cluster. This should ensure that every binding site is represented.
June 2022: incorporated some coding sequences from ENA with the /experiment tag.
March 2022: incorporated BioLiP.
April 2020: incorporated TCDB.
April 2019: EuropePMC now returns table entries in their search results. This has expanded PaperBLAST's database, but most of the new entries are of low relevance, and the resulting snippets are often just lists of locus tags with annotations.
February 2018: the alignment page reports the conservation of the hit's functional sites (if available from from Swiss-Prot or UniProt)
January 2018: incorporated BRENDA.
December 2017: incorporated MetaCyc, CharProtDB, CAZy, REBASE, and the reannotations from the Fitness Browser.
September 2017: EuropePMC no longer returns some table entries in their search results. This has shrunk PaperBLAST's database, but has also reduced the number of low-relevance hits.

Many of these changes are described in Interactive tools for functional annotation of bacterial genomes.

Secrets

PaperBLAST cannot provide snippets for many of the papers that are published in non-open-access journals. This limitation applies even if the paper is marked as "free" on the publisher's web site and is available in PubmedCentral or EuropePMC. If a journal that you publish in is marked as "secret," please consider publishing elsewhere.

Omissions from the PaperBLAST Database

Many important articles are missing from PaperBLAST, either because the article's full text is not in EuropePMC (as for many older articles), or because the paper does not mention a protein identifier such as a locus tag, or because of PaperBLAST's heuristics. If you notice an article that characterizes a protein's function but is missing from PaperBLAST, please notify the curators at UniProt or add an entry to GeneRIF. Entries in either of these databases will eventually be incorporated into PaperBLAST. Note that to add an entry to UniProt, you will need to find the UniProt identifier for the protein. If the protein is not already in UniProt, you can ask them to create an entry. To add an entry to GeneRIF, you will need an NCBI Gene identifier, but unfortunately many prokaryotic proteins in RefSeq do not have corresponding Gene identifers.

References

PaperBLAST: Text-mining papers for information about homologs.
M. N. Price and A. P. Arkin (2017). mSystems, 10.1128/mSystems.00039-17.

Europe PMC in 2017.
M. Levchenko et al (2017). Nucleic Acids Research, 10.1093/nar/gkx1005.

Gene indexing: characterization and analysis of NLM's GeneRIFs.
J. A. Mitchell et al (2003). AMIA Annu Symp Proc 2003:460-464.

UniProt: the universal protein knowledgebase.
The UniProt Consortium (2016). Nucleic Acids Research, 10.1093/nar/gkw1099.

BRENDA in 2017: new perspectives and new tools in BRENDA.
S. Placzek et al (2017). Nucleic Acids Research, 10.1093/nar/gkw952.

The EcoCyc database: reflecting new knowledge about Escherichia coli K-12.
I. M. Keeseler et al (2016). Nucleic Acids Research, 10.1093/nar/gkw1003.

The MetaCyc database of metabolic pathways and enzymes.
R. Caspi et al (2018). Nucleic Acids Research, 10.1093/nar/gkx935.

CharProtDB: a database of experimentally characterized protein annotations.
R. Madupu et al (2012). Nucleic Acids Research, 10.1093/nar/gkr1133.

The carbohydrate-active enzymes database (CAZy) in 2013.
V. Lombard et al (2014). Nucleic Acids Research, 10.1093/nar/gkt1178.

The Transporter Classification Database (TCDB): recent advances
M. H. Saier, Jr. et al (2016). Nucleic Acids Research, 10.1093/nar/gkv1103.

REBASE - a database for DNA restriction and modification: enzymes, genes and genomes.
R. J. Roberts et al (2015). Nucleic Acids Research, 10.1093/nar/gku1046.

Deep annotation of protein function across diverse bacteria from mutant phenotypes.
M. N. Price et al (2016). bioRxiv, 10.1101/072470.

by Morgan Price, Arkin group
Lawrence Berkeley National Laboratory