Searching for up to 100 curated homologs for ABID97_RS24730 (78 a.a.)

Found high-coverage hits (≥70%) to 4 curated proteins.

You can add additional sequences or change the %identity threshold for inclusion. Once you have selected sequences, you can build an alignment and a tree.

Hits with ≥ 30% identity

Fis / b3261 DNA-binding transcriptional dual regulator Fis from Escherichia coli K-12 substr. MG1655 (see 8 papers)
FIS_ECOLI / P0A6R3 DNA-binding protein Fis; Factor-for-inversion stimulation protein; Hin recombinational enhancer-binding protein from Escherichia coli (strain K12) (see 4 papers)
Fis / P0A6R3 Transcription factor Fis (activator/repressor) from Escherichia coli K12 MG1655 (see 25 papers)
Fis / FIS_SALTI Transcription factor Fis (repressor) from Salmonella enterica
5ds9B / P0A6R3 Crystal structure of fis bound to 27bp DNA f1-8a (aaattagtttgaattttgagctaattt) (see paper)
fis / GB|AAN44763.1 DNA-binding protein fis from Shigella sonnei Ss046 (see 13 papers)
    42% identity, 97% coverage of query (71.2 bits)

1fipA The structure of fis mutant pro61ala illustrates that the kink within the long alpha-helix is not due to the presence of the proline residue
    42% identity, 91% coverage of query (65.9 bits)

ntrC / CAA86065.1 Nitrogen assimilation regulatory protein from Azospirillum brasilense (see paper)
    48% identity, 79% coverage of query (57.8 bits)

P10577 DNA-binding transcriptional regulator NtrC; Nitrogen regulation protein NR(I); Nitrogen regulator I; NRI from Rhizobium meliloti (strain 1021) (Ensifer meliloti) (Sinorhizobium meliloti)
    42% identity, 87% coverage of query (52.8 bits)

Build an alignment

Build an alignment for ABID97_RS24730 and 4 homologs with ≥ 30% identity

Or download the sequences

No additional hits (below 30% identity) were found

Or start over